WO2011052013A1 - Nucleic acid strand binding method and nucleic acid strand modification method - Google Patents

Abstract

Disclosed is a method for binding a first nucleic acid strand to a second nucleic acid strand, in which the experiment can be carried out safely within a short reaction time by using the first nucleic acid strand, the second nucleic acid strand and a third nucleic acid strand without the need of using any radioactive isotope.  Also disclosed is a method for labeling a nucleic acid strand by utilizing the binding method. Specifically disclosed is a method for binding a 3’-hydroxyl group in a first nucleic acid strand having at least one ribonucleotide at the 3'-terminal to a 5’-phosphate group in a second nucleic acid strand.  The method is characterized by comprising the following steps: carrying out the base pair formation between the first nucleic acid strand and a third nucleic acid strand capable of binding complementary to at least a part of the first nucleic acid strand and at least a part of the second nucleic acid strand and the base pair formation between the second nucleic acid strand and the third nucleic acid strand simultaneously or separately in the presence of the third nucleic acid strand; and adding an RNA ligase that is classified into EC6.5.1.3 and has an activity to repair a nick in a double-stranded nucleic acid to a mixture of the first, second and third nucleic acid strands obtained in the preceding step, wherein the third nucleic acid strand has a nucleotide sequence complementary to a nucleotide sequence composed of one or more contiguous nucleotides including a nucleotide located at the 3'-terminal of the first nucleic acid strand and also has a nucleotide sequence complementary to a nucleotide sequence composed of one or more contiguous nucleotides including a nucleotide located at the 5'-terminal of the second nucleic acid strand, and wherein the length of the nucleotide sequence that is contained in the third nucleic acid strand and is complementary to the second nucleic acid strand is less than half the length of the second nucleic acid strand.

Description

Nucleic acid chain binding and modification methods

The present invention relates to a method for binding a 3 'hydrosyl group of a first nucleic acid strand and a 5' phosphate group of a second nucleic acid strand, and a method for modifying the second nucleic acid strand thereby.

Conventionally, in the field of molecular biology and genetic engineering, modifying or labeling a nucleic acid strand such as RNA is one of the experimental methods essential for research and development, and at the same time, it is a powerful research method. But there is. Further, since this is an experimental technique frequently used by researchers, there is a need for a simple technique that uses an enzyme capable of performing a reaction at room temperature and normal pressure and that can perform an experiment safely.

As such a technique, in Non-Patent Document 1, the 3 'end of the RNA strand is modified using a non-radioactive isotope. In this method, since a non-radioactive isotope is used, an experiment can be performed safely. However, since RNA biosynthesis extends from the 5 ′ end to the 3 ′ end, an extension reaction can be performed on the modified RNA strand. It becomes impossible.

In Non-Patent Document 2, the 5 ′ end is modified with T4 polynucleotide kinase, but at the same time, the radioactive isotope [γ- ³² P] ATP must be used. Therefore, a dedicated facility is required, and a large burden is imposed on the disposal of radioactive waste. Also, a technique that is familiar with handling is necessary from the viewpoint of safety.

In order to solve such a problem, in recent years, by using a technique such as Non-Patent Documents 3 and 4 or Patent Document 1, a modified strand prepared in advance is bound to a target nucleic acid strand. Techniques for modifying and labeling the nucleic acid strands have been proposed. In Patent Document 1, a first nucleic acid chain and a second nucleic acid chain are arranged via a third nucleic acid chain, thereby binding the first nucleic acid chain and the second nucleic acid chain. .

JP 2002-171983 A

By the way, in the methods of Non-Patent Documents 3 and 4 or Patent Document 1, in order to bind the first nucleic acid strand and the second nucleic acid strand, the 3 ′ end of the first nucleic acid strand and the second nucleic acid strand The first nucleic acid strand so that several bases of the 3′-end sequence and the 5′-end sequence, each containing 2 bases at the 5 ′ end, form a loop structure called “broken interior loop” (see Non-Patent Document 3). And the second nucleic acid strand must be arranged on the third nucleic acid strand, and the sequence must be configured so that base pairing between bases does not occur in the generated loop structure. . Therefore, structural restrictions are imposed on both the 3 'terminal sequence of the first nucleic acid strand and the 5' terminal sequence of the second nucleic acid strand, or at least one of the sequences.

Therefore, even if an attempt is made to bind a modified strand prepared in advance to the target nucleic acid strand, there may be a combination of the nucleic acid strand and the modified strand that cannot be bound due to structural problems of the target nucleic acid strand and / or the base sequence of the modified strand It will come out. Such a structural restriction in the base sequence is caused by the fact that the enzyme used is T4 RNA ligase 1.

The present invention has been made in view of such a situation, and the first nucleic acid strand that can be completed in a short time using the first nucleic acid strand, the second nucleic acid strand, and the third nucleic acid strand. It is an object of the present invention to provide a method for binding a nucleic acid strand to a second nucleic acid strand, and a method for labeling a nucleic acid strand that can be used to safely perform experiments without using a radioisotope. *

According to a first main aspect of the present invention, there is provided a method for binding a 3 ′ hydrosyl group of a first nucleic acid strand and a 5 ′ phosphate group of a second nucleic acid strand comprising:
In the presence of a third nucleic acid strand that complementarily binds to at least a part of the first nucleic acid strand and at least a portion of the second nucleic acid strand, it has at least one or more ribonucleotides at the 3 ′ end. A step of performing base pairing of the first nucleic acid strand and the third nucleic acid strand and base pairing of the second nucleic acid strand and the third nucleic acid strand simultaneously or separately; A mixture of the three nucleic acid strands of the first nucleic acid strand, the second nucleic acid strand, and the third nucleic acid strand obtained in step 6 above and classified into EC 6.5.1.3 and a double-stranded nucleic acid nick A step of adding an RNA ligase having repair activity, wherein the third nucleic acid strand is complementary to at least one or more consecutive base sequences including a base at the 3 ′ end of the first nucleic acid strand And the third nucleic acid strand is at the 5 ′ end of the second nucleic acid strand. The base sequence in the third nucleic acid strand having a base sequence complementary to at least one continuous base sequence containing a base and complementary to the second nucleic acid strand is the second base sequence. There is provided a method characterized in that it is less than half the length of the nucleic acid strand.

Such a configuration can provide a simple method for binding the first nucleic acid strand and the second nucleic acid strand. Further, according to the present invention, in the binding between RNAs, self-circulation of the RNA strand can be performed by protecting the 3 ′ end of one RNA strand as in the conventional method using T4 RNA ligase 1. There is no need to perform such processing. Furthermore, according to the present invention, there are disadvantages in binding RNAs using T4 DNA ligase, that is, a large amount of enzyme must be used, a long reaction time is required, and further, The disadvantage that the rate is low can be solved.

In addition, according to such a configuration, the nucleic acid strands can be prevented from being circularized and the nucleic acid strands can be bonded to each other. This can also be used to enable 5 'end modification of nucleic acid strands.

Moreover, according to one embodiment of the present invention, in such a method, the RNA ligase is T4 RNA ligase 2 derived from T4 bacteriophage.

According to another embodiment of the present invention, in such a method, the third nucleic acid strand has a base sequence in the third nucleic acid strand that is complementary to the second nucleic acid strand. It will be 10 bases or less.

According to still another embodiment of the present invention, in such a method, the second nucleic acid strand is an RNA strand.

Further, according to still another embodiment of the present invention, in such a method, the first nucleic acid strand has a base sequence in which a single base is continuous for 6 bases or more.

According to still another embodiment of the present invention, in such a method, the first nucleic acid strand has a 5 'end labeled with a dye, a fluorescent dye or biotin.

According to a second main aspect of the present invention, there is provided a kit for use in the above-described method, wherein the first nucleic acid strand having at least one or more ribonucleotides at the 3 ′ end, and EC 6.5.1. A kit is provided, comprising: an RNA ligase classified as .3 and having a double-stranded nucleic acid nick repair activity; and a reaction buffer for the binding reaction.

Also, according to one embodiment of the present invention, in such a kit, the RNA ligase is T4 RNA ligase 2 derived from T4 bacteriophage.

Also, according to another embodiment of the present invention, in such a kit, the first nucleic acid strand has a base sequence in which a single base is continuous for 6 bases or more.

According to yet another embodiment of the present invention, in such a kit, the first nucleic acid strand has a 5 'end labeled with a dye, a fluorescent dye or biotin.

It should be noted that features and remarkable actions / effects of the present invention other than those described above will be apparent to those skilled in the art by referring to the following embodiments and drawings of the present invention.

FIG. 1 is an electrophoretogram showing a modification experiment by ligation of an oligo RNA strand according to one embodiment of the present invention. FIG. 2 is a schematic diagram of a base sequence pairing experiment according to an embodiment of the present invention. FIG. 3 is an electrophoretogram showing the involvement of base sequence pairing in the modification according to one embodiment of the present invention. FIG. 4 is a schematic diagram showing a stringency experiment of base sequence pairing according to an embodiment of the present invention. FIG. 5 is an electrophoretogram showing the stringency of base sequence pairing in the modification according to one embodiment of the present invention. FIG. 6 is an electrophoretogram showing a miRNA modification experiment according to an embodiment of the present invention. FIG. 7 is an electrophoretogram showing a modification experiment with four types of homo-oligomers according to one embodiment of the present invention. FIG. 8 is a schematic view of an oligoribonucleotide tag addition reaction experiment according to an embodiment of the present invention. FIG. 9 is an electrophoretogram showing an oligoribonucleotide tag addition reaction experiment according to an embodiment of the present invention. FIG. 10 is an electropherogram showing a modification experiment of 73mer RNA according to one embodiment of the present invention. FIG. 11 is an electrophoretogram showing an RNA pull-down experiment by biotinylation according to one embodiment of the present invention. FIG. 12 is a schematic view of ligation using auxiliary nucleic acid strands having different strand lengths in the sequence of the pairing portion according to one embodiment of the present invention. FIG. 13 is an electrophoretogram showing the relationship between the ligation speed and the chain length of the auxiliary nucleic acid chain according to one embodiment of the present invention.

As described above, according to the present invention, a method for binding a first nucleic acid strand and a second nucleic acid strand using a third nucleic acid strand and a predetermined RNA ligase, and a method for use in the method A kit is provided.

In addition, by labeling or modifying the first nucleic acid strand, any second nucleic acid strand can be labeled or modified via the first nucleic acid strand using the method as described above. Can do.

The first nucleic acid strand used in the present invention may be a nucleic acid strand having any base sequence as long as at least the 3'-end base is RNA. Further, the first nucleic acid chain may be a sequence in which DNA and RNA are mixed. Moreover, the first nucleic acid chain according to the present invention may have a base sequence in which a single base is continuous for 6 bases or more.

The second nucleic acid strand used in the present invention may be any base sequence as long as it is a single-stranded nucleic acid sequence. That is, the second nucleic acid chain may be a DNA sequence, an RNA sequence, or a sequence in which DNA and RNA are mixed. Further, the length of the second nucleic acid chain is not particularly limited, and may be 70 mer or longer.

In the third nucleic acid strand used in the present invention, the 5 ′ terminal sequence is the 5 ′ terminal sequence of the second nucleic acid strand, and the 3 ′ terminal sequence is the 3 ′ terminal side of the first nucleic acid strand. It forms a base pair in a complementary manner with the sequence and functions to assist the binding between the first nucleic acid strand and the second nucleic acid strand. In addition, the third nucleic acid strand according to the present invention may be an RNA strand, a DNA strand, or a sequence in which DNA and RNA are mixed, but it is economical for those skilled in the art who carry out the method according to the present invention. In this respect, the use of a DNA strand is preferable.

In addition, the third nucleic acid chain according to the present invention prevents the second nucleic acid chain from being circularized when the first nucleic acid chain and the second nucleic acid chain are combined. Furthermore, by carrying out the method according to the present invention, the binding reaction between the first nucleic acid strand and the second nucleic acid strand is accelerated, which is another factor for preventing the self-circularization of the second nucleic acid strand. It has become.

Furthermore, in the method according to the present invention, the third nucleic acid strand includes at least one or more consecutive base sequences having a base at the 3 ′ end of the first nucleic acid strand, and the second nucleic acid strand, It is preferable to have at least one continuous base sequence having a base at the 5 ′ end of the nucleic acid strand and a complementary base sequence. In addition, the complementary binding between the first nucleic acid strand and the third nucleic acid strand, and the complementary binding between the second nucleic acid strand and the third nucleic acid strand are strictly base paired. Preferably, it is formed.

In addition, the present inventors have found that the complementary reaction between the second nucleic acid strand and the third nucleic acid strand increases the speed of the binding reaction when the paired strand length is shortened ( See Example 10 below). For example, Bullard et al. Studied the substrate specificity of ligase using a double-stranded nucleic acid with a nick in one strand, but in this enzyme activity measurement experiment, the base of the nucleic acid strand on the non-nicked side was nicked. Nick repair activity is delayed because all base pairs are formed with a base of a complementary nucleic acid strand (Bullard, DR and Bowater, RP 2006. Direct comparison of nickjoining activity of the nucleic acid ligases from bacteriophage T4. Biochem. J . 398: 135-144.).

The RNA ligase classified in EC 6.5.1.3 and having double-stranded nucleic acid nick repair activity used in the present invention is an EC number established by the International Union of Biochemical and Molecular Biology and is designated as EC 6.5.1.3. These enzymes are classified and are enzymes that catalyze the reaction of ATP + (ribonucleotide) n + (ribonucleotide) m = AMP + diphosphate + (ribonucleotide) n + m, and have an activity of repairing a nick in a double-stranded nucleic acid. The RNA ligase according to the present invention is preferably T4 RNA ligase 2 derived from T4 bacteriophage. Furthermore, the RNA ligase according to the present invention is T4 bacteriophage-derived T4 RNA ligase 2, vibriophage KVP40-derived ligase 2, Trypanosoma brucei RNA ligase, Deinococcus radiodurans RNA ligase RNAiol or ligase RNAi ligase RNAi ligase RNAiol or ligase RNAi ligase RNAiol ligase RNAiolase or LeiRNA Any RNA ligase classified as EC 6.5.1.3 and having a double-stranded nucleic acid repair activity is not limited to these ligases.

In the method according to the present invention, the binding between the first nucleic acid strand and the second nucleic acid strand is a condition of ligase reaction commonly used in the field of molecular biology as long as the RNA ligase according to the present invention functions. The reaction may be carried out under any conditions within the range of conditions. For example, as described in Examples described later, a first nucleic acid strand, a second nucleic acid strand, a third nucleic acid strand, a buffer solution, and pure water are mixed, and the RNA ligase according to the present invention is added to the mixture. And then reacting at a temperature at which the ligase functions (eg, 37 ° C.) for a predetermined time (eg, 1 hour). Moreover, the dose of each component such as the first nucleic acid chain used in the binding reaction of the method according to the present invention can be appropriately changed by those skilled in the art.

Moreover, by using the method according to the present invention, the second nucleic acid strand used in the present invention can be labeled or modified. In this case, these labels or modifications are not particularly limited as long as they are performed by a substance or compound that can label or modify a nucleic acid. For example, the second nucleic acid strand according to the present invention can be labeled with biotin, a dye or a fluorescent dye, and the fluorescent dye may be Cy (trademark) 3, Cy (trademark) 5, FITC, etc. It may be a sign, a DIG sign, or the like. The labeled or modified nucleic acid strand after the reaction can be used for the purpose of hybridization or the like as it is or after purification. For purification, column separation or electrophoresis can be used. Conditions generally used in the field of molecular biology can be used for electrophoresis and column separation.

When the second nucleic acid strand according to the present invention is labeled or modified, it is performed through the binding between the first nucleic acid strand and the second nucleic acid strand as described above. That is, before performing the binding reaction between the first nucleic acid strand and the second nucleic acid strand, as a pretreatment, the first nucleic acid strand is labeled with the predetermined label, and the labeled first The second nucleic acid strand can be modified or labeled by performing a binding reaction using the above nucleic acid strand. In this case, the position of the label in the first nucleic acid chain is not particularly limited, and the label can be arranged at an arbitrary position in the first nucleic acid chain. For example, it may be at the 5 'end of the first nucleic acid strand or near the 3' end that binds to the second nucleic acid strand. Of course, such a modification may be a label in the strand of the second nucleic acid strand.

Conventionally, a DNA splint method using DNA ligase has been used for binding RNA strands. However, the reaction time takes several hours, the reaction yield is low, and a large amount of DNA ligase is used. There was a problem that had to be used. As a solution to this problem, an RNA ligase-mediated ligation method using T4 RNA ligase 1 and RNA protected at the 3 ′ end has been reported. This method is 5′-silyl-2′-. RNA having an acetylethyl orthoester protecting group is required and is not practical (Non-patent Document 4). Further, in this RNA ligase-mediated binding method, as described above, it is necessary to form a broken interior loop with the two nucleic acid strands to be bound, and structural restrictions are imposed on the sequences in the two nucleic acid strands. End up. Furthermore, when one nucleic acid strand is to be labeled by binding the nucleic acid strands, in the RNA ligase-mediated binding method, the position of the label such as a fluorescent dye in the other nucleic acid strand is positioned near the nucleic acid binding site. At present, it has not been confirmed whether it can be arranged.

Here, T4 RNA ligase 2 derived from T4 bacteriophage according to an embodiment of the present invention described later was discovered and cloned in 2002 (Ho, Shuman 2002), and its properties have been studied. Yin et al. (2003) examined the activity of T4 RNA ligase 2 using stem loop RNA consisting of two RNAs as a substrate. Nandakumar et al. (2004) use two nucleic acid strands of 24 bases that form a 12 bp pair, and the polymerization of the nucleic acid strands is used as an indicator of the activity of T4 RNA ligase 2. Bullard et al. (2006) studied the substrate specificity of ligase using a 20 bp double stranded nucleic acid nicked in one strand. This 20-bp double-stranded nucleic acid substrate is produced overnight. This study is aimed at repairing nicks in double-stranded nucleic acids, and the length of the non-nicked nucleic acid strand and the arbitrary nature of the 5 'phosphorylated RNA to be bound are not known. Using the partial sequence of the 5 'end, there was a big difference from the method of modifying the 5' end (Ho, CK and Shuman, S. 2002. Bacteriophage T4 RNA ligase 2 (gp24.1) exemplifies a family of RNA ligases found in all phylogenetic domains. Proc Natl Acad Sci USA.99: 12709-12714., Yin, S., Ho, CK, and Shuman, S. 2003. Structure-function analysis of T4 RNA ligase 2. J Biol. Chem. 278: 17601-17608. Biol. Chem. 279: 31337-31347., Bullard, DR and Bowater, RP 2006. Direct comparis on of nickjoining activity of the nucleic acid ligases from bacteriophage T4. Biochem. J. 398: 135-144.).

By using the method according to the present invention, the 5 'end of the nucleic acid chain can be modified easily without using a radioactive isotope. As described above, various fluorescent dyes, biotin, and other labels can be used for the modification. Currently, oligo RNA strands themselves are cheaper and easier to obtain than before, but labeled nucleic acids such as labeled RNA are currently expensive. The method according to the present invention is a useful method because it can easily label a nucleic acid chain such as an arbitrary RNA, thereby reducing the economic burden.

The method according to the present invention makes it possible to easily generate a nucleic acid chain labeled with a non-radioactive isotope, and to add a new base sequence to the 5 'end of the nucleic acid chain.

Further, when the method according to the present invention is compared with the conventional nucleic acid chain binding method, they can be summarized as shown in Table 1 below.

That is, as shown in # 1 and # 2, when DNAs or RNAs are bound to each other, the reaction is slow regardless of which enzyme is used for the two nucleic acid strands involved in the binding, and the nucleic acid strands are self-circular There is also a problem of conversion. In addition, as shown in # 3, it has been conventionally known that a good reaction can be performed between DNAs by using an auxiliary nucleic acid strand as a third nucleic acid strand and T4 DNA ligase. Regarding the binding between RNAs, a good reaction mode has not been known. As shown in # 4, RNA can be bound to each other using the third nucleic acid strand, the auxiliary nucleic acid strand, and T4 DNA ligase, but the reaction time is long, a large amount of enzyme is required, the yield is low, etc. There was a problem. In addition, as shown in # 5, a method using an auxiliary nucleic acid strand, which is a third nucleic acid strand, and T4 RNA ligase 1 has also been reported. However, the above-described Broken interior loop structure must be provided, and RNA that can bind to it. There was a restriction on the sequence. On the other hand, the method according to the present invention solves the problem of using a T4 DNA ligase without providing a Broken interior loop structure. For RNA-RNA / DNA binding as shown in # 6, it is not necessary to prepare a third nucleic acid strand, but it is necessary to form a complementary base pair for a part of the nucleic acid strands to be joined. Yes, as in # 5, there are limitations on the arrangement.

In addition, representative reactions of the method according to the present invention will be described below, but it goes without saying that the present invention is not limited to these reaction examples.

First, typical examples of the nucleic acid chain binding method according to the present invention will be described.
1) The first nucleic acid strand and the third nucleic acid strand are base-paired in a buffer solution, and a complex of the base-paired first nucleic acid strand and third nucleic acid strand is obtained (nucleic acid strand). Complex A). Thereafter, the nucleic acid strand complex A and the second nucleic acid strand are base-paired in a buffer solution to obtain a complex in which the first nucleic acid strand and the second nucleic acid strand are base-paired to the third nucleic acid strand. (Nucleic acid chain complex B). Then, an RNA ligase having double-stranded nucleic acid strand nick repair activity is added to the nucleic acid strand complex B in the buffer solution, and the catalytic action causes the 3 ′ hydrosyl group of the first nucleic acid strand and the second nucleic acid strand to To the 5 'phosphate group.
2) The first nucleic acid strand, the second nucleic acid strand, and the third nucleic acid strand are mixed in a buffer. This nucleic acid chain mixture is subjected to base pairing in a buffer solution to obtain a complex in which the first nucleic acid chain and the second nucleic acid chain are base paired with the third nucleic acid chain (nucleic acid chain complex B). Then, an RNA ligase having double-stranded nucleic acid strand nick repair activity is added to the nucleic acid strand complex B in the buffer solution, and the catalytic action causes the 3 ′ hydrosyl group of the first nucleic acid strand and the second nucleic acid strand to To the 5 'phosphate group.

Subsequently, representative examples of the method for modifying a nucleic acid chain according to the present invention will be described.
1) Prepare a first nucleic acid strand whose 5 ′ end is labeled with biotin, a fluorescent dye or the like. The first nucleic acid strand and the third nucleic acid strand are base-paired in a buffer solution to obtain a complex of the base-paired first nucleic acid strand and the third nucleic acid strand (nucleic acid strand complex A). ). Thereafter, the nucleic acid strand complex A and the second nucleic acid strand are base-paired in a buffer solution to obtain a complex in which the first nucleic acid strand and the second nucleic acid strand are base-paired to the third nucleic acid strand. (Nucleic acid chain complex B). Then, an RNA ligase having double-stranded nucleic acid strand nick repair activity is added to the nucleic acid strand complex B in the buffer solution, and the 3 ′ hydrosyl group of the first nucleic acid strand labeled by this catalytic action and the second nucleic acid strand To the 5 'phosphate group. This labels the 5 ′ end of the second nucleic acid strand.
2) Prepare a first nucleic acid strand whose 5 ′ end is labeled with biotin, fluorescent dye or the like. The first nucleic acid strand, the second nucleic acid strand, and the third nucleic acid strand are mixed in a buffer solution. Thereafter, this nucleic acid chain mixture is subjected to base pairing in a buffer solution to obtain a complex in which the first nucleic acid chain and the second nucleic acid chain are base-paired to the third nucleic acid chain (nucleic acid chain complex B). ). Then, RNA ligase having double-stranded nucleic acid strand nick repair activity is added to the nucleic acid strand complex B in the buffer solution, and the catalytic action causes the 3 ′ hydrosyl group of the first nucleic acid strand and the second nucleic acid strand to To the 5 'phosphate group. This labels the 5 ′ end of the second nucleic acid strand.

Next, the effects of the present invention will be described with reference to examples. However, it will be understood that the invention is not limited to the examples described below, and that various changes and modifications can be readily made by those skilled in the art.

Hereinafter, examples according to the present embodiment will be described in detail with reference to the drawings. In each example, the terms “acceptor RNA”, “RNA to be modified”, and “auxiliary nucleic acid strand” are used, and “first nucleic acid strand” and “second nucleic acid” in the present invention, respectively. “Strand”, “third nucleic acid strand”. *

In Examples 1 to 10, which will be described later, experiments were performed using DNA strands or RNA strands described in Table 2 below.

[Modification by ligation of oligo RNA strand]
(experimental method)
In Experiment a, 0.1 nmol of RNA strand to be modified (pR21) and 2 μl of Buffer 1 (500 mM Tris-HCl (pH 7.8), 100 mM MgCl ₂ , 100 mM DTT, 10 mM ATP) were added, and pure water was added. 19 μl.

In Experiments b and d, 0.1 nmol of RNA to be modified (pR21), 2 μl of buffer 1 and 0.5 nmol of acceptor RNA (AcF-1) were added, and pure water was added to make 19 μl.

Experiment c was performed by adding RNA to be modified (pR21), 0.1 nmol, 2 μl of buffer 1, 0.5 nmol of acceptor RNA (AcF-1), 2.7 μl of polyethylene glycol, and adding pure water to 19 μl.

2 nmol of acceptor RNA (AcF-1) and 2 nmol of auxiliary nucleic acid strand (DNA strand: BrR21-6) are dissolved in 20 μl of 10 mM Tris-HCl, 20 mM NaCl (pH 7.5) buffer, and annealed at 65 ° C. for 5 minutes. This was used as an annealing solution.

Experiments e, f, and g were 0.1 nmol of RNA to be modified (pR21), 2 μl of buffer 1 and 5 μl of annealing solution were added, and experiment f was further added with 2.7 μl of polyethylene glycol and then with pure water. 19 μl and annealed at 65 ° C. for 5 minutes.

Experiment a added 1 μl of pure water, experiments b, c, e, f added 1.67 μg T4 RNA ligase 1 (1 μl), experiment d, g added 0.29 μg T4 RNA ligase 2 (1 μl). The reaction was started at 37 ° C., and after 1 hour, 2.5 μl was taken from the reaction solutions a, b, c, d, e, f, and g, and a reaction stop solution (80% formamide, 10 mM EDTA (pH 8. 0), 0.025% bromophenol blue), immediately heat-treated at 80 ° C. for 5 minutes, then placed on ice and rapidly cooled, 12.5% denaturing acrylamide gel (1 × TBE buffer, 7 (Containing 5M urea) and electrophoresis was performed using 1 × TBE buffer as an electrophoretic solution. After the electrophoresis, the gel was taken out from the apparatus and photographed by applying ultraviolet rays. Thereafter, the gel was stained with ethidium bromide, then exposed to ultraviolet light, and photographed again.

(Experimental result)
In experiments a, b, c, d, e, f, and g, acceptor RNA (AcF-1) is ligated to the RNA strand to be modified (pR21) only in experiment g, and the RNA strand to be modified (pR21) is labeled with FITC. (FIG. 1, lane 7). In the reaction using T4 RNA ligase 1 (experiments b, c, e, f), the 5 ′ phosphate group and 3 ′ hydroxyl group of the RNA strand to be modified (pR21) are ligated and circularized, but the acceptor RNA ( Ligation with AcF-1) was not observed (FIG. 1, lanes 2, 3, 5, 6). In the reaction using T4 RNA ligase 2, when there was no auxiliary nucleic acid strand, the acceptor RNA (AcF-1) was not ligated with the RNA to be modified (pR21) (Experiment d, FIG. 1, lane 4). T4 RNA ligase 2 and an auxiliary nucleic acid strand are essential for ligation of the acceptor RNA (AcF-1) and the RNA to be modified (pR21). In this reaction, the RNA to be modified (pR21) is prevented from self-circulation, and the acceptor The RNA (AcF-1) and the RNA strand to be modified (pR21) can be successfully ligated.

[Base sequence pairing of RNA strand to be modified in auxiliary nucleic acid strand in ligation]
(experimental method)
Acceptor RNA (AcF-1) 1 nmol and auxiliary nucleic acid chain 1 nmol were dissolved in 10 μl of 10 mM Tris-HCl, 20 mM NaCl (pH 7.5) buffer solution, and annealed at 65 ° C. for 5 minutes to obtain an annealing solution. . In this experiment, in order to examine the base pairing of the 5 ′ side sequence of the RNA strand to be modified (pR21) in the ligation and the 5 ′ side sequence of the auxiliary nucleic acid strand, each experiment c, d, e, f, g, k The auxiliary nucleic acid strand (DNA strand), BrR21-1 (c), BrR21-2 (d), BrR21-3 (e), BrR21-4 (f), BrR21-5 (g), BrR21-6 ( h), BrR21-7 (i), BrR21-8 (j), BrR21-F (k) were used. BrR21-1, BrR21-2, BrR21-3, BrR21-4, BrR21-5, BrR21-6, BrR21-7, BrR21-8, BrR21-F are RNA strands to be modified (pR21) as shown in FIG. 1, 2, 3, 4, 5, 6, 7, 8, 21 base pairs with respect to the 5′-side sequence.

Experiment a was performed by adding 0.1 μmol of RNA strand to be modified (pR21) and 2 μl of buffer 1 (500 mM Tris-HCl (pH 7.8), 100 mM MgCl ₂ , 100 mM DTT, 10 mM ATP), and adding pure water to 19 μl. I made it.

In experiment b, 0.1 nmol of the RNA strand to be modified (pR21), 2 μl of buffer 1 were added, and pure water was added to make 19 μl.

In experiments c, d, e, f, g, h, i, j, k, 0.1 nmol of RNA to be modified (pR21), 2 μl of buffer 1, 5 μl of each annealing solution, and pure water were added. 19 μl and annealed at 65 ° C. for 5 minutes. In experiment a, pure water, 1 μl, and in experiments b, c, d, e, f, g, h, i, j, 0.29 μg of T4 RNA ligase 2 (1 μl) was added, and the reaction was started at 37 ° C. After 1 hour, 2.5 μl was taken from the reaction solution of a, b, c, d, e, f, g, h, i, j, k, and the reaction stop solution (80% formamide, 10 mM EDTA (pH 8. 0), 0.025% bromophenol blue), immediately heat-treated at 80 ° C. for 5 minutes, then placed on ice and rapidly cooled, 12.5% denaturing acrylamide gel (1 × TBE buffer, 7 (Containing 5M urea) and electrophoresis was performed using 1 × TBE buffer as an electrophoretic solution. After the electrophoresis, the gel was taken out from the apparatus and photographed by applying ultraviolet rays. Thereafter, the gel was stained with ethidium bromide, then exposed to ultraviolet light, and photographed again.

(Experimental result)
In experiments c, d, e, and f in which base pairing was 4 nucleotides or less, ligation of acceptor RNA (AcF-1) and RNA strand to be modified (pR21) was not observed (FIG. 3, lanes 3, 4, 5). 6). Weak ligation was seen in experiment g with 5 base pairs (FIG. 3, lane 7). In experiments c, d, e, f, and g, self-circulation of the RNA strand to be modified (pR21) is observed (FIG. 3, lanes 3 to 7). In experiments h, i, j, and k in which base pairing is 6 nucleotides or more, self-cyclization of the RNA strand to be modified (pR21) is suppressed, ligation is successfully performed, and the RNA strand to be modified (pR21) is labeled with FITC (Fig. 3, lanes 8, 9, 10, 11). This result indicates that a pair of 6 nucleotide pairs or more in the 5 ′ sequence of the RNA strand to be modified (pR21) and the 5 ′ sequence of the auxiliary nucleic acid strand promote the ligation of the acceptor RNA and the RNA strand to be modified.

[Strictness of base sequence pairing of the target RNA strand of the auxiliary nucleic acid strand]
(experimental method)
Acceptor RNA (AcF-1) 1.5 nmol and auxiliary nucleic acid strand 1.5 nmol were dissolved in 15 μl of 10 mM Tris-HCl, 20 mM NaCl (pH 7.5) buffer solution, and annealed at 65 ° C. for 5 minutes. An annealing solution was used. The auxiliary nucleic acid strand used in this experiment has 8 nucleotides in the paired sequence portion based on BrR21-8 whose 8 ′ sequence in the 5 ′ side is matched with 8 nucleotides in the 5 ′ side sequence of the RNA strand to be modified (pR21). Were replaced one by one with the same nucleotide as the nucleotide of the RNA strand to be modified (pR21). However, T was used for U of the RNA strand (pR21) to be modified (FIG. 4). Specifically, for each experiment a, b, c, d, e, f, g, h, i, the auxiliary nucleic acid strand (DNA strand), BrR21-8 (a), BrR21-8-1T (b ), BrR21-8-2G (c), BrR21-8-3A (d), BrR21-8-4G (e), BrR21-8-5G (f), BrR21-8-6T (g), BrR21-8 -7A (h), BrR21-8-8G (i).

In each experiment a, b, c, d, e, f, g, h, i, the RNA strand to be modified (pR21) 0.1 nmol, buffer 1 (500 mM Tris-HCl (pH 7.8), 100 mM MgCl ₂ , 100 mM DTT, 10 mM ATP) 2 μl, each annealing solution 5 μl, pure water is added to 19 μl, and annealing is performed at 65 ° C. for 5 minutes, and then experiments a, b, c, d, e, f, 0.29 μg of T4 RNA ligase 2 (1 μl) was added to g, h, i, and the reaction was started at 37 ° C. After 1 hour, a, b, c, d, e, f, g, h, i , J, k, and 2.5 μl were taken from the reaction solution, and an equal amount of a reaction stop solution (80% formamide, 10 mM EDTA (pH 8.0), 0.025% bromphenol blue) was immediately added to the reaction solution at 80 ° C. Then, it was placed on ice for rapid cooling and electrophoresed on a 12.5% denaturing acrylamide gel (1 × TBE buffer, containing 7.5 M urea) using 1 × TBE buffer as an electrophoresis solution. . After the electrophoresis, the gel was taken out from the apparatus and photographed by applying ultraviolet rays.

(Experimental result)
In the base pairing with the 8 ′ nucleotide at the 5 ′ side of the RNA strand to be modified (pR21), if the pairing from the 5 ′ end to the sixth position of the RNA strand to be modified (pR21) is eliminated by 1 base substitution (Experiment b, c, d, e, f, g), ligation of acceptor RNA (AcF-1) and RNA strand to be modified (pR21) was inhibited (FIG. 5, lanes 2 to 7). The ligation reaction in Experiments h and i proceeds almost the same as in Experiment a, and the influence on the ligation of the 7th and 8th unpairs from the 5 ′ end of the RNA strand to be modified (pR21) is small. As a result, base pairing of the 5 ′ side sequence of the auxiliary nucleic acid strand and the 5 ′ side sequence of the RNA strand to be modified (pR21) is from the 1st to the 6th from the 5 ′ end of the RNA strand to be modified (pR21). It shows that it is greatly inhibited by the unpairing of 1 base up to.

[Modification of miRNA]
(experimental method)
In this experiment, four miRNAs of the nematode Caenorhabditis elegans, cel-lin-4 (pUCCCUGAGACCUCAAGUGUGA, miRBase Accession #MIMATGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGU)) , MiRBase Access # MIMAT0000005), cel-miR-52 (pCACCCCGUACAUAUGUUCUCGUGUCU miRBase Access # MIMAT000cc) And NA chain tried FITC-labeled by ligation with the acceptor RNA (AcF-1).

In experiment a, 0.1 nmol of cel-lin-4 to be modified and 2 μl of buffer 1 (500 mM Tris-HCl (pH 7.8), 100 mM MgCl ₂ , 100 mM DTT, 10 mM ATP) were added, and pure water was added. 19 μl.

In experiment b, 0.1 nmol of cel-lin-4 to be modified, 2 μl of buffer 1 (500 mM Tris-HCl (pH 7.8), 100 mM MgCl ₂ , 100 mM DTT, 10 mM ATP) were added, and pure water was added. 19 μl.

For experiments c, d, e, f, acceptor RNA (AcF-1) 1.5 nmol, auxiliary nucleic acid strand (DNA strand), BrLin-4 (experiment c), BrMir-34 (experiment d), BrMir-52 (Experiment e), BrMir-87 (Experiment f) 1.5 nmol was dissolved in 15 μl of 10 mM Tris-HCl, 20 mM NaCl (pH 7.5) buffer solution, annealed at 65 ° C. for 5 minutes, and each annealed. Solutions c, d, e, and f were used.

Experiments c, d, e, and f are respectively two tubes (c1 and c2, d1 and d2, e1 and e2, f1 and f2, respectively), RNA to be modified, cel-lin-4 (experiment c), cel- miR-34 (experiment d), cel-miR-52 (experiment e), cel-miR-87 (experiment f) 0.1 nmol, buffer 1 (500 mM Tris-HCl (pH 7.8), 100 mM MgCl ₂ , 2 μl of 100 mM DTT, 10 mM ATP) and the corresponding annealing solution c, d, e, f, 5 μl were added, and pure water was added to make 19 μl, followed by annealing at 65 ° C. for 5 minutes.

In experiments a, c1, d1, e1, and f1, 1 μl of pure water was added. In experiments b, c2, d2, e2, and f2, 0.29 μg of T4 RNA ligase 2 (1 μl) was added, and the reaction was performed at 37 ° C. 1 hour later, 2.5 μl was taken from the reaction solution of a, b, c1, c2, d1, d2, e1, e2, f1, and f2, and the reaction stop solution (80% formamide, 10 mM EDTA (pH 8. 0), 0.025% bromophenol blue), and immediately heat-treated at 80 ° C. for 5 minutes, then placed on ice and rapidly cooled, 12.5% denaturing acrylamide gel (1 × TBE buffer, 7 (Containing 5M urea) and electrophoresis was performed using 1 × TBE buffer as an electrophoretic solution. After the electrophoresis, the gel was taken out from the apparatus and photographed by applying ultraviolet rays. Thereafter, the gel was stained with ethidium bromide, then exposed to ultraviolet light, and photographed again.
(Experimental result)
In the method using an auxiliary nucleic acid strand and T4 RNA ligase 2, 4 kinds of miRNAs having different 5 ′ terminal nucleotides from U, A, C and G, cel-lin-4, cel-miR-34, cel-miR-52 As for cel-miR-87, self-circulation of these miRNAs was prevented, and FITC labeling by ligation with acceptor RNA (AcF-1) could be performed. From the ethidium bromide-stained images, the original miRNA, cel-lin-4, cel-miR-34, cel-miR-52, and cel-miR-87 are almost identical to the acceptor RNA (AcF-1) in all reactions. It can be seen that the reaction was consumed. Regarding the RNA to be modified, due to the substrate specificity of T4 RNA ligase 2, it was thought that some RNA was difficult to modify, but in this experiment, all miRNAs whose 5 ′ terminal nucleotides are different from U, A, C, and G are all modified. (Fig. 6).

[Enzyme specificity for acceptor RNA sequence]
(experimental method)
In Experiment a, 2 μl of Buffer 1 (500 mM Tris-HCl (pH 7.8), 100 mM MgCl ₂ , 100 mM DTT, 10 mM ATP) was added to 0.1 nmol of the RNA strand to be modified (pR21), and pure water was added to 19 μl. did.

In experiment b, 2 μl of buffer solution 1 (500 mM Tris-HCl (pH 7.8), 100 mM MgCl ₂ , 100 mM DTT, 10 mM ATP) was added to 0.1 nmol of the RNA strand to be modified (pR21), and then pure water was added. 19 μl.

For experiment c, 2 nmol of the acceptor RNA (AcF-1), 2 nmol of the auxiliary nucleic acid strand (DNA strand: BrR21-6) were dissolved in 20 μl of a buffer of 10 mM Tris-HCl and 20 mM NaCl (pH 7.5). Annealing treatment was carried out at 5 ° C. for 5 minutes to obtain an annealing solution c.

For experiment d, 2 nmol acceptor RNA (AcF-2), 2 nmol auxiliary nucleic acid strand (DNA strand: BrR21-12) were dissolved in 20 μl of 10 mM Tris-HCl, 20 mM NaCl (pH 7.5) buffer solution, and 65 Annealing treatment was performed at 5 ° C. for 5 minutes, and this was used as an annealing solution d.

For experiment e, 2 nmol acceptor RNA (AcF-3), 2 nmol auxiliary nucleic acid strand (DNA strand: BrR21-13) were dissolved in 20 μl of 10 mM Tris-HCl, 20 mM NaCl (pH 7.5) buffer, and 65 Annealing treatment was carried out at 5 ° C. for 5 minutes, and this was used as an annealing solution e.

For experiment f, 2 nmol acceptor RNA (AcF-4), 2 nmol auxiliary nucleic acid strand (DNA strand: BrR21-14) were dissolved in 20 μl of 10 mM Tris-HCl, 20 mM NaCl (pH 7.5) buffer solution, and 65 Annealing treatment was performed at 5 ° C. for 5 minutes, and this was used as an annealing solution f.

Experiments c, d, e, and f are: 0.1 nmol of RNA to be modified (pR21), buffer 1 (500 mM Tris-HCl (pH 7.8), 100 mM MgCl ₂ , 100 mM DTT, 10 mM ATP) 2 μl, respectively, annealing solution 5 μl of c, d, e, and f was added, and pure water was added to make 19 μl, followed by annealing at 65 ° C. for 5 minutes. After that, in Experiment a, 1 μl of pure water was added, and in Experiments c, d, e, and f, 0.29 μg of T4 RNA ligase 2 (1 μl) was added, and the reaction was started at 37 ° C. After 1 hour, a, Take 12.5 μl from the reaction mixture of b, c, d, e, and f, add an equal amount of a reaction stop solution (80% formamide, 10 mM EDTA (pH 8.0), 0.025% bromphenol blue) and immediately add 80 Heat treatment at 5 ° C. for 5 minutes, then place on ice, cool rapidly, and use 12.5% denaturing acrylamide gel (1 × TBE buffer, containing 7.5M urea) as 1 × TBE buffer as electrophoresis solution Electrophoresis was performed. After electrophoresis, a fluorescent band from the ligation product was cut out from the gel, RNA was extracted from the gel slice, and the RNA amount was calculated.

(Experimental result)
The ligation rates of adenosine ribonucleotide (experiment c), uridine ribonucleotide (experiment d), guanine ribonucleotide (experiment e), cytosine ribonucleotide (experiment e) and RNA chain pR21 are as shown in Table 3 below. The reaction proceeds with adenine ribonucleotide, guanine ribonucleotide, and cytosine ribonucleotide homo-oligomer, but the reaction hardly proceeds with uridine ribonucleotide homo-oligomer.

FIG. 7 shows a stained image of ethidium bromide, but no band corresponding to the ligation product is detected in the uridine ribonucleotide homo-oligomer. In the four ribonucleotide homo-oligomers, the ligation product is the largest in the reaction of cytosine ribonucleotide homo-oligomer, but there are many by-products. In FIG. 7, many ligation products with guanine ribonucleotide homo-oligomer appear, and this seems to be because the guanine ribonucleotide chain is easily stained with ethidium bromide.

[Addition reaction of oligoribonucleotide tag]
(experimental method)
A schematic diagram of this experiment is shown in FIG.
In experiment a, RNA chain (pR21) 0.1 nmol and buffer 1 (500 mM Tris-HCl (pH 7.8), 100 mM MgCl ₂ , 100 mM DTT, 10 mM ATP) 2 μl were added, and pure water was added to make 19 μl. .

In Experiment b, RNA chain (pR21) 0.1 nmol, Buffer 1 (500 mM Tris-HCl (pH 7.8), 100 mM MgCl ₂ , 100 mM DTT, 10 mM ATP) 2 μl were added, and then pure water was added to 19 μl. did.

For experiments c, d, and e, 2 nmol of each acceptor RNA, Ac-1, AcEx09, AcEx14, 2 nmol of each auxiliary nucleic acid strand, BrR21-6, Br21Ex, BrR21-6, 10 mM Tris-HCl, 20 mM It was dissolved in 20 μl of NaCl (pH 7.5) buffer solution and annealed at 65 ° C. for 5 minutes, which were used as annealing solutions c, d and e, respectively.

In experiments c1, d1, and e1, 5 μl of the corresponding annealing solutions c, d, and e were added, and pure water was added to make 19 μl. Experiments c2, d2, and e2 were RNA strand (pR21) 0.1 nmol, buffer 1 (500 mM Tris-HCl (pH 7.8), 100 mM MgCl ₂ , 100 mM DTT, 10 mM ATP) 2 μl, corresponding annealing solution c, d, e, 5 μl was added, pure water was added to make 19 μl, and annealing treatment was performed at 65 ° C. for 5 minutes.

In experiments a, c1, d1, and e1, 1 μl of pure water was added. In experiments b, c2, d2, and e2, 0.29 μg of T4 RNA ligase 2 (1 μl) was added, and the reaction was started at 37 ° C. After time, 2.5 μl was taken from the reaction solution of a, b, c1, c2, d1, d2, e1, e2, and the reaction stop solution (80% formamide, 10 mM EDTA (pH 8.0), 0.025% bromphenol). blue) and immediately heat-treated at 80 ° C. for 5 minutes, then placed on ice for rapid cooling and 1% with 12.5% denaturing acrylamide gel (1 × TBE buffer, containing 7.5 M urea). X Electrophoresis was performed using TBE buffer as a running solution. After the electrophoresis, the gel was taken out from the apparatus, and the gel was stained with ethidium bromide, and then irradiated with ultraviolet rays and photographed.

(Experimental result)
With the method using the auxiliary nucleic acid strand and T4 RNA ligase 2, it was possible to bind the single-stranded oligoribonucleotide at its 5 ′ end with respect to the RNA strand (pR21). FIG. 9 shows the ethidium bromide stained image, and AcEx09 and AcEx14 could be added efficiently as in the case where the acceptor RNA, Ac-1, was ligated to the RNA strand (pR21). In Lane 4, 8mer Ac-1 binds to the RNA strand (pR21) and a 29mer band is seen. Similarly, in Lane 6, 16mer AcEx09 binds to the RNA strand (pR21) and a 29mer band appears. Then, 22-mer AcEx14 binds to the RNA strand (pR21) and a 45-mer band is seen. As a result, a 9- or 14-mer single-stranded oligoribonucleotide tag protruding 5 ′ from the RNA strand (pR21) could be added.

[Modification of 73-mer RNA]
(experimental method)
A plasmid, pBlueScript KS II (+) (Stratagene, CA), cut with EcoRV, followed by a T7 promoter sequence, the 3rd G to 73 bases of TATACGACTACTACTAGGG, a template for RNA in vitro transcription (Template 73) Was made. RNA in vitro transcription was performed using 0.1 μg / μl of template 73, 2 u / μl in a buffer containing 40 mM Tris-HCl (pH 7.9), 6 mM MgCl ₂ , 2 mM permidine, 10 mM DTT, 1 mM ATP, UTP, CTP, GTP. of T7 RNA polymerase was added and reacted at 37 ° C. for 3 hours, followed by phenol / chloroform extraction and ethanol precipitation to purify 73-mer RNA. Purified 73mer RNA was dephosphorylated with alkaline phosphatase and rephosphorylated with T4 polynucleotide kinase (pR73).

2 nmol of acceptor RNA (AcF-1) and 2 nmol of auxiliary nucleic acid strand (DNA strand: BrR73) were dissolved in 20 μl of a buffer solution of 10 mM Tris-HCl, 20 mM NaCl (pH 7.5), and annealed at 65 ° C. for 5 minutes. This was used as an annealing solution.

In experiments a and b, 0.05 nmol of RNA strand to be modified (pR73), buffer 1 (500 mM Tris-HCl (pH 7.8), 100 mM MgCl ₂ , 100 mM DTT, 10 mM ATP) 2 μl, annealing solution 5 μl were added, and pure Water was added to 19 μl, and annealing was performed at 65 ° C. for 5 minutes.

In experiment a, 1 μl of pure water was added, and in experiment b, 0.29 μg of T4 RNA ligase 2 (1 μl) was added, and the reaction was started at 37 ° C. After 1 hour, from the reaction solutions of a and b Take 1 μl, add an equal volume of reaction stop solution (80% formamide, 10 mM EDTA (pH 8.0), 0.025% bromphenol blue), immediately heat-treat at 80 ° C. for 5 minutes, then place on ice and quench rapidly Electrophoresis was performed using a 10% concentration denaturing acrylamide gel (1 × TBE buffer, containing 7.5 M urea) and 1 × TBE buffer as an electrophoresis solution.

(Experimental result)
By the method using the auxiliary nucleic acid chain and T4 RNA ligase 2, FITC labeling by ligation with the acceptor RNA (AcF-1) could be performed on the 73-nucleotide RNA chain (pR73). From the ethidium bromide staining, unreacted pR73 was estimated to be 30% or less, and 70% or more of pR73 was labeled with FITC (FIG. 10).

[Biotinylation for RNA selection]
(experimental method)
Acceptor RNA, Ac-1 or 2 nmol of AcB-1 biotinylated at the 5 ′ end and 2 nmol of auxiliary nucleic acid strand (DNA strand: BrLin-4) in 20 μl of 10 mM Tris-HCl, 20 mM NaCl (pH 7.5) buffer solution It was melted and annealed at 65 ° C. for 5 minutes, which were designated as annealing solutions F and B, respectively.

Experiments a and b are 0.2 nmol of an RNA strand (plin4-FITC) with a FITC label at the 3 ′ end of plin4, buffer 1 (500 mM Tris-HCl (pH 7.8), 100 mM MgCl ₂ , 100 mM DTT, 10 mM ATP) 2 μl and 5 μl of annealing solution F were added, and pure water was added to make 18 μl, followed by annealing at 65 ° C. for 5 minutes.

In experiments c and d, RNA chain (plin4-FITC) 0.2 nmol, buffer 1 (500 mM Tris-HCl (pH 7.8), 100 mM MgCl ₂ , 100 mM DTT, 10 mM ATP) 2 μl, annealing solution B 5 μl were added, Pure water was added to make 18 μl, and annealed at 65 ° C. for 5 minutes.

In experiments a and c, 2 μl of pure water was added, and in experiments b and d, 0.29 μg of T4 RNA ligase 2 (2 μl) was added, and the reaction was performed at 37 ° C. for 1 hour. On the other hand, streptavidin magnetic beads suspension (Dynabeads MyOne Streptavidin C1, purchased from Invitrogen) was collected by a magnet with streptavidin magnetic beads, and this was collected in buffer 2 (10 mM Tris-HCl (pH 7.5), 2M MgCl ₂ , Washed with 1 mM EDTA). 10 μl of the reaction solution from experiments b and d that had been ligated for 1 hour was originally mixed with the washed streptavidin magnetic bead pellet from the 20 μl suspension, suspended, and left for 15 minutes with occasional shaking. Thereafter, the streptavidin magnetic beads were removed with a magnet, and the liquid portion was recovered (10 μl). For the experiments a, b, c, d before treatment with streptavidin magnetic beads and the experiments b, d and 2.5 μl after treatment with magnetic beads, the reaction stop solution (80% formamide, 10 mM EDTA (pH 8.0), 0. 025% bromophenol blue) was immediately added, heat-treated at 80 ° C. for 5 minutes, then placed on ice and rapidly cooled, and 10% denaturing acrylamide gel (containing 1 × TBE buffer, 7.5 M urea) Electrophoresis was performed using 1 × TBE buffer as an electrophoresis solution. After the electrophoresis, the gel was taken out from the apparatus and photographed by applying ultraviolet rays. Thereafter, the gel was stained with ethidium bromide, then exposed to ultraviolet light, and photographed again.

(Experimental result)
In FIG. 11, lanes 3 and 5 show experiments b and d before the magnetic bead treatment, and lanes 5 and 6 show experiments b and d after the magnetic bead treatment. In experiment b, the bands ligated with the acceptor RNA, Ac-1 and plin4-FITC were seen in the same way before and after the magnetic bead treatment (compare lanes 3 and 5). On the other hand, in the experiment d, the band ligated with acceptor RNA, AcB-1 and plin4-FITC disappears after magnetic bead treatment (comparison between lanes 4 and 6), and biotinylated AcB-1-binding plin4-FITC is streptavidin. It can be seen that it was captured by the magnetic beads. This indicates that plin4-FITC from experiment b efficiently ligated with AcB-1.

[Preparation of T4 RNA ligase 2]
T4 gene 24.1 was obtained from T4 phage genomic DNA and cloned into the restriction enzyme sites of BamHI and NotI of the E. coli expression vector pETBA (Biodynamics Laboratory Inc.) (this plasmid is designated as pETBT4L2). Escherichia coli strain BL21 (DE3) was transformed with pETBT4L2 to obtain Escherichia coli BL21 (DE3) / pETBT4L2 retaining pETBT4L2.

This BL21 (DE3) / pETBT4L2 was inoculated into LB medium containing 0.1 mg / ml ampicillin, and when OD600 reached 0.5, 1 mM IPTG (Isopropyl β-D-1-thiogalactopyroside) was added, and further 3 The cells were cultured for a period of time and collected with a centrifuge. 9 ml of 50 mM NaH ₂ PO ₄ , 300 mM NaCl, 10 mM imidazole pH 8.0 buffer was added to the cell pellet obtained from the 50 ml culture solution, and the cell pellet was resuspended, and then 1 ml of 10 mg / ml lysozyme solution was added. Stir and let stand on ice for 30 minutes. This was centrifuged to obtain a supernatant, followed by filtration with a 0.2 μm pore syringe filter to obtain a crude enzyme filtrate.

A resin volume of 1 ml of Proband column (Invitrogen) was equilibrated with 50 mM NaH ₂ PO ₄ 300 mM NaCl, 10 mM imidazole, pH 8.0 buffer solution, and the above-mentioned crude enzyme filtrate was provided thereto, followed by 10 ml of 50 mM NaH. After washing with ₂ PO ₄ , 300 mM NaCl, 10 mM imidazole, pH 8.0 buffer and 10 ml of 50 mM NaH ₂ PO ₄ , 300 mM NaCl, 20 mM imidazole, pH 8.0 buffer, 50 mM NaH ₂ PO ₄ , 300 mM NaCl, 250 mM imidazole Elution was performed with pH 8.0 buffer. The obtained fraction eluted with T4 RNA Ligase ₂ was dialyzed against 20 mM Tris-HCl, 100 mM KCl, 70 mM (NH ₄ ) ₂ SO ₄ , 0.2 mM DTT, 0.2 mM EDTA at 4 ° C. An equal amount of glycerol was added to 910 μl of the obtained dialysis internal solution (protein amount: 0.53 mg) to prepare an enzyme solution. For the measurement of protein amount, BCA Protein Assay Kit manufactured by Thermo Scientific was used, and BSA was used as a standard.

[Ligation speed and auxiliary nucleic acid chain length]
(experimental method)
In this experiment, for the ligation of acceptor RNA (Ac-1) and RNA strand pR21, auxiliary nucleic acid strands (DNA strands) having different strand lengths in the sequence paired with RNA strand pR21, BrR21-6, BrR21-12, BrR21- The reaction rate was compared using F (see FIG. 12).

In experiment a, 2 μg (0.27 nmol) of RNA strand pR21 to be modified and 2 μl of buffer 1 (500 mM Tris-HCl (pH 7.8), 100 mM MgCl ₂ , 100 mM DTT, 10 mM ATP) were added, and pure water was added. 19 μl.

For experiments b, c and d, acceptor RNA (Ac-1) 2 nmol, auxiliary nucleic acid strand (DNA strand), BrR21-6 (experiment b), BrR21-12 (experiment c), BrR21-F (experiment d) 2 nmol was dissolved in 20 μl of 10 mM Tris-HCl, 20 mM NaCl (pH 7.5) buffer solution, and annealed at 65 ° C. for 5 minutes, which were designated as annealing solutions b, c, and d, respectively.

Experiments b, c and d are 2 μg (0.27 nmol) of RNA strand pR21 to be modified, buffer 1 (500 mM Tris-HCl (pH 7.8), 100 mM MgCl ₂ , 100 mM DTT, 10 mM ATP) 5 μl, corresponding annealing 12.5 μl of solutions b, c and d were added, and pure water was added to make 19 μl, followed by annealing at 65 ° C. for 5 minutes.

In Experiment a, 1 μl of pure water was added, and in Experiments b, c and d, 0.29 μg of T4 RNA ligase 2 (1 μl) was added, and the reaction was started at room temperature (25 ° C.). After 10 minutes, 30 minutes Then, 1 hour later, 2.5 μl was taken from the reaction solution, and an equal amount of a reaction stop solution (80% formamide, 10 mM EDTA (pH 8.0), 0.025% bromphenol blue) was added thereto, and immediately at 80 ° C. Heat treatment was performed for 1 minute, then placed on ice, rapidly cooled, and electrophoresed on a 12.5% denaturing acrylamide gel (1 × TBE buffer solution containing 7.5 M urea) using 1 × TBE buffer solution as an electrophoresis solution. . After the electrophoresis, the gel was taken out from the apparatus, and the gel was stained with ethidium bromide, then irradiated with ultraviolet rays, and photographed again.

(Experimental result)
In FIG. 13, lanes 2, 3, and 4 are auxiliary nucleic acid strand BrR21-6 (RNA strand pR21 and 6 base pairs), and lanes 5, 6, and 7 are BrR21-12 (RNA strand pR21 and 12 base pairs). Lanes 8, 9, and 10 show the results of the ligation experiment of acceptor RNA strand Ac-1 and RNA strand pR21 using BrR21-F (RNA base pR21 and 21 base pairing).

When the auxiliary nucleic acid strand BrR21-6 was used, most of 2 μg of the RNA strand pR21 was converted into a 29-mer RNA strand ligated with the RNA strand Ac-1 in 10 minutes, and after 30 minutes, the RNA strand pR21 was all 29 mer. It has been converted to an RNA strand and the reaction is complete. When the auxiliary nucleic acid strand BrR21-12 was used, about 50% of 2 μg of RNA strand pR21 was converted into a 29-mer RNA strand ligated with RNA strand Ac-1 in 30 minutes, and after 1 hour, 60% or more was 29-mer. Although converted to an RNA strand, the reaction is not complete. When the auxiliary nucleic acid strand BrR21-F was used, 2 μg of the RNA strand pR21 was converted into a 29-mer RNA strand ligated with RNA strand Ac-1 in 30 minutes, and about 50% of the RNA strand pR21 was converted even after 1 hour. It remained unreacted.

The above results indicate that the ligation of the acceptor RNA strand Ac-1 and the RNA strand pR21 to be modified varies depending on the chain length of base pairing with the RNA strand pR21 of the auxiliary nucleic acid strand to be used, and the length of base pairing is long. It shows that the reaction is slow. On the other hand, according to another experimental result, when BrR21-6 having a short base-pairing chain length was used, at least 10 μg of RNA strand pR21 was accepted as acceptor RNA strand Ac− in a reaction at room temperature (25 ° C.) of 0.5 μg of enzyme. Ligated with 1.

In addition, it goes without saying that the present invention can be variously modified, and is not limited to the above-described embodiment, and can be variously modified without changing the gist of the invention.

Claims (10)

1. A method of binding a 3 ′ hydrosyl group of a first nucleic acid strand and a 5 ′ phosphate group of a second nucleic acid strand,
   In the presence of a third nucleic acid strand that complementarily binds to at least a part of the first nucleic acid strand and at least a portion of the second nucleic acid strand, it has at least one or more ribonucleotides at the 3 ′ end. A step of performing base pairing of the first nucleic acid strand and the third nucleic acid strand and base pairing of the second nucleic acid strand and the third nucleic acid strand simultaneously or separately; A mixture of the three nucleic acid strands of the first nucleic acid strand, the second nucleic acid strand, and the third nucleic acid strand obtained in step 6 above and classified into EC 6.5.1.3 and a double-stranded nucleic acid nick Adding an RNA ligase having repair activity,
   The third nucleic acid strand has a base sequence complementary to at least one or more continuous base sequences including the base at the 3 ′ end of the first nucleic acid strand, and the third nucleic acid strand is The third nucleic acid having a base sequence complementary to at least one or more consecutive base sequences including the base at the 5 ′ end of the second nucleic acid strand and complementary to the second nucleic acid strand A method characterized in that the base sequence in the chain is less than half the chain length of the second nucleic acid chain.
2. The method according to claim 1, wherein the RNA ligase is T4 RNA ligase 2 derived from T4 bacteriophage.
3. The method according to claim 1, wherein the third nucleic acid strand has a base sequence of 10 bases or less in the third nucleic acid strand that is complementary to the second nucleic acid strand. And the method.
4. 2. The method according to claim 1, wherein the second nucleic acid strand is an RNA strand.
5. 2. The method according to claim 1, wherein the first nucleic acid strand has a base sequence in which a single base is continuous for 6 bases or more.
6. The method according to claim 1, wherein the first nucleic acid strand has a 5 'end labeled with a dye, a fluorescent dye or biotin.
7. A kit for use in the method according to claim 1,
   Said first nucleic acid strand having at least one or more ribonucleotides at the 3 'end;
   An RNA ligase classified in EC 6.5.1.3 and having double-stranded nucleic acid nick repair activity;
   A reaction buffer for the binding reaction;
   A kit comprising:
8. The kit according to claim 7, wherein the RNA ligase is T4 RNA ligase 2 derived from T4 bacteriophage.
9. 8. The kit according to claim 7, wherein the first nucleic acid chain has a base sequence in which a single base is continuous for 6 bases or more.
10. 8. The kit according to claim 7, wherein the first nucleic acid strand has a 5 'end labeled with a dye, a fluorescent dye or biotin.

Images