CN1385441A - Novel human lymphokine, its coding sequence and use - Google Patents

Novel human lymphokine, its coding sequence and use Download PDF

Info

Publication number
CN1385441A
CN1385441A CN 01112889 CN01112889A CN1385441A CN 1385441 A CN1385441 A CN 1385441A CN 01112889 CN01112889 CN 01112889 CN 01112889 A CN01112889 A CN 01112889A CN 1385441 A CN1385441 A CN 1385441A
Authority
CN
China
Prior art keywords
polypeptide
sequence
polynucleotide
people
protein
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN 01112889
Other languages
Chinese (zh)
Other versions
CN1234728C (en
Inventor
罗楹
吴骏
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shanghai Genomics Inc
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Individual filed Critical Individual
Priority to CN 01112889 priority Critical patent/CN1234728C/en
Publication of CN1385441A publication Critical patent/CN1385441A/en
Application granted granted Critical
Publication of CN1234728C publication Critical patent/CN1234728C/en
Anticipated expiration legal-status Critical
Expired - Fee Related legal-status Critical Current

Links

Images

Landscapes

  • Peptides Or Proteins (AREA)

Abstract

The present invention provides a novel human lymphokine-JY1 protein, polynucleotide for coding JY1 protein and method for producing this JY1 protein by using recombination technology. JY1 protein is homogeneous molecule of TSLP. Said ivnention also discloses the application of polynucleotide coding this JY1 protein, also discloses the method for curing several diseases (such as tumor, inflammation and immunological system diseases) by using said JY1 protein receptor. Said invention also provides the medicine composition containing JY1 protein.

Description

New human lymphokine, its encoding sequence and purposes
The invention belongs to biotechnology and medical field, specifically, the present invention relates to the polynucleotide of new coding human lymphokine-JY1, and the polypeptide of this polynucleotide encoding.The invention still further relates to the purposes and the preparation of these polynucleotide and polypeptide.Specifically, polypeptide of the present invention is a kind of new lymphokine relevant with immunity, and it is the proteic homolgous molecule of mouse TSLP.
Cell growth factor can influence lymphocytic growth in immune response, therefore immunity is reconciled playing a key effect.Just great promoter action is played in bone-marrow-derived lymphocyte and the lymphocytic growth of T and hyperplasia such as interleukin-17.At the antibody of the acceptor of interleukin-17 just can obviously suppress bone-marrow-derived lymphocyte in vivo with external growth.
In the past few years, the researchist has dropped into a large amount of energy to B and T lymphocyte from the process that immature precursor cell develops into the mature cell of function.The researchist finds, this process is subjected to the conciliation of the part that the overlapped solubility of multiple function and symphysis connect.Although having had a series ofly can influence lymphocyte differentiation and outgrowth cytokine is found, in vitro system, the researchist can't break up outgrowth each step in vivo with these factor reduction lymphocytes.Obviously, should there be more cytokine to remain to be discovered.
In 1994, the researchist found a kind of activity of new lymphocyte factor for the first time, and this activity is identified from mouse thymus matrix (stromal) cell, at that time the sequence of its gene and not knowing.Discover that the function of this new factor should be overlapping to some extent with the function of interleukin-17, can stimulate thymocyte and T lymphocyte, also can promote the ripe and growth of the bone-marrow-derived lymphocyte precursor in embryonic liver and marrow.The TSLP gene of mouse was finally cloned by the Paxton laboratory in 2000, and its acceptor was also cloned in same year.As other increase the hemocyte factor, the shared wherein chain of each autoreceptor of mouse TSLP and interleukin-17.Another chain of mouse TSLP acceptor is TSLPR clone in 2000.Mouse TSLP is the same with interleukin-17, can both activate STAT5, but the activated mode is distinguished to some extent.
The TSLP gene of mouse was cloned by USA I MUNEX company on September 4th, 2000, and its DNA and protein sequence are delivered on The Journal of Experimental Medicine.The albumen total length is 140 amino acid.Do not stop coding owing to translate before ATG, so the researchist suspects that the albumen that this gene compiles may be than known length, promptly this gene might not be the gene of total length.This little musculus cdna all has expression in thymus gland, spleen, marrow, lymphoglandula and lung, but does not find to have expression in brain, liver, the heart and skeletal muscle.
Although the TSLP of mouse is cloned, human corresponding TSLP is still undiscovered.In view of lymphokine often plays a significant role in human body, it is unusual or variation is frequent and some disease-related, so this area presses for the new new lymphokine of exploitation.
The purpose of this invention is to provide a kind of new human lymphokine JY1 albumen with and fragment, analogue and derivative.
Another object of the present invention provides the polynucleotide of these polypeptide of coding.
Another object of the present invention provides the method for these polypeptide of production and the purposes of this polypeptide and encoding sequence.
In a first aspect of the present invention, novel isolated JY1 polypeptide is provided, this polypeptide is the people source, it comprises: have SEQ ID NO:2 or six amino acid polypeptide of sequence or its conservative property variation polypeptide or its active fragments or its reactive derivative.Preferably, this polypeptide is to have SEQ ID NO:2 or six amino acid polypeptide of sequence.
In a second aspect of the present invention, the polynucleotide of isolating these polypeptide of coding are provided, these polynucleotide comprise a nucleotide sequence, and this nucleotide sequence is shown at least 70% homogeny with a kind of nucleotides sequence that is selected from down group: (a) polynucleotide of the above-mentioned people JY1 polypeptide of coding; (b) with polynucleotide (a) complementary polynucleotide.Preferably, this polynucleotide encoding has the polypeptide of aminoacid sequence shown in SEQ ID NO:2 or 6.More preferably, the sequence of these polynucleotide is be selected from down group a kind of: the sequence that (a) has 53-529 position among the SEQ ID NO:1; (b) has the sequence of 137-529 position among the SEQ ID NO:1; (c) has the sequence of 1-557 position among the SEQ ID NO:1.
In a third aspect of the present invention, the carrier that contains above-mentioned polynucleotide is provided, and has been transformed or host cell of transduceing or the host cell that is directly transformed or transduce by above-mentioned polynucleotide by this carrier.
In a fourth aspect of the present invention, provide preparation to have the method for the polypeptide of people JY1 protein-active, this method comprises: (a) under the proteic condition of suitable expressing human JY1, cultivate the above-mentioned host cell that is transformed or transduce; (b) from culture, isolate polypeptide with people JY1 protein-active.
In a fifth aspect of the present invention, provide and above-mentioned people JY1 polypeptid specificity bonded antibody.The nucleic acid molecule that can be used for detecting also is provided, and it contains a successive 10-557 Nucleotide in the above-mentioned polynucleotide.
In a sixth aspect of the present invention, the compound of simulation, promotion, antagonism people JY1 polypeptide active is provided, and the compound that suppresses people JY1 polypeptide expression.The method of screening and/or prepare these compounds also is provided.Preferably, this compound is encoding sequence or its segmental antisense sequences of people JY1 polypeptide.
In a seventh aspect of the present invention, provide and whether had the proteic method of JY1 in the test sample, it comprises: sample is contacted with the proteic specific antibody of JY1, observe whether form antibody complex, formed antibody complex and just represented to exist in the sample JY1 albumen.
In a eighth aspect of the present invention, a kind of disease relevant with people JY1 polypeptide unconventionality expression or method of disease susceptibility of detecting is provided, this method comprises: whether have sudden change in the nucleotide sequence of detection coding said polypeptide.
In a ninth aspect of the present invention, provide the purposes of polypeptide of the present invention and encoding sequence.Polypeptide for example of the present invention can be used to screen the agonist that promotes people JY1 polypeptide active, and perhaps screening suppresses the antagonist of people JY1 polypeptide active or is used to the peptide finger print identification.The proteic encoding sequence of people JY1 of the present invention or its fragment can be used as primer and be used for pcr amplification reaction, perhaps are used for hybridization as probe, perhaps are used to make gene chip or microarray.
In a tenth aspect of the present invention, a kind of pharmaceutical composition is provided, it contains people JY1 polypeptide of the present invention or its agonist, antagonist and the pharmaceutically acceptable carrier of safe and effective amount.These pharmaceutical compositions can be treated illnesss such as tumour, inflammation, dysimmunity.
Others of the present invention are because disclosing of the technology of this paper is conspicuous to those skilled in the art.
Following figure is used to illustrate specific embodiments of the present invention, and is not used in qualification by the scope of the invention that claims defined.
Fig. 1 is the genome sequence of human lymphokine JY1 of the present invention, and wherein the gt of the intersection of exon and intron and ag mark with horizontal line.Start code ATG that albumen is translated and termination coding TAG, TGA or TAA also mark with big sign character.Exon marks with runic.
Fig. 2 has shown that some compilings have the human EST fragment nucleotide sequence of similar protein.
Fig. 3 is the cDNA sequence of lymphokine JY1, and wherein non-coding sequence is represented with lowercase, and encoding sequence is represented with capitalization.
Fig. 4 is the proteic full length amino acid sequence of people JY1 of the present invention.Wherein the 1-28 amino acids of N end has constituted signal peptide.
Fig. 5 is the amino acid sequence homology comparison diagram of human lymphokine JY1 of the present invention and mouse TSLP.The top sequence is people JY1, and the below sequence is a people TSLP albumen.Identical amino acid marks with the monocase abbreviation between two sequences, and similar amino acid marks with "+".Identical halfcystine below sequence with " *" mark.
Fig. 6 is the electrophorogram of people JY1 albumen coded sequence of the present invention.
Fig. 7 is the Northern trace collection of illustrative plates of people JY1 of the present invention.
Fig. 8 is the proteic electrophorogram of recombinant human JY1 of the present invention.
Fig. 9 is presented at lymphokine JY1 (10ng/ milliliter) to be stimulated down, and IgM positive B lymphocyte number obviously increases.
Figure 10 has shown the activation of reorganization lymphokine JY1 to dendritic cell.
Figure 11 has shown by the hormesis of reorganization lymphokine JY1 activated dendritic cell to the lymphocytic growth of T.
The activation of restructuring lymphokine JY1 to BMDC.
In the present invention, term " JY1 albumen ", " JY1 polypeptide " or " lymphokine JY1 " are used interchangeably, and all refer to have albumen or the polypeptide of people's lymphokine JY1 amino acid sequence (SEQ ID NO:2 or 6). They comprise the lymphokine JY1 that contains or do not contain initial methionine.
As used herein, " separation " refers to that material separates (if crude, primal environment is namely natural surroundings) from its primal environment. There is no separation and purification as the polynucleotide under the native state in active somatic cell and polypeptide, but same polynucleotide or polypeptide as from native state with in other materials that exist separately, for separation and purification.
As used herein, " JY1 albumen or the polypeptide of separation " refers to that the JY1 polypeptide is substantially free of natural relative other albumen, lipid, carbohydrate or other material. Those skilled in the art can use the purified technology of protein purifying JY1 albumen of standard. Basically pure polypeptide can produce single master tape on non-reduced polyacrylamide gel.
Polypeptide of the present invention can be restructuring polypeptide, natural polypeptides, synthetic polypeptide, the polypeptide of preferably recombinating. Polypeptide of the present invention can be the product of natural purifying, or the product of chemical synthesis, or uses the restructuring technology to produce from protokaryon or eucaryon host (for example, bacterium, yeast, higher plant, insect and mammalian cell). According to restructuring production decision host used, polypeptide of the present invention can be glycosylated, can be maybe nonglycosylated. Polypeptide of the present invention also can comprise or not comprise initial methionine residue.
the present invention also comprises fragment, derivative and the analog of people JY1 albumen. as used herein, term " fragment ", " derivative " refer to basically keep the identical biological function of natural people JY1 albumen of the present invention or active polypeptide with " analog ". polypeptide fragment of the present invention, derivative or analog can be that (i) has one or more conservative or substituted polypeptide of non-conservation amino acid residue (preferred conservative amino acid residue), and the amino acid residue of such replacement can be also can by genetic code, not encoded, or (ii) has a polypeptide that replaces group in one or more amino acid residues, or (iii) mature polypeptide and another compound (such as the compound that extends the polypeptide half-life, polyethylene glycol for example) merge formed polypeptide, or (iv) additional amino acid sequence be fused to this peptide sequence and the polypeptide that forms (as targeting sequencing or secretion sequence or be used for sequence or the proteinogen sequence of this polypeptide of purifying, or with the fusion of the formation of antigen IgG fragment). according to the instruction of this paper, these fragments, derivative and analog belong to the known scope of those skilled in the art.
In the present invention, term " people JY1 polypeptide " refers to have the polypeptide of the SEQ ID NO.2 sequence of people JY1 protein active. This term also comprises having and people JY1 albumen phase congenerous, variant form SEQ ID NO.2 sequence. These variant forms comprise (but being not limited to): several (are generally 1-50, preferably 1-30, more preferably 1-20,1-10 best) amino acid whose disappearance, insertion and/or replacement, and at C end and/or N end, add one or several (being generally in 20, being preferably in 10, is more preferably in 5) amino acid. For example, in the art, while with the close or similar amino acid of performance, replacing, usually can not change the function of protein. Again such as, add one or several amino acid at C end and/or N end and usually also can not change the function of protein. This term also comprises active fragment and the reactive derivative of people JY1 albumen.
The variant form of this polypeptide comprises: polypeptide or albumen that homologous sequence, conservative variant, allelic variant, natural mutation, induced mutation body, the albumen that can encode with the DNA of people JY1 DNA hybridization under high or low stringency condition and the antiserum that utilizes anti-human JY1 polypeptide obtain. The present invention also provides other polypeptide, as comprises the fusion (fusion as shown in SEQ ID NO:3) of people JY1 polypeptide or its fragment. Except the polypeptide of total length almost, the present invention has also comprised the solubility fragment of people JY1 polypeptide. Usually, this fragment have people JY1 peptide sequence at least about 10 continuous amino acids, usually at least about 30 continuous amino acids, preferably at least about 50 continuous amino acids, more preferably at least about 80 continuous amino acids, best at least about 100 continuous amino acids.
Invention also provides the analog of people JY1 albumen or polypeptide. The difference of these analogs and natural people JY1 polypeptide can be the difference on amino acid sequence, can be also the pro forma difference of modification that does not affect sequence, perhaps haves both at the same time. These polypeptide comprise genetic variant natural or that induce. The induce variation body can obtain by various technology,, as by radiation or be exposed to mutagens and produce random mutagenesis, also can pass through direct mutagenesis method or the biological technology of other known moleculars. Analog also comprises having the analog that is different from the amino acid whose residue of natural L-(as D-amino acid), and the analog with that non-natural exists or synthetic amino acid (as β, gamma-amino acid). Should be understood that polypeptide of the present invention is not limited to the above-mentioned representational polypeptide that exemplifies.
(usually the not changing primary structure) form of modification comprises: chemically derived form such as acetylation or the carboxylated of the polypeptide that body is interior or external. Modification also comprises glycosylation, as those, carries out the glycosylation modification and the polypeptide of generation in procedure of processing in the synthetic and processing of polypeptide or further. This modification can be carried out glycosylated enzyme (as mammiferous glycosylase or deglycosylating enzyme) and completes by polypeptide is exposed to. The modification form also comprises have the phosphorylated amino acid residue sequence of (as phosphotyrosine, phosphoserine, phosphothreonine). Thereby also comprise the polypeptide that has been improved its anti-proteolysis performance or optimized solubility property by modifying.
In the present invention, " people JY1 albumen conservative variation polypeptide " refers to compare with the amino acid sequence of SEQ ID NO:2 or 6, has 10 at the most, preferably at the most 8, more preferably at the most 5,3 amino acid are replaced and form polypeptide by similar performance or close amino acid at the most best. These conservative variation polypeptide preferably carry out amino acid substitution according to table 1 and produce.
Table 1
Initial residue Representational replacement The preferred replacement
Ala(A) Val；Leu；Ile Val
Arg(R) Lys；Gln；Asn Lys
Asn(N) Gln；His；Lys；Arg Gln
Asp(D) Glu Glu
Cys(C) Ser Ser
Gln(Q) Asn Asn
Glu(E) Asp Asp
Gly(G) Pro；Ala Ala
His(H) Asn；Gln；Lys；Arg Arg
Ile(I) Leu；Val；Met；Ala；Phe Leu
Leu(L) Ile；Val；Met；Ala；Phe Ile
Lys(K) Arg；Gln；Asn Arg
Met(M) Leu；Phe；Ile Leu
Phe(F) Leu；Val；Ile；Ala；Tyr Leu
Pro(P) Ala Ala
Ser(S) Thr Thr
Thr(T) Ser Ser
Trp(W) Tyr；Phe Tyr
Tyr(Y) Trp；Phe；Thr；Ser Phe
Val(V) Ile；Leu；Met；Phe；Ala Leu
Polynucleotides of the present invention can be DNA form or rna form. DNA form comprises cDNA, genomic DNA or artificial synthetic DNA. DNA can be strand or double-stranded. DNA can be coding strand or noncoding strand. The coding region sequence of encoding mature polypeptide can be identical with the coding region sequence shown in SEQ ID NO:1 or the variant of degeneracy. As used herein, " variant of degeneracy " refers in the present invention encode and has the protein of SEQ ID NO:2 or 6, but with the differentiated nucleotide sequence of coding region sequence shown in SEQ ID NO:1.
The polynucleotides of the mature polypeptide of coding lymphokine JY1 comprise: the coded sequence of an encoding mature polypeptide; The coded sequence of mature polypeptide and various additional code sequence; The coded sequence of mature polypeptide (with optional additional code sequence) and non-coding sequence.
Term " polynucleotides of coded polypeptide " can be the polynucleotides that comprise this polypeptide of encoding, and can be also the polynucleotides that also comprise additional code and/or non-coding sequence.
The invention still further relates to the varient of above-mentioned polynucleotide, its coding has the polypeptide of identical aminoacid sequence or fragment, analogue and the derivative of polypeptide with the present invention.The varient of these polynucleotide can be the allelic variant of natural generation or the varient that non-natural takes place.These nucleotide diversity bodies comprise and replace varient, deletion mutation body and insert varient.As known in the art, allelic variant is the replacement form of polynucleotide, and it may be replacement, disappearance or the insertion of one or more Nucleotide, but can be from not changing the function of its encoded polypeptides in fact.
The invention still further relates to and above-mentioned sequence hybridization and two sequences between have at least 50%, preferably at least 70%, the polynucleotide of at least 80% homogeny more preferably.The present invention be more particularly directed under stringent condition and the interfertile polynucleotide of polynucleotide of the present invention.In the present invention, " stringent condition " is meant: (1) than hybridization under low ionic strength and the comparatively high temps and wash-out, as 0.2 * SSC, and 0.1%SDS, 60 ℃; Or (2) hybridization the time is added with denaturing agent, as 50% (v/v) methane amide, 0.1% calf serum/0.1%Ficoll, 42 ℃ etc.; Or (3) only at the homogeny between the two sequences at least more than 90%, be more preferably 95% and just hybridize when above.And the polypeptide of interfertile polynucleotide encoding has identical biological function and activity with the mature polypeptide shown in the SEQ ID NO:2.
The invention still further relates to nucleic acid fragment with above-mentioned sequence hybridization.As used herein, the length of " nucleic acid fragment " contains 15 Nucleotide at least, better is at least 30 Nucleotide, is more preferably at least 50 Nucleotide, preferably more than at least 100 Nucleotide.Nucleic acid fragment can be used for the amplification technique (as PCR) of nucleic acid to determine and/or the proteic polynucleotide of separation coding JY1.
Polypeptide among the present invention and polynucleotide preferably provide with isolating form, more preferably are purified to homogeneous.
People JY1 Nucleotide full length sequence of the present invention or its fragment can obtain with the method for pcr amplification method, recombination method or synthetic usually.For the pcr amplification method, can be disclosed according to the present invention about nucleotide sequence, especially open reading frame sequence designs primer, and with commercially available cDNA storehouse or by the prepared cDNA storehouse of ordinary method well known by persons skilled in the art as template, amplification and must relevant sequence.When sequence is longer, usually needs to carry out twice or pcr amplification repeatedly, and then the fragment that each time amplifies is stitched together by proper order.
In case obtained relevant sequence, just can obtain relevant sequence in large quantity with recombination method.This normally is cloned into carrier with it, changes cell again over to, separates obtaining relevant sequence then from the host cell after the propagation by ordinary method.
In addition, also the method for available synthetic is synthesized relevant sequence, especially fragment length more in short-term.Usually, by first synthetic a plurality of small segments, and then connect and to obtain the very long fragment of sequence.
At present, can be fully obtain the dna sequence dna of code book invention albumen (or its fragment, or derivatives thereof) by chemosynthesis.This dna sequence dna can be introduced in various existing dna moleculars as known in the art (or as carrier) and the cell then.In addition, also can will suddenly change and introduce in the protein sequence of the present invention by chemosynthesis.
Use method (Saiki, the et al.Science 1985 of round pcr DNA amplification/RNA; 230:1350-1354) be optimized for acquisition gene of the present invention.The primer that is used for PCR can suitably be selected according to sequence information of the present invention disclosed herein, and available ordinary method is synthetic.Available ordinary method is as the DNA/RNA fragment by gel electrophoresis separation and purifying amplification.
The present invention also relates to comprise the carrier of polynucleotide of the present invention, and the host cell that produces through genetically engineered with carrier of the present invention or JY1 albumen coded sequence, and the method that produces polypeptide of the present invention through recombinant technology.
Recombinant DNA technology (Science, 1984 by routine; 224:1431), can utilize polymerized nucleoside acid sequence of the present invention to can be used to express or produce the JY1 polypeptide of reorganization.In general following steps are arranged:
(1). with the polynucleotide (or varient) of coding of the present invention people JY1 polypeptide, or with the recombinant expression vector that contains these polynucleotide proper host cell that transforms or transduce;
(2). the host cell of in suitable medium, cultivating;
(3). separation, protein purification from substratum or cell.
Among the present invention, people JY1 polynucleotide sequence can be inserted in the recombinant expression vector.Term " recombinant expression vector " refers to that bacterial plasmid well known in the art, phage, yeast plasmid, vegetable cell virus, mammalian cell virus are as adenovirus, retrovirus or other carriers.The carrier of Shi Yonging includes but not limited in the present invention: and the expression vector based on T7 of in bacterium, expressing (Rosenberg, et al.Gene, 1987,56:125); The pMSXND expression vector of in mammalian cell, expressing (Lee and Nathans, J Bio Chem.263:3521,1988) and at the carrier that derives from baculovirus of expressed in insect cells.In a word, as long as can duplicate in host and stablize, any plasmid and carrier can be used.A key character of expression vector is to contain replication orgin, promotor, marker gene and translation controlling elements usually.
Method well-known to those having ordinary skill in the art can be used to make up and contains people JY1 DNA sequences encoding and suitable transcribing/the translate expression vector of control signal.These methods comprise (Sambroook, et al.Molecular Cloning, a Laboratory Manual, coldSpring Harbor Laboratory.New York, 1989) such as extracorporeal recombinant DNA technology, DNA synthetic technology, the interior recombinant technologys of body.Described dna sequence dna can effectively be connected on the suitable promotor in the expression vector, and is synthetic to instruct mRNA.The representative example of these promotors has: colibacillary lac or trp promotor; Lambda particles phage P LPromotor; Eukaryotic promoter comprises LTRs and some other known may command gene expression promoter in protokaryon or eukaryotic cell or its virus of CMV immediate early promoter, HSV thymidine kinase promoter, early stage and late period SV40 promotor, retrovirus.Expression vector also comprises ribosome bind site and the transcription terminator that translation initiation is used.
In addition, expression vector preferably comprises one or more selected markers, to be provided for selecting the phenotypic character of transformed host cells, cultivate Tetrahydrofolate dehydrogenase, neomycin resistance and the green fluorescent protein (GFP) of usefulness as eukaryotic cell, or be used for colibacillary tsiklomitsin or amicillin resistance.
Comprise the carrier of above-mentioned suitable dna sequence dna and suitable promotor or control sequence, can be used to transform appropriate host cell, so that it can marking protein.
Host cell can be a prokaryotic cell prokaryocyte, as bacterial cell; Or eukaryotic cell such as low, as yeast cell; Or higher eucaryotic cells, as mammalian cell.Representative example has: intestinal bacteria, streptomyces; The bacterial cell of Salmonella typhimurium; Fungal cell such as yeast; Vegetable cell; The insect cell of fruit bat S2 or Sf9; The zooblast of CHO, COS, 293 cells or Bowes melanoma cells etc.
When polynucleotide of the present invention are expressed in higher eucaryotic cells, be enhanced if will make to transcribe when in carrier, inserting enhancer sequence.Can for example be included in the SV40 enhanser of 100 to 270 base pairs of replication origin side in late period one, at the polyoma enhanser of replication origin side in late period one and adenovirus enhanser etc.
Persons skilled in the art all know how to select appropriate carriers, promotor, enhanser and host cell.
Can carry out with routine techniques well known to those skilled in the art with the recombinant DNA transformed host cell.
When the host was prokaryotic organism such as intestinal bacteria, the competent cell that can absorb DNA can be used CaCl in exponential growth after date results 2Method is handled, and used step is well-known in this area.Another kind method is to use MgCl 2If desired, transforming also the method for available electroporation carries out.When the host is an eukaryote, can select following DNA transfection method for use: coprecipitation of calcium phosphate method, conventional mechanical method such as microinjection, electroporation, liposome packing etc.
The transformant that obtains can be cultivated with ordinary method, expresses the polypeptide of coded by said gene of the present invention.According to used host cell, used substratum can be selected from various conventional substratum in the cultivation.Under the condition that is suitable for the host cell growth, cultivate.After host cell grows into suitable cell density, induce the promotor of selection with suitable method (as temperature transition or chemical induction), cell is cultivated for some time again.
The extracellular can be expressed or be secreted into to recombinant polypeptide in the above methods in cell or on cytolemma.If desired, can utilize its physics, the separating by various separation methods with other characteristic and the albumen of purification of Recombinant of chemistry.These methods are well-known to those skilled in the art.The example of these methods includes, but are not limited to: conventional renaturation handles, with protein precipitant handle (salt analysis method), centrifugal, the broken bacterium of infiltration, superly handle, the combination of super centrifugal, sieve chromatography (gel-filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC) and other various liquid chromatography (LC) technology and these methods.
The people JY1 albumen or the polypeptide of reorganization are of use in many ways.These purposes include, but is not limited to: the direct disease due to the low or forfeiture and be used to screen and promote or antibody, polypeptide or other part of antagonism JY1 protein function as pharmacological agent JY1 protein function.The peptide molecule that can suppress or stimulate people JY1 protein function that can be used for seeking therapeutic value with the recombinant human JY1 protein screening peptide library of expressing.
On the other hand, the present invention also comprises people JY1 DNA or the polypeptide of its fragment coding has specific polyclonal antibody and monoclonal antibody, especially monoclonal antibody.Here, " specificity " is meant that antibody capable is incorporated into people JY1 gene product or fragment.Preferably, refer to that those can combine with people JY1 gene product or fragment but nonrecognition and be incorporated into the antibody of other irrelevant antigen molecule.Among the present invention antibody comprise those can in conjunction with and suppress the proteic molecule of people JY1, comprise that also those do not influence the antibody of people JY1 protein function.The present invention also comprise those can with modify or without the people JY1 gene product bonded antibody of modified forms.
The present invention not only comprises complete mono-clonal or polyclonal antibody, but also comprises having immunocompetent antibody fragment, as Fab ' or (Fab) 2Fragment; Heavy chain of antibody; Light chain of antibody; Genetically engineered strand Fv molecule; Or chimeric antibody, as have the murine antibody binding specificity but still keep antibody from people's antibody moiety.
Antibody of the present invention can be prepared by the known various technology of those skilled in that art.For example, the people JY1 gene product of purifying or its have antigenic fragment, can be applied to animal to induce the generation of polyclonal antibody.Similarly, expressing human JY1 albumen or its have antigenic segmental cell and can be used to immune animal and produce antibody.Antibody of the present invention also can be monoclonal antibody.This type of monoclonal antibody can utilize hybridoma technology to prepare that (see people such as Kohler, Nature 256; 495,1975; People such as Kohler, Eur.J.Immunol.6:511,1976; People such as Kohler, Eur.J.Immunol.6:292,1976; People such as Hammerling, In Monoclonal Antibodies and T Cell Hybridomas, Elsevier, N.Y., 1981).Antibody of the present invention comprises the antibody that can block people JY1 protein function and the antibody that does not influence people JY1 protein function.Each antibody-like of the present invention can utilize the fragment or the functional zone of people JY1 gene product, obtains by the routine immunization technology.These fragments or functional zone can utilize recombinant methods or utilize Peptide synthesizer synthetic.Can come immune animal and produce with the gene product of producing in the prokaryotic cell prokaryocyte (for example E.Coli) with the unmodified form bonded antibody of people JY1 gene product; With posttranslational modification form bonded antibody (as the albumen or the polypeptide of glycosylation or phosphorylation), can come immune animal and obtain with the gene product that produces in the eukaryotic cell (for example yeast or insect cell).
The proteic antibody of anti-people JY1 can be used in the immunohistochemistry technology, detects the people JY1 albumen in the biopsy specimen.In addition, with the also available labelled with radioisotope of the protein bound monoclonal antibody of people JY1, inject in the body and can follow the tracks of its position and distribution.
Antibody among the present invention can be used for treating or prevention and the relevant disease of people JY1 albumen.The antibody that gives suitable dosage can stimulate or block proteic generation of people JY1 or activity.
Antibody also can be used for being designed to the immunotoxin at a certain privileged sites in the body.As the monoclonal antibody of people JY1 albumen high-affinity can with bacterium or plant poison (as diphtheria toxin, ricin, abrine etc.) covalent attachment.A kind of usual method is with sulfydryl linking agent such as SPDP, attacks the amino of antibody, by the exchange of disulfide linkage, toxin is incorporated on the antibody, and this hybrid antibody can be used for killing the cell (for example lymph-node cell etc.) of people JY1 protein positive.
The production of polyclonal antibody can choose JY1 albumen or polypeptide immune animal, as rabbit, mouse, rat etc.Multiple adjuvant can be used for the enhancing immunity reaction, includes but not limited to freund's adjuvant etc.
Utilize albumen of the present invention,, can filter out with JY1 albumen interactional material takes place, as acceptor, inhibitor, agonist or antagonist etc. by various conventional screening methods.
Albumen of the present invention and antibody thereof, inhibitor, agonist, antagonist or acceptor etc. when using (administration) in treatment, can provide different effects.Usually, can these materials are formulated in nontoxic, inert and the pharmaceutically acceptable aqueous carrier medium, wherein pH is about 5-8 usually, and preferably pH is about 6-8, although the pH value can be with being changed to some extent by preparation Substance Properties and illness to be treated.The pharmaceutical composition for preparing can carry out administration by conventional route, comprising (but being not limited to): intramuscular, intraperitoneal, intravenously, subcutaneous, intracutaneous or topical.
Polypeptide of the present invention can be directly used in disease treatment, for example, is used for the treatment of aspects such as tumour, inflammation, dysimmunity.When using JY1 albumen of the present invention, also can use the other treatment agent simultaneously, as TNF-α, TNF-β etc.
The present invention also provides a kind of pharmaceutical composition, and it contains JY1 polypeptide of the present invention or its agonist, antagonist and the pharmaceutically acceptable carrier or the vehicle of safe and effective amount.This class carrier comprises (but being not limited to): salt solution, damping fluid, glucose, water, glycerine, ethanol and combination thereof.Pharmaceutical preparation should be complementary with administering mode.Pharmaceutical composition of the present invention can be made into the injection form, for example is prepared by ordinary method with the physiological saline or the aqueous solution that contains glucose and other assistant agents.Pharmaceutical composition such as tablet and capsule can be prepared by ordinary method.Pharmaceutical composition such as injection, solution, tablet and capsule should be made under aseptic condition.The dosage of activeconstituents is the treatment significant quantity, for example every day about 1 microgram/kg body weight-Yue 5 mg/kg body weight.In addition, polypeptide of the present invention also can use with the other treatment agent.
When making pharmaceutical composition, be that the JY1 albumen of safe and effective amount or its antagonist, agonist are applied to Mammals, wherein this safe and effective amount is usually at least about 10 micrograms/kg body weight, and in most of the cases be no more than about 8 mg/kg body weight, preferably this dosage is about 10 micrograms/kg body weight-Yue 1 mg/kg body weight.Certainly, concrete dosage also should be considered factors such as route of administration, patient health situation, and these all are within the skilled practitioners skill.
The proteic polynucleotide of people JY1 also can be used for multiple therapeutic purpose.Gene therapy technology can be used for treating because cell proliferation, growth or the metabolic disturbance due to the proteic expression of JY1 of the proteic nothing expression of JY1 or unusual/non-activity.The JY1 albumen that the gene therapy vector (as virus vector) of reorganization can be designed to express variation is to suppress endogenic JY1 protein-active.Deriving from viral expression vector such as retrovirus, adenovirus, adeno-associated virus (AAV), hsv, parvovirus etc. can be used for the JY1 transgenosis to cell.The method that structure carries the recombinant viral vector of JY1 gene is found in existing document (Sambrook, et al.).Recombinant human JY1 gene can be packaged in the liposome in addition, and then is transferred in the cell.
Suppress the oligonucleotide (comprising sense-rna and DNA) of people JY1 mRNA and ribozyme also within the scope of the invention.
Polynucleotide imports tissue or intracellular method comprises: directly be injected into polynucleotide in the in-vivo tissue; Or external by carrier (as virus, phage or plasmid etc.) earlier with the polynucleotide transfered cell in, again cell is transplanted in the body etc.
Can be incorporated into the rondom polypeptide storehouse that solid formation forms by the various amino acid that may make up by screening with the protein bound peptide molecule of people JY1 obtains.During screening, must carry out mark to people JY1 protein molecular.
The invention still further relates to the diagnostic testing process of quantitative and detection and localization people JY1 protein level.These tests are known in the art, and comprise that FISH measures and radioimmunoassay.The people JY1 protein level that is detected in the test can be with laying down a definition the importance of people JY1 albumen in various diseases and be used to the disease of diagnosing JY1 albumen to work.
Whether having the proteic method of JY1 in a kind of detection test sample is to utilize the proteic specific antibody of JY1 to detect, and it comprises: sample is contacted with the JY1 protein specific antibody; Observe whether form antibody complex, formed antibody complex and just represented to exist in the sample JY1 albumen.
The proteic polynucleotide of JY1 can be used for the diagnosis and the treatment of JY1 protein related diseases.Aspect diagnosis, the proteic polynucleotide of JY1 can be used for detecting the proteic expression of JY1 JY1 abnormal exprssion whether or under morbid state.Can be used for the hybridization of biopsy specimen to judge the proteic abnormal expression of JY1 as the JY1 dna sequence dna.Hybridization technique comprises the Southern blotting, Northern blotting, in situ hybridization etc.These technological methods all are disclosed mature technologies, and relevant test kit all can obtain from commercial channels.Part or all of polynucleotide of the present invention can be used as probe stationary on microarray (microarray) or DNA chip (being called " gene chip " again), is used for analyzing the differential expression analysis and the gene diagnosis of tissue gene.Carry out RNA-polymerase chain reaction (RT-PCR) amplification in vitro with the special primer of JY1 albumen and also can detect the proteic transcription product of JY1.
The sudden change that detects the JY1 gene also can be used for the disease of diagnosing JY1 albumen relevant.The form of JY1 protein mutation comprises that the point mutation compared with normal wild type JY1 dna sequence dna, transposition, disappearance, reorganization and other are any unusual etc.Available existing technology such as Southern blotting, dna sequence analysis, PCR and in situ hybridization detect sudden change.In addition, sudden change might influence proteic expression, therefore can judge indirectly that with Northern blotting, Western blotting gene has or not sudden change.
Sequence of the present invention identifies it also is valuable to karyomit(e).Can pass through linkage analysis then, determine the JY1 gene and navigated to relation between the disease on the chromosomal region already.
In an example of the present invention, a kind of isolating polynucleotide are provided, its coding has the JY1 polypeptide of aminoacid sequence shown in SEQ ID NO:2 or 6.Polynucleotide of the present invention are isolated from human spleen cell cDNA library.Its sequence is shown in SEQ ID NO:1, and the polynucleotide sequence total length that it comprises is 557 bases, and its open reading frame is positioned at the 53-529 position, and the coding total length is 159 amino acid whose people JY1 albumen (SEQ ID NO:2).The TSLP of JY1 albumen of the present invention and mouse has 41% similarity, thereby with its called after lymphokine JY1.Studies show that lymphokine JY1 is a new human lymphocyte factor, the TSLP of its function and mouse has difference, can reconcile immunity system, therefore treatment Immunological diseases, inflammation and cancer is had very big effect, has great application prospect.
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to people such as normal condition such as Sambrook, molecular cloning: laboratory manual (New York:Cold SpringHarbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.
Embodiment 1
The discovery of lymphokine JY1 gene
The inventor utilizes the method for information biology, is the protein sequence (numbering AF232937) that uses mouse to deliver at GenBank used the public website of the method for tblastn at NCBI: http://www.ncbi.nlm.nih.gov/blast/Blast.cgi? CMD=Web﹠amp; LAYOUT=Two Windows﹠amp; AUTO_FORMAT=Semiauto﹠amp; ALIGNMENTS=50﹠amp; ALIGNMENT_VIEW=Pairwise﹠amp; CLIENT=web﹠amp; DATABASE=nr﹠amp; DESCRIPTIONS=100﹠amp; ENTREZ_QUERY=(none) ﹠amp; EXPECT=10﹠amp; FILTER=L﹠amp; FORMAT_OBJECT=Alignment﹠amp; FORMAT_TYPE=HTML﹠amp; GENETIC_CODE=0﹠amp; HITLIST_SIZE=100﹠amp; NCBI_GI=on﹠amp; PAGE=Translations﹠amp; PROGRAM=tblastn﹠amp; SERVICE=plain﹠amp; SET_DEFAULTS.x=23﹠amp; SET_DEFAULTS.y=10﹠amp; SHOW_OVERVIEW=on﹠amp; UNGAPPED_ALIGNMENT=no﹠amp; END_OF_HTTPGET=Yes seeks and mouse TSLP similar protein in human est_human database or human genome database nr.
The parameter of selecting is as follows:
filter＝low?complexity
expect＝10
MATRIX＝BLOSUM62
Gap?Cost＝Existence：11?Extension：1
Found that some compilings have the proteic EST fragment or the human genomic sequence of similarity:
AC008572 is human the 5th pair of karyomit(e) clone CTC-551A13, comprises exon and intron (Fig. 1 and SEQ ID NO:5).
The N end of EST segment AA889581 coding lymphokine JY1.Encode the jointly C end of lymphokine JY1 of five EST fragments (Fig. 2) such as BG532037, BF244565, BF219288, BG496490, BG493158.
Embodiment 2
The clone of the cDNA of lymphokine JY1
Based on the dna sequence dna of lymphokine JY1, designed and synthesized following two oligonucleotides and be the PCR clone:
TCGTGGTGGG?AAGAGTTTAG?TG(SEQ?ID?NO：3)
GAAATATGACCATAATAAAGATGGT(SEQ?ID?NO：4)
Template is the splenocyte cDNA storehouse of Clontech company.Use pfu polysaccharase (Stratagene) to be the PCR clone, through 35 circulations (50 microlitre volumes, 60 ℃-1 minute, 90 ℃-1 minute, the 400nM primer, 200mMdNTP) after, hatched 10 minutes at 72 ℃ again.On sepharose, produced the significantly band (Fig. 6) of the about 550bp of size.
Isolated PCR product cloning to the TA cloning vector of Invitrogen, is carried out dna sequencing after building up the pCMVJY1 construction.
Sequencing result has been verified the dna sequence dna of the lymphokine JY1 gene of finding with bioinformatics method.Particularly, the dna sequence dna of lymphokine JY1 such as Fig. 3 and SEQ ID NO:1, ORF is positioned at the 53-529 position.The albumen of the JY1 that translates out from dna sequence dna has 159 amino acid, and its sequence is shown in Fig. 4 and SEQ ID NO:2, and wherein the N end has 28 amino acid whose signal peptides.The aminoacid sequence of sophisticated lymphokine JY1 is shown in SEQ ID NO:6.
Protein sequence and the mouse TSLP albumen of human lymphokine JY1 are carried out the amino acid comparison, find that both have 41% similar (Fig. 5).Especially the most halfcystines in two albumen are high conservatives, though two albumen homologys of this hint are not high, structure may be very similar.
Embodiment 3
The expression of lymphokine JY1 in histoorgan
Use two oligonucleotide primers among the embodiment 2 to pass through the PCR synthesising probing needle, carry out the Northern engram analysis, to detect the expression of lymphokine JY1 in histoorgan.
Found that the band of an about 1.4kb, lymphokine JY1 has expression (Fig. 7) in organ-tissues such as spleen, thymus gland, prostate gland, small intestine and colon.
Embodiment 4
Recombinant expressed and the purification of lymphokine JY1
With pCMVJY1 and anti-neomycin gene expression plasmid co-infected mammalian cell Chinese hamster ovary celI, under selecting, Xin Meisu builds up stable genetic expression clone.
Cell culture fluid is subsequently by a few step purification lymphokine JY1 such as centrifugal, dialysis, filtration and separator columns.Use sds gel and Coomassie blue stain to observe proteic purity in the purification process.Found that, at the 22kDa place one protein band is arranged, (predicted molecular weight of the JY1 of band signal peptide is 18.1kDa to molecular weight greater than the molecular weight of ripe lymphokine JY1 of prediction, the predicted molecular weight of the JY1 of no signal peptide is 15kDa) (Fig. 8), this may exist glycosylation relevant with the lymphokine JY1 of eukaryotic expression.
Embodiment 5
Reorganization lymphokine JY1 induces the bone-marrow-derived lymphocyte of IgM+ to grow
The growth that the TSLP of mouse once was found bone-marrow-derived lymphocyte has promoter action, can support the medullary cell of mouse to grow up to colony in agarose, and stimulates IgM -Medullary cell develop into IgM +Cell.
In the present embodiment, with people's medullary cell (IgM -) be separated after, under the situation of the lymphokine JY1 that contains or do not contain embodiment 4 preparation, after cultivating 7 days on the methylcellulose gum, dye with anti-IgM antibody.
The result as shown in Figure 9, under 10ng/ milliliter lymphokine JY1 stimulated, IgM positive B lymphocyte number obviously increased.
Embodiment 6
Reorganization lymphokine JY1 activates dendritic cell
Sophisticated dendritic cell is a kind of important immunity regulatory cell, and it offers the T lymphocyte to start immune response after antigen being handled.If this antigen is the antigen of tumour-specific, dendritic cell just can start antineoplastic immunity system for human body.The ripening process of dendritic cell can detect by the expression of its surface markers such as CD40, CD80, CD86 etc.
In the present embodiment, from blood, extract the immature dendritic cell of CD11c+, under the situation of the lymphokine JY1 (10ng/ milliliter) that contains or do not contain embodiment 4 preparations, cultivate immature dendritic cell, whether can influence the ripening process of dendritic cell to detect JY1.
Experimental result shows that JY1 can obviously increase the CD86 expression of dendritic cell, promotes the maturation of dendritic cell as shown in figure 10.
Embodiment 7
Reorganization lymphokine JY1 activated dendritic cell can stimulate the lymphocytic growth of T
Another functional parameter of sophisticated dendritic cell is that it can activate the T lymphocyte.In the present embodiment, with dendritic cell and CD4 +T lymphocyte co-cultivation, add 2.5,5.0 with the lymphokine JY1 of the different protein concentrations of 7.5ng/ milliliter, by 3The mark of H detects the lymphocytic hyperplasia situation of T.
The result as shown in figure 11, when JY1 existed, the lymphocytic hyperplasia of T had increase clearly.
All quote in this application as a reference at all documents that the present invention mentions, just quoted as a reference separately as each piece document.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.
Sequence table＜110〉sieve, the principal columns of a hall
Wu, fine horse＜120〉new human lymphokine, its encoding sequence and purposes＜130〉012696＜160〉6＜170〉PatentIn version 3.0＜210〉1＜211〉557＜212〉DNA＜213〉Homo sapiens＜220〉＜221〉CDS＜222〉(53) .. (529)＜400〉1tcgtggtggg aagagtttag tgtgaaactg gggtggaatt gggtgtccac gt atg ttc 58
Met?Phe
1cct?ttt?gcc?tta?cta?tat?gtt?ctg?tca?gtt?tct?ttc?agg?aaa?atc?ttc???????106Pro?Phe?Ala?Leu?Leu?Tyr?Val?Leu?Ser?Val?Ser?Phe?Arg?Lys?Ile?Phe
5???????????????????10??????????????????15atc?tta?caa?ctt?gta?ggg?ctg?gtg?tta?act?tac?gac?ttc?act?aac?tgt???????154Ile?Leu?Gln?Leu?Val?Gly?Leu?Val?Leu?Thr?Tyr?Asp?Phe?Thr?Asn?Cys
20??????????????????25??????????????????30gac?ttt?gag?aag?att?aaa?gca?gcc?tat?ctc?agt?act?att?tct?aaa?gac???????202Asp?Phe?Glu?Lys?Ile?Lys?Ala?Ala?Tyr?Leu?Ser?Thr?Ile?Ser?Lys?Asp35??????????????????40??????????????????45??????????????????50ctg?att?aca?tat?atg?agt?ggg?acc?aaa?agt?acc?gag?ttc?aac?aac?acc???????250Leu?Ile?Thr?Tyr?Met?Ser?Gly?Thr?Lys?Ser?Thr?Glu?Phe?Asn?Asn?Thr
55??????????????????60??????????????????65gtc?tct?tgt?agc?aat?cgg?cca?cat?tgc?ctt?act?gaa?atc?cag?agc?cta???????298Val?Ser?Cys?Ser?Asn?Arg?Pro?His?Cys?Leu?Thr?Glu?Ile?Gln?Ser?Leu
70??????????????????75??????????????????80acc?ttc?aat?ccc?acc?gcc?ggc?tgc?gcg?tcg?ctc?gcc?aaa?gaa?atg?ttc???????346Thr?Phe?Asn?Pro?Thr?Ala?Gly?Cys?Ala?Ser?Leu?Ala?Lys?Glu?Met?Phe
85??????????????????90??????????????????95gcc?atg?aaa?act?aag?gct?gcc?tta?gct?atc?tgg?tgc?cca?ggc?tat?tcg???????394Ala?Met?Lys?Thr?Lys?Ala?Ala?Leu?Ala?Ile?Trp?Cys?Pro?Gly?Tyr?Ser
100?????????????????105?????????????????110gaa?act?cag?ata?aat?gct?act?cag?gca?atg?aag?aag?agg?aga?aaa?agg???????442Glu?Thr?Gln?Ile?Asn?Ala?Thr?Gln?Ala?Met?Lys?Lys?Arg?Arg?Lys?Arg115?????????????????120?????????????????125?????????????????130aaa?gtc?aca?acc?aat?aaa?tgt?ctg?gaa?caa?gtg?tca?caa?tta?caa?gga??????490Lys?Val?Thr?Thr?Asn?Lys?Cys?Leu?Glu?Gln?Val?Ser?Gln?Leu?Gln?Gly
135?????????????????140?????????????????145ttg?tgg?cgt?cgc?ttc?aat?cga?cct?tta?ctg?aaa?caa?cag?taaaccatct???????539Leu?Trp?Arg?Arg?Phe?Asn?Arg?Pro?Leu?Leu?Lys?Gln?Gln
150?????????????????155ttattatggt?catatttc??????????????????????????????????????????????????557<210>2<211>159<212>PRT<213>Homo?sapiens<400>2Met?Phe?Pro?Phe?Ala?Leu?Leu?Tyr?Val?Leu?Ser?Val?Ser?Phe?Arg?Lys1???????????????5???????????????????10??????????????????15Ile?Phe?Ile?Leu?Gln?Leu?Val?Gly?Leu?Val?Leu?Thr?Tyr?Asp?Phe?Thr
20??????????????????25??????????????????30Asn?Cys?Asp?Phe?Glu?Lys?Ile?Lys?Ala?Ala?Tyr?Leu?Ser?Thr?Ile?Ser
35??????????????????40??????????????????45Lys?Asp?Leu?Ile?Thr?Tyr?Met?Ser?Gly?Thr?Lys?Ser?Thr?Glu?Phe?Asn
50??????????????????55??????????????????60Asn?Thr?Val?Ser?Cys?Ser?Asn?Arg?Pro?His?Cys?Leu?Thr?Glu?Ile?Gln65??????????????????70??????????????????75??????????????????80Ser?Leu?Thr?Phe?Asn?Pro?Thr?Ala?Gly?Cys?Ala?Ser?Leu?Ala?Lys?Glu
85??????????????????90??????????????????95Met?Phe?Ala?Met?Lys?Thr?Lys?Ala?Ala?Leu?Ala?Ile?Trp?Cys?Pro?Gly
100?????????????????105?????????????????110Tyr?Ser?Glu?Thr?Gln?Ile?Asn?Ala?Thr?Gln?Ala?Met?Lys?Lys?Arg?Arg
115?????????????????120?????????????????125Lys?Arg?Lys?Val?Thr?Thr?Asn?Lys?Cys?Leu?Glu?Gln?Val?Ser?Gln?Leu
130135140 Gln Gly Leu Trp Arg Arg Phe Asn Arg Pro Leu Leu Lys Gln Gln 145150155 <210> 3 <211> 22 <212> DNA <213> Synthetic primers <400> 3 tcgtggtggg aagagtttag tg 22 <210> 4 <211> 25 <212> DNA <213> Synthetic primers <400> 4 gaaatatgac cataataaag atggt 25 <210> 5 <211> 4980 <212> DNA <213> Homo sapiens <400> 5 aataagggct tcctgtggac tggcaatgag aggcaaaacc tggtgcttga gcactggccc 60 ctaaggcagg ccttacagat ctcttacact cgtggtggga agagtttagt gtgaaactgg 120 ggtggaattg ggtgtccacg tatgttccct tttgccttac tatatgttct gtcagtttct 180 ttcaggaaaa tcttcatctt acaacttgta gggctggtgt taacttacga cttcactaac 240 tgtgactttg agaagattaa agcagcctat ctcagtacta tttctaaaga cctgattaca 300 tatatgagtg gggtaagtga agaagctttt ttaaaacaaa tgtattttca tcagaggagt 360 cggcatacac acactctaca atttaacttt gtaggaaaga aaaataattt agaaaaaatc 420 atggccccac attttgtcaa ggattcttac aagtgatatt caaatatcta atctaaaatg 480 attatctaga aattggcaca ttctaagtgt gcagatgctg atgaggagca ggtattgata 540 gacagcgcgt tatgcgtcaa aggatgtcta tcctttgcta aagtgttact ctgactatgc 600 tgtaaaaagc aggaggtaag agcttaagaa agaggagtaa aagagataat tctcatgaga 660 taaactctaa ggattgatgc tgtgctccag gtctctccag tgttttagat gtttcaggat 720 gctatttatt acagaatatg gtgtacttgg aatttttttt aacatacagt agtaatcatt 780 ttcctgatta acctaatttc tagacagagt ttgcattcat gaatggccac agtacagatg 840 cggacatcca aaggatggca ttattactca caagcatagt gctatgtgca gttatggctt 900 gagggaaggg aggggggagg tcgccctctg agacctgaac cttttggtgt ggtttcaagc 960 actaaccagc actatctaat ggctatttca ctgccttgtc aatgacatag gaaaaaggta 1020 cctgagtgga aactgttttc agggcacctt taaagcctgg gagcaaaggg tggagggatg 1080 attttccttg tggacttaaa agtctttacc ctctttgtcc tatttttctt tcttccagac 1140 caaaagtacc gagttcaaca acaccgtctc ttgtagcaat cgggtgagta gagagttcag 1200 tgctgctggc tttctccagg gagacgccag gcattttgga gagggagtat cctgctacgt 1260 gcagaactcc gagaggtgcc tgggctccgg gacgccgccg ccgggggaaa ggggacatct 1320 gggctgtcag agcggggctg cgcctagctt gggacaacac ttctgttcca atttagggag 1380 aggaagtctc tatccggagg aaaggcaaat tgggaactgg gacgagggaa cgttgttagg 1440 ggcaccacct gctggggtcc ggcgcctccg cgctcgggct cggaattttg gcagcctccg 1500 ccccctggag acttgggagg agcgagcgtg ggtgacagtc ttttcgcgac gagtgccctc 1560 cgccaccctc gccacgcccc tgctcccccg cggttggttc ttccttgctc tactcaaccc 1620 tgacctcttc tctctgactc tcgacttgtg ttccccgctc ctccctgacc ttcctcccct 1680 cccctttcac tcaattctca ccaactcttt ctctctctgg tgttttctcc ttttctcgta 1740 aactttgccg cctatgagca gccacattgc cttactgaaa tccagagcct aaccttcaat 1800 cccaccgccg gctgcgcgtc gctcgccaaa gaaatgttcg ccatgaaaac taaggctgcc 1860 ttagctatct ggtgcccagg ctattcggaa actcaggtaa gcccgaagcc tcagacgttt 1920 gctgtacctt ggggctaacc tcaaattaaa ctggggcttt ggtgcagaag tcgttctctt 1980 atttttattt aggttttatc tttcgaagag caaacgagcc gggtaaaagt ggtaggatgt 2040 cagttagacc cacgttgata cccggaatca aactcaccta tttctacggt tctgatactg 2100 ttttggctga attatggttc taaaccttag ggcaatgttt caagctatga tgagtgagac 2160 ttctatatca gaatgttttg attgctggag cataagagta tggctgctaa aaatgccaat 2220 tcccaggtac tcaacccaga ccttcaacat taaaatctca gattatgggg ctccttaaga 2280 gattcttgtc cagtccaaag tttgagcaac acctcttgtt cttatcactt aattattgtg 2340 tgcttatttg ctaaatgtat aattacatta tacataaaat ctctatccta tgtttgctta 2400 attgcttgtg tgggcgctat tgctgtctct ttacacattt ttgcacatgt agttatctgc 2460 atttgaatgc tcgtgtagca ttaaatatgg agatagtgta gtggaaagtt aggcacagga 2520 actctggaga caacctgcct gactttgaat cctggcccta taacttctgt gaagacttag 2580 ttaaattact tagcctccgt gtactgtagc ttcatgggta aagtaagtat catatcagtt 2640 agtcttatac aggttgtttc tgaggattaa attagtcaac acatgtaaat gcagttggaa 2700 cagtgcctgg tacacaacag gcactcaata tttatttcag tcagcaagta gaggatttat 2760 cttcatggtg acaagtttaa ggaacagaga gagacaagtg cagatatgtt tgattgctcc 2820 ttattagcct agtggacttt atatgtctac agtctaggta gatggacacg actgtcactt 2880 tttttttttt tttttttttg agacagaatc tcgctctgtt acccaggctg gaatgcagtg 2940 gcacgatctc agctcactgc aacctccatc tcctgggttc aagcctcagc ctcccgagta 3000 gctggaacta caggtgcccg ccaccacgcc tggctaactt ttgtattttt agtagagacg 3060 gggtttcacc atattggcca ggctggtctc gaattcctga ccttgtgatc tgcctgcctc 3120 ggcctcccaa agtgctggaa ttacaagcat gagccaccat gcccagccaa aactgtcact 3180 ttctagaggt tgaggattga agccatagcg ctgatctggg ttgagcttga attagaaact 3240 caataccaga cagccatatg ggaaacctat ttggcttcat gccttcttat gaaggagacc 3300 ctggcaaatc tgcagatggc tacaataaaa ttcatttaaa taagagcaca aacaaaaagc 3360 tagatcaagt tcttggacag catgtgagaa agggagagtt tggagaaatt tatttcagtc 3420 cctcccaagc ccaaatggag agtctaagac taataataat gattttgcag gtttttttaa 3480 gatttgtgct taataaccct gtgactttat taatttgcat accatgtgtc taggaggccc 3540 agtgtactac tcaaaggtaa ttcagataaa ggtatatact gcaatcctct ttaaaataag 3600 ccctcagatg tctgtgacac atctagacaa tggggcaggg gagggggaag gatggggagc 3660 aggagcatgc attttgggtc caaaaaatag actaggttta ttgaatgatg tctataaaca 3720 ggtataagat agctcttgcc catgaggaac ttgtgatctt gtcagggagg tcttgaaatc 3780 agcaatttat tcatttactt aatcactcaa caaatattca gtgtttccta tgattaagac 3840 actgtattca gtgctatggg gaatacctat gatgcaatat aaagaaaagc atgttaagtg 3900 agagccaagt taaatgacac acactcttaa gtactggaag agtttccaaa agcaaggtct 3960 gagcaattag tggaggcttt ttgaaggagg tggtgcttgg ccttgaagca aaagtaggtg 4020 ggtacagaaa caggaaggca ttcccctgga aaaggcacat gctagcacat agtaagcagg 4080 tgctttggag acacactgaa agatggattt gcatagagaa ggcaattaaa cctgctctca 4140 acagttacta aagatagtga aaagtaattt tgactattga ttcttatatt ctgcagataa 4200 atgctactca ggcaatgaag aagaggagaa aaaggaaagt cacaaccaat aaatgtctgg 4260 aacaagtgtc acaattacaa ggattgtggc gtcgcttcaa tcgaccttta ctgaaacaac 4320 agtaaaccat ctttattatg gtcatatttc acagcaccaa aataaatcat ctttattaag 4380 tagatgaaac attaactcta actgtgacaa agaagaccac aaatagttat cttttaatta 4440 cagaagagtt tcttaactta cttttgtaag tttttattgt gtaagtttat aatgcagggg 4500 aagtactact cctcaaatgt tgagggaagc ttccataaca ttgatgactg gcttcatggc 4560 agtaattctc ggctgtagtt gcataagcat tgctcaagag gaaaatccaa aagtgcagca 4620 ggagaactct tttccctgaa aaaggaaaaa tattgaactc aatgatagca cctaaactta 4680 catttaaaag acagacattc cttctacatg taatgacact tcttgtgtta aactaaaaat 4740 ttacaagaga agaaagtgaa agcaaatggg gtttcacaaa tagttgtaaa tatagtgaag 4800 caatttgaaa taattttcaa gcaaagtatt gtgaaagtat tctaagccaa gttttaaata 4860 ttatctaaca gacaagagtg gtatatacaa gtagatcctg agaagtacct ttgttacagc 4920 tactataaat atacatataa attatagaat ctactttaat ttattttgtg aacacttttg 4980 <210> 6 <211> 131 <212> PRT <213> Homo sapiens <400> 6 Tyr Asp Phe Thr Asn Cys Asp Phe Glu Lys Ile Lys Ala Ala Tyr Leu 151015 Ser Thr Ile Ser Lys Asp Leu Ile Thr Tyr Met Ser Gly Thr Lys Ser ...
20??????????????????25??????????????????30Thr?Glu?Phe?Asn?Asn?Thr?Val?Ser?Cys?Ser?Asn?Arg?Pro?His?Cys?Leu
35??????????????????40??????????????????45Thr?Glu?Ile?Gln?Ser?Leu?Thr?Phe?Asn?Pro?Thr?Ala?Gly?Cys?Ala?Ser
50??????????????????55??????????????????60Leu?Ala?Lys?Glu?Met?Phe?Ala?Met?Lys?Thr?Lys?Ala?Ala?Leu?Ala?Ile65??????????????????70??????????????????75??????????????????80Trp?Cys?Pro?Gly?Tyr?Ser?Glu?Thr?Gln?Ile?Asn?Ala?Thr?Gln?Ala?Met
85??????????????????90??????????????????95Lys?Lys?Arg?Arg?Lys?Arg?Lys?Val?Thr?Thr?Asn?Lys?Cys?Leu?Glu?Gln
100?????????????????105?????????????????110Val?Ser?Gln?Leu?Gln?Gly?Leu?Trp?Arg?Arg?Phe?Asn?Arg?Pro?Leu?Leu
115?????????????????120?????????????????125Lys?Gln?Gln
130

Claims (10)

1. an isolating people JY1 polypeptide is characterized in that it comprises: have SEQ ID NO:2 or six amino acid polypeptide of sequence or its conservative property variation polypeptide or its active fragments or its reactive derivative.
2. polypeptide as claimed in claim 1 is characterized in that, this polypeptide is to have SEQ ID NO:2 or six amino acid polypeptide of sequence.
3. isolating polynucleotide is characterized in that, it comprises a nucleotide sequence, and this nucleotide sequence is shown at least 70% homogeny with a kind of nucleotides sequence that is selected from down group:
(a) coding is as the polynucleotide of polypeptide as described in claim 1 and 2;
(b) with polynucleotide (a) complementary polynucleotide.
4. polynucleotide as claimed in claim 3 is characterized in that this polynucleotide encoding has the polypeptide of aminoacid sequence shown in SEQ ID NO:2 or 6.
5. polynucleotide as claimed in claim 3 is characterized in that, the sequence of these polynucleotide is selected from down a kind of of group:
(a) has the sequence of 53-529 position among the SEQ ID NO:1;
(b) has the sequence of 137-529 position among the SEQ ID NO:1;
(c) has the sequence of 1-557 position among the SEQ ID NO:1.
6. a carrier is characterized in that, it contains the described polynucleotide of claim 3.
7. a genetically engineered host cell is characterized in that, it contains the described carrier of claim 6.
8. preparation method with polypeptide of people JY1 protein-active is characterized in that this method comprises:
(a) under the proteic condition of suitable expressing human JY1, cultivate the described host cell of claim 7;
(b) from culture, isolate polypeptide with people JY1 protein-active.
9. energy and the described people JY1 of claim 1 protein-specific bonded antibody.
10. a pharmaceutical composition is characterized in that, it contains the described polypeptide of claim 1 and the pharmaceutically acceptable carrier of safe and effective amount.
CN 01112889 2001-05-16 2001-05-16 Novel human lymphokine, its coding sequence and use Expired - Fee Related CN1234728C (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN 01112889 CN1234728C (en) 2001-05-16 2001-05-16 Novel human lymphokine, its coding sequence and use

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN 01112889 CN1234728C (en) 2001-05-16 2001-05-16 Novel human lymphokine, its coding sequence and use

Publications (2)

Publication Number Publication Date
CN1385441A true CN1385441A (en) 2002-12-18
CN1234728C CN1234728C (en) 2006-01-04

Family

ID=4659635

Family Applications (1)

Application Number Title Priority Date Filing Date
CN 01112889 Expired - Fee Related CN1234728C (en) 2001-05-16 2001-05-16 Novel human lymphokine, its coding sequence and use

Country Status (1)

Country Link
CN (1) CN1234728C (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005007186A1 (en) * 2003-07-18 2005-01-27 Schering Corporation Treatment and diagnosis of neoplasms using thymic stromal lymphopoietin
CN101605814B (en) * 2006-12-14 2014-02-19 默沙东公司 Engineered Anti-TSLP Antibodies
CN104231081A (en) * 2007-09-10 2014-12-24 安美基公司 Antigen binding proteins capable of binding thymic stromal lymphopoietin

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005007186A1 (en) * 2003-07-18 2005-01-27 Schering Corporation Treatment and diagnosis of neoplasms using thymic stromal lymphopoietin
JP2007534623A (en) * 2003-07-18 2007-11-29 シェーリング　コーポレイション Neoplastic treatment and diagnosis using thymic interstitial lymphopoietin
JP2007314547A (en) * 2003-07-18 2007-12-06 Schering Plough Corp Treatment and diagnosis of neoplasm using thymic stromal lymphopoietin
JP2011236252A (en) * 2003-07-18 2011-11-24 Schering Corp Treatment and diagnosis of neoplasm using thymic stromal lymphopoietin
US8822405B2 (en) 2003-07-18 2014-09-02 Merck, Sharp & Dohme Corp. Uses of mammalian cytokines and agonists; related reagents
CN101605814B (en) * 2006-12-14 2014-02-19 默沙东公司 Engineered Anti-TSLP Antibodies
CN104231081A (en) * 2007-09-10 2014-12-24 安美基公司 Antigen binding proteins capable of binding thymic stromal lymphopoietin
CN104231081B (en) * 2007-09-10 2022-01-11 安美基公司 Antigen binding proteins capable of binding thymic stromal lymphopoietin

Also Published As

Publication number Publication date
CN1234728C (en) 2006-01-04

Similar Documents

Publication Publication Date Title
CN1385441A (en) Novel human lymphokine, its coding sequence and use
CN1343725A (en) Human angiogenin-like protein and coding sequence and application thereof
CN1477117A (en) Novel human phosphotidylethanolamine binding protein, its coding sequence and application
CN1371916A (en) Human siali acid conjugated immunoglobulin-like agglutinant, its coding sequence and use
CN1477118A (en) Novel DnaJ/Hsp40 molecule DC-DJIII, its coding sequence and application
CN1238379C (en) New osteoclast formation inhibiting factor and its coding sequence and use
CN1299827A (en) New human CD20 homolgous molecule and its code sequence and use
CN1475502A (en) New withered induced protein, its coded sequence and use
CN1368509A (en) Human protein with suppression to cancer cell growth and its coding sequence
CN1388132A (en) Cell death inducing protein and its coding sequence and use
CN1171901C (en) Novel interferon-like protein, its coding sequence and use
CN1477115A (en) Novel human cyclin, its coding sequence and application
CN1325874A (en) Human C-type lectin-like receptor and its coding sequence and application
CN1367179A (en) Novel liver regeneration related protein, its code sequence and application
CN1477193A (en) Novel human Rab GTP enzyme, its coding sequence and application
CN1475503A (en) Novel growth inhibitory factor derived from human bone marrow stromal cells, its coding sequence and use
CN1477119A (en) Novel Human cysteine proteinase inhibitor sample molecule, its coding sequence and application
CN1475501A (en) New type human bone marrow substrate cell source 1 type phosphoric acid enzyme inhibition factor, its coded sequence and use
CN1475500A (en) New type human marrow differentiation tagged object its coded sequence and use
CN1470524A (en) Polypeptide-human transcriptional elongation factor IIS51 and polynucleotide encoding this polypeptide
CN1299828A (en) New cell factor acceptor and its code sequence and use
CN1299832A (en) New human cell cycle regulating protein and its code sequence and use
CN1299824A (en) New human coupling acceptor and its code sequence
CN1477114A (en) Immunoglobulin sample receptor originated from human dendritic cell, its coding sequence and application
CN1477116A (en) Novel human secretion-related membrane protion, its coding sequence and its application

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
ASS Succession or assignment of patent right

Owner name: SHANGHAI RUIXING GENE TECHNOLOGY CO., LTD.

Free format text: FORMER OWNER: LUO YING

Free format text: FORMER OWNER: WU JUN

Effective date: 20040903

C41 Transfer of patent application or patent right or utility model
TA01 Transfer of patent application right

Effective date of registration: 20040903

Address after: 201203 Shanghai Pudong Zhangjiang Songtao road 647 Lane 1 No. 5-6

Applicant after: Shanghai Genomics

Address before: 201203, Zhangjiang hi tech park, Shanghai, No. 573 Blue River Road, 501 apartment building, room 11

Applicant before: Luo Ying

Co-applicant before: Wu Jun

C14 Grant of patent or utility model
GR01 Patent grant
C17 Cessation of patent right
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20060104

Termination date: 20100516