WO2021024467A1

WO2021024467A1 - Production method for single-strand rna

Info

Publication number: WO2021024467A1
Application number: PCT/JP2019/031427
Authority: WO
Inventors: 彬裕阪田
Original assignee: 住友化学株式会社
Priority date: 2019-08-08
Filing date: 2019-08-08
Publication date: 2021-02-11

Abstract

The present invention provides a production method that is for single-strand RNA and that comprises: (I) a step for causing an RNA ligase which has double-strand nick-repairing activity and is classified as EC6.5.1.3, which is an enzyme number defined by the International Union of Biochemistry, to act on first single-strand RNA having a phosphate group at the 5' end and second single-strand RNA having a hydroxy group at the 3' end so that the first single-strand RNA and the second single-strand RNA are linked together; and (II) a step for purifying a reaction product containing the single-strand RNA generated in the linking step (I) by reversed-phase column chromatography using a mobile phase containing at least one salt selected from the group consisting of monoalkylamine salts and dialkylammonium salts.

Description

Method for producing single-strand RNA

The present invention relates to a method for producing single-stranded RNA.

Nucleic acid compounds are reported in Patent Document 1 as nucleic acid molecules capable of suppressing gene expression. As such a nucleic acid compound, a compound having an amino acid structure in the linker portion of the nucleic acid compound is also known. In addition, these nucleic acid compounds are not easily decomposed in the living body, have high biostability, and have the property of avoiding an immune response.

Since a nucleic acid compound having such excellent properties has a long chain length of about 50 bases, a simpler method is required in the synthesis method.

International Publication No. 2012/017919

An object of the present invention is to provide a simple method for producing single-stranded RNA.

As a result of diligent research to achieve the above object, the present inventor ligates the first single-strand RNA and the second single-strand RNA using a certain RNA ligase. It has been found that the desired single-stranded RNA having a length of 50 bases or more can be easily produced, and the produced target product can be purified by reverse phase chromatography.

The present invention has been completed by further studying based on these findings, and provides the following method for producing single-stranded RNA.

The present invention includes the following aspects.
[1] (I) EC6 defined by the International Biochemical Union as an enzyme number for the first single-strand RNA having a phosphate group at the 5'end and the second single-strand RNA having a hydroxyl group at the 3'end. A step of ligating the first single-strand RNA and the second single-strand RNA by allowing an RNA ligase classified as 5.1.3 and having double-strand nick repair activity to act, and (II). ) Reverse-phase column chromatography using a mobile phase containing at least one salt selected from the group consisting of monoalkylamine salts and dialkylammonium salts for the reaction product containing the single-strand RNA produced in the ligation step (I). A method for producing positive-strand RNA, which comprises a step of purifying by
a) The first single-stranded RNA is a single-stranded RNA consisting of a Y2a region, an Lz linker region, a Y1a region, an X1a region, a W1a region, an Lw linker region, and a W2a region in this order from the 5'terminal side.
b) The second single-stranded RNA is a single-stranded RNA consisting of the X2a region.
c) The X1a and X2a regions contain at least four equal number of nucleotide sequences complementary to each other.
d) The Y1a and Y2a regions contain at least one equal number of nucleotide sequences complementary to each other.
e) The W1a and W2a regions contain any number of nucleotide sequences.
f) The Lw linker region and the Lz linker region are linker regions having atomic groups derived from amino acids, and
g) The single-strand RNA to be produced is a linked single-stranded RNA consisting of an X2a region, a Y2a region, an Lz linker region, a Y1a region, an X1a region, a W1a region, an Lw linker region, and a W2a region in this order from the 5'terminal side. Characterized by being
Method for producing single-stranded RNA.
[2] The production method according to the preceding item [1], wherein the Lz linker region and the Lw linker region are divalent groups represented by the following formula (I).

(In the formula, Y ₁₁ and Y ₂₁ each independently represent an alkylene group having 1 to 20 carbon atoms, and Y ₁₂ and Y ₂₂ are each independently substituted with a hydrogen atom or an amino group. Either represents a good alkyl group, or Y ₁₂ and Y ₂₂ bond to each other at their ends to represent an alkylene group with 3-4 carbon atoms, and
The terminal oxygen atom bonded to Y ₁₁ is bonded to the phosphorus atom of the phosphate ester of the terminal nucleotide of either the Y1 region or the Y2 region.
The terminal oxygen atom bonded to Y ₂₁ are bonded to the phosphorus atom of the phosphoric acid ester of a terminal nucleotide of the Y1 region and the Y2 region other areas not bound to Y ₁₁ of. )
[3] The Lz linker region is a divalent group represented by the following formula (I), and the Lz linker region is a divalent group represented by the following formula (I'). The production method according to 1] or [2].

(In the formula, Y ₁₁ and Y ₂₁ each independently represent an alkylene group having 1 to 20 carbon atoms, and Y ₁₂ and Y ₂₂ are each independently substituted with a hydrogen atom or an amino group. Either represents a good alkyl group, or Y ₁₂ and Y ₂₂ bond to each other at their ends to represent an alkylene group with 3-4 carbon atoms, and
The terminal oxygen atom bonded to Y ₁₁ is bonded to the phosphorus atom of the phosphate ester of the terminal nucleotide of either the Y1 region or the Y2 region.
The terminal oxygen atom bonded to Y ₂₁ are bonded to the phosphorus atom of the phosphoric acid ester of a terminal nucleotide of the Y2 region and the Y1 region other areas not bound to Y ₁₁ of. )

(Wherein, Y _'11 and Y' ₂₁ each independently represents an alkylene group having 1 to 20 carbon atoms, Y _'12 and Y' ₂₂ are each independently a hydrogen atom or an amino group, or represents optionally substituted alkyl group, or Y 'and ₁₂ and the Y' ₂₂ are bonded to each other at their ends an alkylene group having 3 to 4 carbon atoms,
The terminal oxygen atom bonded to Y _'11 is coupled with the phosphorus atom of the phosphoric acid ester of a terminal nucleotide of one of regions of the Z1 region and the Z2 region and,
Y 'terminal oxygen atoms bonded to _21, wherein Z2 region and the Z1 region of Y' is bonded to the phosphorus atom of the phosphoric acid ester of a terminal nucleotide of the other areas not bound to _11. )
[4] The Lz linker region and the Lw linker region are independently divalent groups having a structure represented by the following formula (II-A) or (II-B), respectively, according to the above item [1] or The manufacturing method according to [2].

(In the equation, n and m each independently represent an integer from 1 to 20.)
[5] Suppresses the expression of a gene targeted by RNA interferometry in at least one of the X1 region, the Y1a region, the X1a region and the W1a region, and the X2a region and the Y2a region. The production method according to any one of the above items [1] to [4], which comprises the nucleotide sequence to be used.
[6] The RNA ligase is T4 RNA ligase 2 derived from T4 bacteriophage, ligase 2 derived from KVP40, Trypanosoma brucei RNA ligase, Deinococcus radiodurans RNA ligase, or Leishmania pre-RNA ligase 1 from Leishmania ligase. The manufacturing method according to any one of the above.
[7] Any of the above items [1] to [6], wherein the RNA ligase is an RNA ligase consisting of an amino acid sequence having 95% or more identity with the amino acid sequence set forth in SEQ ID NO: 5, 6, or 7. The manufacturing method according to paragraph 1.
[8] The production method according to any one of the above items [1] to [7], wherein the RNA ligase is T4 RNA ligase 2 derived from T4 bacteriophage or RNA ligase 2 derived from KVP40.
[9] From the above item [1], wherein the monoalkylamine salt or dialkylamine salt is at least one salt selected from the group consisting of hexylammonium salt, dipropylammonium salt, dibutylammonium salt, and quaternaryammonium salt. The production method according to any one of [8].
[10] The packing material for the reverse phase column chromatography is silica or a polymer in which any one or more of a phenyl group, an alkyl group having 1 to 20 carbon atoms, or a cyanopropyl group is immobilized, according to the above item [1]. The production method according to any one of [9].

According to the method of the present invention, a simple method for producing single-stranded RNA is provided.

It is a figure which shows the arrangement used in Example 1. FIG. It is a figure which shows the ligation single-strand RNA synthesized in Example 1. It is a figure which shows RNA strands I, II and III.

Hereinafter, the present invention will be described in detail.

In addition, in this specification, "comprise" also includes the meaning of "essentially consist of" and the meaning of "consist of".

Unless otherwise specified, the "gene" in the present invention includes double-stranded DNA, single-stranded DNA (sense strand or antisense strand), and fragments thereof. Further, in the present invention, the term "gene" shall be used without distinguishing between a regulatory region, a coding region, an exon, and an intron unless otherwise specified.

In the present specification, the numerical range of the number of nucleotides discloses, for example, all positive integers belonging to the range, and as a specific example, the description of "1 to 4 nucleotides" is "1 nucleotide", " Means all disclosures of "2 nucleotides", "3 nucleotides", and "4 nucleotides". Further, the description of "1 to 4 bases" means all disclosures of "1 base", "2 bases", "3 bases", and "4 bases". As used herein, the terms "number of nucleotides" and "number of bases" represent the length of a nucleotide sequence in a mutually compatible manner.

(I) EC6.5, which is defined by the International Biochemical Union as an enzyme number for the first single-strand RNA having a phosphate group at the 5'end and the second single-strand RNA having a hydroxyl group at the 3'end. A step of ligating the first single-strand RNA and the second single-strand RNA by allowing RNA ligase classified into 1.3 and having double-strand nick repair activity to act will be described.

The linked single-stranded RNA contains a nucleotide sequence that suppresses gene expression in at least one of an A region consisting of a Y1a region, an X1a region, and a W1a region, and a B region consisting of an X2a region and a Y2a region. You may. As such a nucleotide sequence, a sequence that suppresses the expression of the target gene by the RNA interference method may be included.

RNA interference (RNAi) is the introduction of double-stranded RNA consisting of a sense RNA consisting of a sequence identical to at least a part of the mRNA sequence of a target gene and an antisense RNA consisting of a sequence complementary thereto into cells. This is a phenomenon in which the mRNA of the target gene is decomposed, and as a result, the translation inhibition into a protein is induced and the expression of the target gene is inhibited. The details of the mechanism of RNA interference are still unclear, but an enzyme called DICE (a type of RNase III nucleolytic enzyme family) comes into contact with double-stranded RNA, and the double-stranded RNA becomes a small fragment called siRNA. It is believed that the main mechanism is disassembly.

The target gene is not particularly limited, and a desired gene can be appropriately selected. The nucleotide sequence that suppresses the expression of the target gene is not particularly limited as long as it is a sequence that can suppress the gene expression, and is based on the sequence information of the target gene registered in a known database (for example, GenBank) or the like. It is possible to design by a conventional method. The nucleotide sequence is 80% or 85% or more, preferably 90% or more, more preferably 95% or more, still more preferably 98% or more, and most preferably 100% with respect to a predetermined region of the target gene. Have the sameness.

As the nucleotide sequence that suppresses the expression of the target gene by RNA interference, for example, a sense RNA having the same sequence as at least a part of the mRNA sequence of the target gene can be used. The number of bases in the nucleotide sequence that suppresses the expression of the target gene by RNA interference is not particularly limited, and is, for example, 19 to 30 bases, preferably 19 to 21 bases.

Either one or both of the A region and the B region may have two or more of the same expression-suppressing sequences for the same target gene, or may have two or more different expression-suppressing sequences for the same target. Alternatively, it may have two or more different expression-suppressing sequences for different target genes. When the A region has two or more expression-suppressing sequences, the location of each expression-suppressing sequence is not particularly limited, and may be any one or both of the X1a region and the Y1a region, or a region spanning both. There may be. When the B region has two or more expression-suppressing sequences, the location of each expression-suppressing sequence may be any one or both of the X2a region and the Y2a region, or may be a region spanning both. The expression-suppressing sequence preferably has 90% or more complementarity with respect to a predetermined region of the target gene, more preferably 95%, further preferably 98%, and particularly preferably 100%. Is.

In such a linked single-strand RNA, a ligase is allowed to act on a first single-strand RNA having a phosphate group at the 5'end and a second single-strand RNA having a hydroxyl group at the 3'end, and the first single-strand RNA is described. It is produced in the step of connecting the single-strand RNA and the second single-strand RNA (see FIG. 2).

In a linked single-stranded RNA, complementary sequence portions are arranged in the molecule, and a double strand can be partially formed in the molecule. As shown in FIG. 2, the linked single-stranded RNA molecule contains a nucleotide sequence in which the X1a region and the X2a region have complementarity with each other, and further contains a nucleotide sequence in which the Y1a region and the Y2a region have complementarity with each other. A double chain is formed between the sequences having complementarity, and the linker regions of Lw and Lz form a loop structure depending on their length. FIG. 2 shows the connection order of the regions and the positional relationship of each region forming the double chain portion. For example, the length of each region, the shape of the linker region (Lw and Lz), and the like are shown. Not limited to these.

At least one of the A region consisting of the Y1a region, the X1a region and the W1a region, and the B region consisting of the X2a region and the Y2a region may contain at least one sequence that suppresses the expression of the target gene by RNA interference. .. In the linked single-stranded RNA, the A region and the B region may be completely complementary, or one or several nucleotides may be non-complementary, but it is preferable that they are completely complementary. The one or several nucleotides are, for example, 1 to 3 nucleotides, preferably 1 or 2 nucleotides. The Y1a region has a nucleotide sequence complementary to the entire region of the Y2a region. The Y1a region and the Y2a region are nucleotide sequences that are completely complementary to each other, and are nucleotide sequences consisting of one or more of the same number of nucleotides. The X1a region has a nucleotide sequence complementary to the entire region of the X2a region. The X1a region and the X2a region are nucleotide sequences that are completely complementary to each other, and are nucleotide sequences consisting of two or more equal numbers of nucleotides. In the production method of the present embodiment, the W1a region and the W2a region are regions containing an arbitrary number of nucleotide sequences, are not essential sequences, and may have an embodiment in which the number of nucleotides is 0. The embodiment may include nucleotides.

The length of each area is illustrated below, but it is not limited to this.

In the linked single-stranded RNA molecule, the relationship between the number of nucleotides in the W2a region (W2an), the number of nucleotides in the X2a region (X2an), and the number of nucleotides in the Y2a region (Y2an) is, for example, the condition of the following formula (1). Fulfill. The relationship between the number of nucleotides in the W1a region (W1an), the number of nucleotides in the X1a region (X1an), and the number of nucleotides in the Y1a region (Y1an) satisfies, for example, the condition of the following formula (2).
W2an ≤ X2an + Y2an ... (1)
W1an ≤ X1an + Y1an ... (2)

In the linked single-stranded RNA molecule, the relationship between the number of nucleotides in the X1 region (X1an) and the number of nucleotides in the Y1a region (Y1an) is not particularly limited, and for example, any of the following conditions is satisfied.
X1an = Y1an ... (3)
X1an <Y1an ... (4)
X1an> Y1an ... (5)

In the method of the present embodiment, the number of nucleotides in the X1a region (X1an) and the number of nucleotides in the X2a region (X2an) are 2 or more, preferably 4 or more, and more preferably 10 or more.
The number of nucleotides in the Y1a region (Y1an) and the number of nucleotides in the Y2a region (Y2an) are one or more, preferably two or more, and more preferably four or more.

The W1a region preferably contains a nucleotide sequence complementary to the entire region of the W2a region or a partial region of the W2a region. The W1a region and the W2a region may have one or several nucleotides that are non-complementary, but are preferably completely complementary.

More specifically, the W2a region preferably consists of a nucleotide sequence that is one or more nucleotides shorter than the W1a region. In this case, the entire nucleotide sequence of the W2a region is complementary to all the nucleotides of any subregion of the W1a region. It is more preferable that the nucleotide sequence from the 5'end to the 3'end of the W2a region is a sequence complementary to the nucleotide sequence starting from the nucleotide at the 3'end of the W1a region and toward the 5'end.

In the linked single-stranded RNA molecule, the relationship between the number of nucleotides in the X1a region (X1an) and the number of bases in the X2a region (X2an), the relationship between the number of nucleotides in the Y1a region (Y1an) and the number of nucleotides in the Y2a region (Y2an), The relationship between the number of nucleotides in the W1a region (W1an) and the number of nucleotides in the W2a region (W2an) satisfies the conditions of the following formulas (6), (7) and (8), respectively.
X1an = X2an ... (6)
Y1an = Y2an ... (7)
W1an ≧ W2an ・・・ (8)

In the linked single-stranded RNA, the total number of nucleotides excluding the linker region (Lw, Lz) has a lower limit of typically 38, preferably 42, more preferably 50, and even more preferably 50. It is 51, particularly preferably 52, and the upper limit is typically 300, preferably 200, more preferably 150, even more preferably 100, and particularly preferably 80.

In the linked single-stranded RNA, the lengths of the linker regions of Lw and Lz are not particularly limited. It is preferable that these linker regions have, for example, a length in which the X1a region and the X2a region can form a duplex, or a length in which the Y1a region and the Y2a region can form a duplex. Each linker region of Lw and Lz is a region having an atomic group derived from an amino acid. These linker regions (Lw, Lz) are usually non-nucleotide linker regions.

The upper limit of the number of atoms forming the main chain of the linker region is typically 100, preferably 80, and more preferably 50.

The Lw linker region is, for example, a divalent group represented by the above formula (I), and the Lz linker is, for example, a divalent group represented by the above formula (I').

The single-stranded RNA produced by the production method according to this embodiment may consist of only ribonucleotides, may contain deoxynucleotides, non-nucleotides, and the like, and may be contained in ribonucleotides. It may contain a phosphorothioester bond in which the oxygen atom of the phosphorodiester bond is partially replaced with a sulfur atom. The single-stranded RNA produced by the production method according to this embodiment is preferably composed of only ribonucleotides.

The Lz linker region and the Lw linker region are each independently a linker region having an atomic group derived from an amino acid, and the amino acid here may be either a natural amino acid or an artificial amino acid, and may be a substituent or a substituent. It may have a protecting group.

Examples of the Lz linker region include a divalent group represented by the following formula (I).

(In the formula, Y ₁₁ and Y ₂₁ each independently represent an alkylene group having 1 to 20 carbon atoms, and Y ₁₂ and Y ₂₂ are each independently substituted with a hydrogen atom or an amino group. Either represents a good alkyl group, or Y ₁₂ and Y ₂₂ bond to each other at their ends to represent an alkylene group with 3-4 carbon atoms.
The terminal oxygen atom bonded to Y ₁₁ are bonded to the phosphorus atom of the phosphoric acid ester of one of the terminal nucleotide of Z1 region and Z2 region and,
The terminal oxygen atom bonded to Y ₂₁ is bonded to the phosphorus atom of the phosphate ester of the other terminal nucleotide that is not bonded to Y _{11 in the} Z2 region and the Z1 region. )

Further, as the Lw linker region, a divalent group represented by the following formula (I') can be mentioned.

(Wherein, Y _'11 and Y' ₂₁ each independently represents an alkylene group having 1 to 20 carbon atoms, Y _'12 and Y' ₂₂ are each independently a hydrogen atom, or an amino group or represents optionally substituted alkyl group, or Y 'and ₁₂ and the Y' ₂₂ are bonded to each other at their ends an alkylene group having 3 to 4 carbon atoms,
The terminal oxygen atom bonded to Y _'11 linker Lw region is linked with the phosphorus atom of the phosphoric acid ester of one of the terminal nucleotide of the W1 region and W2 regions, and,
Y 'terminal oxygen atoms bonded to _21, Y of W2 region and W1 region' joins the phosphorus atom of the phosphoric acid ester of the other terminal nucleotide not bound to _11. )

The alkylene group having 1 to 20 carbon atoms may be either linear or branched, and is preferably an alkylene group having 4 to 6 carbon atoms. Examples of the alkylene group include a methylene group, an ethylene group, an n-propylene group, an isopropylene group, an n-butylene group, an isobutylene group, a tert-butylene group, an n-pentylene group, an isopentylene group, a hexylene group and the like. Be done.

The alkyl group in the alkyl group which may be substituted with the amino group may be either linear or branched, preferably an alkyl group having 1 to 10 carbon atoms, and more preferably an alkyl group having 1 to 5 carbon atoms. It is a group. Examples of the alkyl group include a methyl group, an ethyl group, an n-provyl group, an isopropyl group, an n-butyl group, an isobutyl group, a tert-butyl group, an n-pentyl group, an isopentyl group, a hexyl group and the like. .. Examples of the alkyl group that may be substituted with the amino group include those in which a part of the hydrogen atom of the above-exemplified alkyl group is substituted with an amino group.

The number of amino groups that the alkyl group that may be substituted with the amino group can have is not particularly limited, and is preferably 1. Further, the substitution position of the amino group in the alkyl group which may be substituted with the amino group is not particularly limited, and may be any position. Examples of the alkyl group substituted with the amino group include a 4-aminobutyl group.

As a preferable specific example of the divalent group represented by any of the above formulas (I) and (I'), the divalent group represented by the following formula (II-A) or (II-B) is used. Can be mentioned.

(In the formula, n and m each independently represent an integer of 1 to 20.)

N and m are independent and preferably integers of 4 to 6, and n and m may be the same or different.

FIG. 1 shows an example of the first and second single-strand RNAs used in the production method according to this embodiment. FIG. 1 shows a state in which the first and second single-strand RNAs are arranged in a straight line. The schematic diagram at the bottom of FIG. 2 shows a state in which it is bound with ligase to form a single-stranded RNA.

In the sequences shown herein and in the drawings, the abbreviation "p" indicates that the hydroxyl group at the 5'end is modified with a phosphate group. Further, the abbreviation of "P" in the sequence is a structure introduced by using amidite represented by the following structural formula (III-A).

The method for producing the first and second single-stranded RNA used in the production method according to this embodiment is not particularly limited, and a known solid-phase synthesis method, liquid phase synthesis method, or the like, a known nucleic acid synthesizer, or the like is used. Can be chemically synthesized. Examples of such a synthetic method include a phosphoramidite method, an H-phosphonate method, and the method described in International Publication No. 2013/027843.

For phosphorylation of the 5'position of single-stranded RNA, amidite for phosphorylation at the 5'end may be used in solid-phase synthesis. Commercially available amidite can be used as the 5'phosphoramidite. Further, in solid-phase synthesis, an RNA molecule having a hydroxyl group at the 5'end is synthesized, deprotected, and then phosphorylated with a commercially available phosphorylating agent to form a phosphate group at the 5'end. Single-stranded RNA having can be prepared. As the phosphorylating agent, for example, a commercially available Chemical Phosphorylation Reagent (Glen Research) represented by the following structural formula (III-a) is known (European Patent Application Publication No. 0816368).

Further, the linker regions of Lz and Lw can be similarly prepared by a nucleic acid synthesizer using amidite as shown below. As the amidite in the linker region, for example, an amidite having a proline skeleton represented by the following structural formula (III-b) can be prepared by the method described in Example A4 of International Publication No. 2012/017919, and the following structural formula (III-b) The following amidites represented by each of III-c), (III-d) and (III-e) can be prepared by the method described in Examples A1 to A3 of International Publication No. 2013/103146. ..

The bases that make up nucleotides are usually natural bases that make up nucleic acids, typically RNA, but unnatural bases may be used in some cases. Examples of such non-natural bases include modified analogs of natural or non-natural bases.

Examples of bases include purine bases such as adenine and guanine, pyrimidine bases such as cytosine, uracil and thymine. Examples of the base include inosine, xanthine, hypoxanthine, nubularine, isoganicine, and tubericine. The base is, for example, an alkyl derivative such as 2-aminoadenine, 6-methylated purine; an alkyl derivative such as 2-propylated purine; 5-halouracil and 5-halocitosine; 5-propynyl uracil and 5-propynylcitosine; -Azouracil, 6-azocitosine and 6-azotimine; 5-uracil (psoid uracil), 4-thiouracil, 5-halouracil, 5- (2-aminopropyl) uracil, 5-aminoallyl uracil; 8-aminoallylated, amination, Thiolization, thioalkylation, hydroxylation and other 8-substituted purines; 5-trifluoromethylation and other 5-substituted pyrimidines; 7-methylguanine; 5-substituted pyrimidines; 6-azapyrimidine; N-2, N -6 and O-6 substituted purines (including 2-aminopropyl uracil); 5-propynyl uracil and 5-propynyl uracil; dihydrouracil; 3-deaza-5-azacitocin; 2-aminopurine; 5-alkyl uracil; 7-alkylguanine; 5-alkylcytocin; 7-deazaadenine; N6, N6-dimethyladenine; 2,6-diaminopurine; 5-amino-allyl-uracil; N3-methyluracil; substituted 1,2,4-triazole; 2-pyridinone; 5-nitroindole; 3-nitropyrrole; 5-methoxyuracil; uracil-5-oxyacil; 5-methoxycarbonylmethyluracil; 5-methyl-2-thiouracil; 5-methoxycarbonylmethyl-2-thiouracil 5-Methylaminomethyl-2-thiouracil; 3- (3-amino-3-carboxypropyl) uracil; 3-methylcytosine; 5-methylcitosine; N4-acetylcitosine; 2-thiocitosine; N6-methyladenine; N6 -Isopentyladenine; 2-methylthio-N6-isopentenyladenin; N-methylguanine; O-alkylated base and the like. For purine bases and pyrimidine bases, for example, US Pat. No. 3,687,808, "Chemistry Encyclopedia Of Polymer Science And Angewandte Chemiering", pp. 858-859, edited by Kroschwitz J.I. John Wiley & Sons, 1990, and English et al. (English et al.), Angewandte Chemie, International Edition, 1991, 30, p. Includes those disclosed in 613.

Next, the reaction product containing the single-stranded RNA produced in the ligation step (I) is subjected to a reverse phase column using a mobile phase containing at least one salt selected from the group consisting of monoalkylamine salts and dialkylammonium salts. The step of purifying by chromatography will be described.

RNA ligase is classified into EC6.5.1.3, which is defined as an enzyme number by the International Union of Biochemistry and Molecular Biology, and has nick repair activity. The RNA ligase is an enzyme that catalyzes the reaction of ATP + (ribonucleotide) _n -3'-hydroxyl + 5'-phospho- (ribonucleotide) _m <=> (ribonucleotide) _{n + m} + AMP + diphosphate. It has the activity of repairing nicks in double-stranded nucleic acids. However, n and m represent the number of arbitrary nucleotides and are represented by one or more integers.

Examples of such RNA ligase include T4 RNA ligase 2 derived from T4 bacteriophage. This RNA ligase 2 can be purchased from, for example, New England BioLabs. Further, as the RNA ligase, ligase 2 derived from vibriopage KVP40, Trypanosoma brucei RNA ligase, Deinococcus radiodurans RNA ligase, or Leishmania ligase RNA is exemplified. Such RNA ligase is obtained by, for example, extracting and purifying from each organism by the method described in the non-patent literature (Structure and Mechanism of RNA Ligase, Structure, Vol.12, PP.327-339.). It can also be used.

As the T4 RNA ligase 2 derived from T4 bacteriophage, a protein consisting of an amino acid sequence having 95% or more identity with the amino acid sequence shown in SEQ ID NO: 5 and having double-stranded nick repair activity is also used. It is possible. Such RNA ligase 2 includes not only the enzyme of the amino acid sequence shown in SEQ ID NO: 5, but also its variants T39A, F65A, F66A (RNA ligase structures reveal the basis for RNA specificity and conformative changes that drive ligation forward, Cell. (See Vol.127, pp.71-84.), Etc.) can be exemplified. Such RNA ligase 2 can be obtained, for example, by a method using Escherichia coli bacteriophage T4 deposited in ATCC (American Type Culture Collection) as ATCC (registered trademark) 11303 or a method such as PCR based on the description in the above-mentioned document. Is possible.

RNA ligase 2 derived from KVP40 can be obtained by the method described in the non-patent document (characterization of bacteriophage KVP40 and T4 RNA ligase 2, Virology, vol. 319, PP. 141-151.). Specifically, for example, it can be obtained by the following method. That is, among the DNA extracted from bacteriophage KVP40 (for example, deposited with JGI as deposit number Go008199), the open reading frame 293 is digested with restriction enzymes by NdeI and BamHI, and then amplified by a polymerase chain reaction. The obtained DNA is incorporated into the plasmid vector pET16b (Novagen). Alternatively, the DNA sequence can be artificially synthesized by PCR. Here, a desired mutant can be obtained by DNA sequence analysis. Subsequently, the obtained vector DNA was subjected to E.I. Incorporate into E. coli BL21 (DE3) and incubate in LB medium containing 0.1 mg / mL ampicillin. Add isopropyl-β-thiogalactoside to 0.5 mM and incubate at 37 ° C. for 3 hours. All subsequent operations are preferably performed at 4 ° C. First, the cells are precipitated by centrifugation, and the precipitate is stored at −80 ° C. Buffer A [50 mM Tris-HCl (pH 7.5), 0.2 M NaCl, 10% sucrose] is added to the frozen cells. Then, lysozyme and Triton X-100 are added, and the cells are crushed by ultrasonic waves to elute the target substance. Then, the target product is isolated by using affinity chromatography, size exclusion chromatography, or the like. Then, the obtained aqueous solution can be used as a ligase by centrifugally filtering and replacing the eluate with a buffer.
In this way, RNA ligase 2 derived from KVP40 can be obtained. As the RNA ligase 2 derived from KVP40, an RNA ligase having a double-stranded nick repair activity, which is a protein consisting of an amino acid sequence having 95% or more identity with the amino acid sequence of SEQ ID NO: 6, can be used.

Deinococcus radiodurans RNA ligase can be obtained by the method described in the non-patent document (An RNA Ligase from Deinococcus radiodulans, J Biol Chem., Vol. 279, No. 49, PP. 50654-61.). For example, it is also possible to obtain the ligase from a biological material deposited with the ATCC as ATCC® BAA-816. As the Deinococcus radiodurans RNA ligase, a protein consisting of an amino acid sequence having 95% or more identity with the amino acid sequence of SEQ ID NO: 7 and having double-stranded nick repair activity can be used. Specific examples of such a ligase include an RNA ligase having an amino acid sequence of SEQ ID NO: 7 and an RNA ligase having a mutation of K165A or E278A in the RNA ligase of SEQ ID NO: 7 (ex). An RNA Ligase from Deinococcus radiodurans, J Biol Chem., Vol. 279, No. 49, PP. 50654-61.).

Trypanosoma brucei RNA ligase can be obtained in the non-patent document (Assiciation of Two Novel Proteins TbMP52 and TbMP48 with the Trypanosoma brucei RNA Editing Complex, Vol.21, No.2, PP.380-389.) ..

Leishmania tarentolae RNA ligase can be described in the non-patent document (The Mitochondrial RNA Ligase from Leishmania tarentolae Can Join RNA Molecule Bridged by a Complementary RNA, Vol. 274, No. 34, PP. 24289-24296). ..

Among them, as the RNA ligase, T4 RNA ligase 2 derived from T4 bacteriophage is preferable.

In the production method according to this embodiment, the reaction conditions for allowing the RNA ligase to act on the first and second single-stranded RNAs are particularly limited as long as the RNA ligase functions and the desired single-stranded RNA can be produced. It can be set as appropriate.

The amount of RNA ligase used can be appropriately set according to the amount of the first and second single-stranded RNA to be linked, the reaction temperature and the reaction time. The reaction time of the RNA ligase is selected, for example, from the range of 0.5 to 144 hours. The pH of the RNA ligase treatment can be appropriately set according to the optimum pH of the enzyme used, and is selected from, for example, the range of pH 4 to 9. The temperature of the RNA ligase treatment can be appropriately set according to the optimum temperature of the enzyme used, and is selected from, for example, the range of 0 to 50 ° C.
In addition to these, the reaction solution in which RNA ligase is allowed to act on the first and second single-stranded RNA may contain a buffer solution, a metal salt, ATP and the like. Examples of the buffer solution include Tris-hydrochloric acid buffer solution, ATP buffer solution, potassium phosphate buffer solution, glycine-hydrochloric acid buffer solution, acetate buffer solution, citrate buffer solution and the like. Examples of the metal salt include magnesium salt, potassium salt, calcium salt, sodium salt and the like.

A crude product containing single-stranded RNA produced by the action of RNA ligase can usually be isolated by using a method of precipitating, extracting and purifying RNA. Specifically, a method of precipitating RNA by adding a solvent having low solubility in RNA such as ethanol and isopropyl alcohol to the solution after the reaction, or phenol / chloroform / isoamyl alcohol (for example, phenol / chloroform / isoamyl). A method is adopted in which a solution of alcohol = 25/24/1) is added to the reaction solution to extract RNA into an aqueous layer. Then, it can be isolated and purified by a known high performance liquid chromatography (HPLC) method such as reverse phase column chromatography, anion exchange column chromatography, affinity column chromatography and the like.

In the step of purifying the produced single-stranded RNA by reverse phase column chromatography, a mobile phase containing at least one ammonium salt selected from the group consisting of monoalkylammonium salts and dialkylammonary salts is used. Examples of such ammonium salts are typically ammonium salts composed of organic or inorganic acids and monoalkylamines or dialkylamines.

In reverse phase column chromatography, the mobile phase (eluent) is a non-hydrophobic mobile phase, and specific examples thereof include those containing an ammonium salt as described above. Examples of such mobile phases include solvents containing C1-C3 alcohols (eg, methanol, ethanol, isopropanol or n-propanol), nitriles (eg, acetonitrile) and, in some cases, water. Examples of the acid forming the ammonium salt include carbonic acid, acetic acid, formic acid, trifluoroacetic acid and propionic acid. Such mobile phases typically exemplify eluents consisting of monoalkylamines or dialkylamines / acetic acid / water / acetonitrile.

Examples of the concentration of the ammonium salt include those of 1-200 mM, 5-150 mM or 20-100 mM. Examples of the pH range of the mobile phase include a pH range of 6-8 or 6.5-7.5.

The mobile phase may contain a triethylammonium salt or the like other than the ammonium salt, but the ratio of at least one ammonium salt selected from the group consisting of monoalkylammonium salt and dialkylammonium salt is based on the total ammonium salt. For example, 30 mol% or more, 40 mol% or more, 50 mol% or more, 60 mol% or more, 70 mol% or more, 80 mol% or more, 90 mol% or more, or at least one ammonium salt selected from the group consisting of monoalkylammonium salts and dialkylammonium salts. Consists of only. Specific examples of the at least one ammonium salt selected include, for example, at least one ammonium salt selected from the group consisting of hexyl ammonium salt, dipropyl ammonium salt, dibutyl ammonium salt, and quaternary ammonium salt. , It is preferable to use an ammonium salt selected from these.

As the packing material for the reverse phase column chromatography, for example, silica having one or more of a phenyl group, an alkyl group having 1 to 20 carbon atoms, or a cyanopropyl group fixed as a hydrophobic stationary phase or Polymers are exemplified. Examples of the silica or polymer as such a filler include those having a particle size of 2 μm or more, or 5 μm or more.

For separation by reverse phase column chromatography, a mobile phase containing the ammonium salt is passed through a column containing the packing material, and then a solution in which a single-stranded RNA ligated by rigase is dissolved in the mobile phase is passed. Then, the impurities contained in the RNA (unreacted first and / or second) are subjected to a gradient (gradient) in which the RNA is bound to the column and then the concentration of the organic solvent in the mobile phase through which the solution is passed is gradually increased. It is carried out by separating and eluting the target RNA molecule (such as the RNA strand of).

The temperature of the reverse phase column chromatography is, for example, 20-100 ° C, 25-80 ° C, or 30-60 ° C.

The fractions obtained by reverse phase column chromatography were analyzed for composition by UV absorption at a wavelength of 260 nm under the same chromatographic conditions as the separation conditions, and the selected fractions were collected and purified. You get things.

Among the single-stranded RNA produced by the method of the present invention, those capable of suppressing the expression of the target gene can be used as a therapeutic or prophylactic agent for diseases caused by the gene.

The case of chemically synthesizing a single-stranded RNA having a length of about 20 bases is superior in terms of yield and yield as compared with the case of chemically synthesizing a single-stranded RNA having a length of about 50 bases or more. Therefore, rather than chemically synthesizing a single-stranded RNA having a length of about 50 bases or more, a high yield and yield can be obtained by chemically synthesizing a single-stranded RNA having a length of about 20 bases, ligating and ligating them. In addition, the unligated RNA strand is excellent in quality because it can be easily removed by purification.

Therefore, according to the production method of the present invention, it is possible to produce a single-stranded RNA having a length of about 50 bases or more with high yield, yield and quality. In addition, by including a nucleotide sequence that suppresses the expression of the target gene by RNA interference, as a result, single-stranded RNA that can be used in the RNA interference method can be efficiently produced, and cost reduction is expected.

Hereinafter, examples will be given to explain the present invention in more detail. However, the present invention is not limited to these examples and the like.

[Example 1]
1. 1. Synthesis of First Single-Strand RNA The single-strand RNA shown below (strand I in FIG. 3) was synthesized. The strand consists of 31 bases in length and corresponds to the first single-strand RNA.

Chain I: pCCPGGUAUAUGCUGUGUGUACUCUGCUUCPG (5'-3') (SEQ ID NO: 1)
The description of SEQ ID NO: 1 in the sequence listing indicates the base sequence from the 4th base after the 3rd "P" from the 5'end to the 29th base before the 30th "P".
The single-strand RNA was synthesized from the 3'side to the 5'side using a nucleic acid synthesizer (trade name NTS M-4MX-E, Nippon Techno Service Co., Ltd.) based on the phosphoramidite method.

For the synthesis, as RNA amidite, uridine EMM amidite described in Example 2 of International Publication No. 2013/027843, citidine EMM amidite described in Example 3, adenosine EMM amidite described in Example 4, and Example. Using the guanosine EMM amidite described in 5, Chemical Phosphoramidite Reagent (Glen Research) was used for 5'phosphorylation, porous glass was used as the solid phase carrier, and trichloroacetic acid toluene solution was used as the deblocking solution. , 5-benzylthio-1H-tetrazole was used as a condensing agent, an iodine solution was used as an oxidizing agent, and an anhydrous phenoxyacetic acid solution and an N-methylimidazole solution were used as capping solutions.

Cutting and deprotection from the solid phase carrier after solid phase synthesis followed the method described in International Publication No. 2013/027843. That is, an aqueous ammonia solution and ethanol were added, and after allowing to stand for a while, the solid phase carrier was filtered and the solvent was distilled off. Then, the hydroxyl group was deprotected with tetrabutylammonium fluoride. The obtained RNA was lysed with distilled water for injection to a desired concentration.

2. 2. Synthesis of Second Single-Strand RNA The single-strand RNA shown below (chain II in FIG. 3) was synthesized. The strand consists of 22 bases in length and corresponds to the second single-strand RNA.

Chain II: AGCAGAGUACACACAGCAUAUA (5'-3') (SEQ ID NO: 2)
The single-stranded RNA was synthesized by the same method as described above.

The linked single-stranded RNA obtained by ligating the first and second RNAs is shown below.
Chain III:
AGCAGAGUACACACAGCAUAUACCPGGUAUAUGCUGUGUGUACUCUGCUUCPG (5'-3') (SEQ ID NOs: 3 and 4)
In the above sequence, the base sequence from the 5'-terminal base to the 22nd base corresponds to the sequence of SEQ ID NO: 2, and the base sequence from the 23rd base to the 3'-terminal base corresponds to the above-mentioned SEQ ID NO: 1. Corresponds to the array of. In addition, the description of SEQ ID NO: 3 in the sequence listing indicates the base sequence from the 5'-terminal base to before the 25th "P", and the description of SEQ ID NO: 4 is from the 26th base to the 52nd base. The base sequence before "P" of is shown.

3. 3. Ligation Next, in a 50 mL conical tube, 25.3 mL of Otsuka distilled water (Otsuka Pharmaceutical Co., Ltd.), 3.2 mL of 500 mM Tris-Actate (pH 7.0), 86.4 μL of RNA of 0.82 mM chain IV, 1. 56.0 μL of 15 mM strand V RNA was added and allowed to stand in a water bath warmed to 65 ° C. for 10 minutes, and then cooled at room temperature. Then, the composition was 1250 units T4 RNA ligase 2 (New England Biolabs), 20 mM MgCl ₂ 10 mM DTT 4 mM ATP mixed solution 3.2 mL, and the reaction scale was 32 mL. Then, the mixture was incubated at 37 ° C. for 1 hour, 1 mL of a 0.2 M aqueous ethylenediaminetetraacetic acid solution was added to the reaction solution, and the mixture was allowed to stand in a water bath at 65 ° C. for 10 minutes to stop the reaction.

When a part was taken out from the reaction solution and analyzed by HPLC, the purity of the target product in the crude product was 57.5%, and the residual ratios of chain I and chain II were 3.0% and 15.0%, respectively. It was. In addition, the area value of the target object was calculated as the purity with respect to the total area value of the obtained chromatogram detected by the UV spectrum having a wavelength of 260 nm in HPLC, and the area value of the raw material with respect to the total area value was calculated as the residual ratio.

Subsequently, 16 mL of the reaction solution was taken out, filtered using Milex-GP (Merck & Co., Inc.), and washed with 1 mL of 100 mM hexyl ammonium acetate (pH 7.0).

4. Purification Purification was performed by column chromatography under the conditions shown in Table 1. However, before purification, the sample was added after passing the solution through the column at a ratio of mobile phase A / mobile phase B = 65/35 at a flow rate of 1.0 mL / min for 10 minutes. Each of the obtained fractions was analyzed by HPLC. As a result, the purity of the target product was 88.4%, and the residual ratios of chain I and chain II were 1.0% and 4.0%, respectively. The purity and the residual ratio were calculated in the same manner as in the method described in Example 1. Table 2 shows the results of measuring the obtained sample by mass spectrometric measurement. Since it matches the calculated value, it was confirmed that the desired product was obtained (hereinafter, abbreviated as HAA purification).

[Comparative Example 1]
16 mL was taken out from the reaction solution obtained in Example 1 above, filtered using Milex-GP (manufactured by Merck & Co., Inc.), and washed with 1 mL of 100 mM triethylammonium acetate (pH 7.0). Column chromatography purification was performed under the conditions shown in Table 3. However, before purification, the sample was added after passing the solution through the column at a ratio of mobile phase A / mobile phase B = 95/5 at a flow rate of 1.0 mL / min for 10 minutes. As a result, the purity of the target product was 58.6%, and that of chain I and chain II was 3.1% and 15.5%, respectively. As a result of measuring the obtained sample by mass spectrometric measurement, it was confirmed that the target product was obtained because it matched the calculated value. The results of mass spectrometric measurement of the obtained sample are shown in Table 4 (hereinafter, abbreviated as TEAA purification).

The results of Comparative Example 1 and Example 1 are summarized in Table 4.

According to the production method of the present invention, single-stranded RNA can be easily produced.

SEQ ID NOs: 1 to 4 indicate the base sequence of RNA.
SEQ ID NOs: 5 to 7 represent amino acid sequences.

Claims

(I) EC6.5. The international biochemical association defines the first single-strand RNA having a phosphate group at the 5'end and the second single-strand RNA having a hydroxyl group at the 3'end as enzyme numbers. A step of ligating the first single-strand RNA and the second single-strand RNA by allowing an RNA ligase having a double-strand nick repair activity, which is classified into 1.3, and (II) (I). ), The reaction product containing the single-strand RNA produced in the linking step is purified by reverse phase column chromatography using a mobile phase containing at least one salt selected from the group consisting of a monoalkylamine salt and a dialkylammonium salt. A method for producing single-strand RNA, which comprises a step.
a) The first single-stranded RNA is a single-stranded RNA consisting of a Y2a region, an Lz linker region, a Y1a region, an X1a region, a W1a region, an Lw linker region, and a W2a region in this order from the 5'terminal side.
b) The second single-stranded RNA is a single-stranded RNA consisting of the X2a region.
c) The X1a and X2a regions contain at least four equal number of nucleotide sequences complementary to each other.
d) The Y1a and Y2a regions contain at least one equal number of nucleotide sequences complementary to each other.
e) The W1a and W2a regions contain any number of nucleotide sequences.
f) The Lw linker region and the Lz linker region are linker regions having atomic groups derived from amino acids, and
g) The single-strand RNA to be produced is a linked single-stranded RNA consisting of an X2a region, a Y2a region, an Lz linker region, a Y1a region, an X1a region, a W1a region, an Lw linker region, and a W2a region in this order from the 5'terminal side. Characterized by being
Method for producing single-stranded RNA.
The production method according to claim 1, wherein the Lz linker region and the Lw linker region are divalent groups represented by the following formula (I).

(In the formula, Y 11 and Y 21 each independently represent an alkylene group having 1 to 20 carbon atoms, and Y 12 and Y 22 are each independently substituted with a hydrogen atom or an amino group. Either represents a good alkyl group, or Y 12 and Y 22 bond to each other at their ends to represent an alkylene group with 3-4 carbon atoms, and
The terminal oxygen atom bonded to Y 11 is bonded to the phosphorus atom of the phosphate ester of the terminal nucleotide of either the Y1 region or the Y2 region.
The terminal oxygen atom bonded to Y 21 are bonded to the phosphorus atom of the phosphoric acid ester of a terminal nucleotide of the Y1 region and the Y2 region other areas not bound to Y 11 of. )
Claim 1 or 2 in which the Lz linker region is a divalent group represented by the following formula (I) and the Lz linker region is a divalent group represented by the following formula (I'). The manufacturing method described in.

(In the formula, Y 11 and Y 21 each independently represent an alkylene group having 1 to 20 carbon atoms, and Y 12 and Y 22 are each independently substituted with a hydrogen atom or an amino group. Either represents a good alkyl group, or Y 12 and Y 22 bond to each other at their ends to represent an alkylene group with 3-4 carbon atoms, and
The terminal oxygen atom bonded to Y 11 is bonded to the phosphorus atom of the phosphate ester of the terminal nucleotide of either the Y1 region or the Y2 region.
The terminal oxygen atom bonded to Y 21 are bonded to the phosphorus atom of the phosphoric acid ester of a terminal nucleotide of the Y2 region and the Y1 region other areas not bound to Y 11 of. )

(Wherein, Y '11 and Y' 21 each independently represents an alkylene group having 1 to 20 carbon atoms, Y '12 and Y' 22 are each independently a hydrogen atom or an amino group, or represents optionally substituted alkyl group, or Y 'and 12 and the Y' 22 are bonded to each other at their ends an alkylene group having 3 to 4 carbon atoms,
The terminal oxygen atom bonded to Y '11 is coupled with the phosphorus atom of the phosphoric acid ester of a terminal nucleotide of one of regions of the Z1 region and the Z2 region and,
Y 'terminal oxygen atoms bonded to 21, wherein Z2 region and the Z1 region of Y' is bonded to the phosphorus atom of the phosphoric acid ester of a terminal nucleotide of the other areas not bound to 11. )
The Lz linker region and the Lw linker region are independently the divalent groups of the structure represented by the following formula (II-A) or (II-B), according to claim 1 or 2. Production method.

(In the equation, n and m each independently represent an integer from 1 to 20.)
A nucleotide sequence that suppresses the expression of a gene targeted by RNA interferometry in at least one of the X1 region, the Y1a region, the X1a region and the W1a region, and the X2a region and the Y2a region. The production method according to any one of claims 1 to 4, which comprises.
The RNA ligase is T4 RNA ligase 2 derived from T4 bacteriophage, ligase 2 derived from KVP40, Trypanosoma brucei RNA ligase, Deinococcus radiodurans RNA ligase, or Leishmania ligase 1 ligase from Leishmania tarentolae RNA. The manufacturing method described.
The production according to any one of claims 1 to 6, wherein the RNA ligase is an RNA ligase consisting of an amino acid sequence having 95% or more identity with the amino acid sequence set forth in SEQ ID NO: 5, 6, or 7. Method.
The production method according to any one of claims 1 to 7, wherein the RNA ligase is T4 RNA ligase 2 derived from T4 bacteriophage or RNA ligase 2 derived from KVP40.
Any of claims 1 to 8, wherein the monoalkylamine salt or dialkylamine salt is at least one salt selected from the group consisting of hexylammonium salt, dipropylammonium salt, dibutylammonium salt, and quaternaryammonium salt. The manufacturing method according to paragraph 1.
Any of claims 1 to 9, wherein the packing material for the reverse phase column chromatography is silica or a polymer on which any one or more of a phenyl group, an alkyl group having 1 to 20 carbon atoms, or a cyanopropyl group is immobilized. The manufacturing method according to item 1.