AU5657800A - Transgenic production of antibodies in milk - Google Patents

Transgenic production of antibodies in milk Download PDF

Info

Publication number
AU5657800A
AU5657800A AU56578/00A AU5657800A AU5657800A AU 5657800 A AU5657800 A AU 5657800A AU 56578/00 A AU56578/00 A AU 56578/00A AU 5657800 A AU5657800 A AU 5657800A AU 5657800 A AU5657800 A AU 5657800A
Authority
AU
Australia
Prior art keywords
promoter
immunoglobulin
mammal
dna
milk
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
AU56578/00A
Inventor
Paul Ditullio
Harry Meade
Daniel Pollock
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
rEVO Biologics Inc
Original Assignee
Genzyme Transgenics Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Genzyme Transgenics Corp filed Critical Genzyme Transgenics Corp
Priority to AU56578/00A priority Critical patent/AU5657800A/en
Publication of AU5657800A publication Critical patent/AU5657800A/en
Assigned to GTC BIOTHERAPEUTICS, INC. reassignment GTC BIOTHERAPEUTICS, INC. Amend patent request/document other than specification (104) Assignors: GENZYME TRANSGENICS CORPORATION
Priority to AU2003248473A priority patent/AU2003248473B2/en
Abandoned legal-status Critical Current

Links

Landscapes

  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Description

AUSTRALIA
PATENTS ACT 1990 DIVISIONAL
APPLICATION
NAME OF APPLICANT: Genzyme Transgenics Corporation ADDRESS FOR SERVICE: DAVIES COLLISON
CAVE
Patent Attorneys 1 Little Collins Street Melbourne, 3000.
INVENTION
TITLE:
"Transgenic production of antibodies in milk" The following statement is a full description of this invention, including the best method of performing it known to us:
C
C
C. C
C.
C la TRANSGENIC PRODUCTION OF ANTIBODIES IN MILK This application is a divisional of Australian patent application No. 73079/98, the disclosure of which is included herein by way of reference in its entirety.
Field of the Invention This invention pertains to a method for the production of monoclonal antibodies in mammal's milk, specifically through the creation of transgenic animals that selectively express foreign antibody genes in mammary epithelial cells.
Backcrround of the Invention Immunoglobulins are heteropolymeric proteins that are normally synthesized, modified, assembled, and secreted from circulating B lymphocytes. Using recombinant DNA technology, it 20 is possible to program cells other than B-lymphocytes to express ixmunoglobulin genes. The difficulties encountered in this effort stem from several factors: 1) Both heavy and light chains of immunoglobulins must be co-expressed at appropriate levels; 2) Nascent immunoglobulin polypeptides undergo a variety of co- and post-translational modifications that may not occur with sufficient fidelity or efficiency in heterologous cells; 3) S' Immunoglobulins require accessory chaperone proteins for their assembly; 4) The synthetic and secretory capacity of the cell may be inadequate to secrete large amounts of heterologous proteins; and 5) The secreted immunoglobulins may be unstable in the extracellular milieu of a foreign cell.
Because immunoglobulins have many therapeutic, diagnostic and industrial applications, there is a need in the art for expression systems in which these proteins can be reproducibly manufactured at a high level, in a functional configuration, and in a form that allows them to be easily harvested and purified. The development of transgenic animal technology has raised the possibility of using large animals as genetically programmed protein factories. P.C.T. application
W
90/04036 (published 4/19/90) discloses the use of transgenic technology for immunoglobulin expression. WO 92/03918 (3/19/92) and WO 93/12227 (6/24/93) teach the introduction of unrearranged immunoglobulin genes into the germline of transgenic animals The use of intact immunoglobulin genes (including their respective promoter regions) will result in their expression in lymphocytes and secretion into the bloodstream of the host animal; this necessitates a strategy for suppressing the expression of the host's endogenous immunoglobulins, and raises the problem of purifying the immunoglobulins from serum, which contains many other proteins, including proteolytic enzymes.
Furthermore, if the transgenic approach is chosen, heavy and light chain genes must both be incorporated into the host genome, in a manner that enables their comcomittant expression.
Another option in creating transgenic animals is to S. link the gene of interest to a heterologous transcriptional promoter that only functions in a defined cell type within the host. In this manner, tissue-specific expression of the transgene may be programmed. U.S. Patent No. 4,873,316 (issued October 10, 1989) discloses the production of recombinant tissue plasminogen activator (TPA) in the milk of transgenic mice in which the TPA gene is linked to the promoter of the milk protein 25 casein. Other proteins that have been expressed in a similar fashion include cystic fibrosis transmembrane conductance regulator (DiTullio et al., Bio/Technology 10:74, 1992), urokinase (Meade et al., Bio/Technology 8: 443, 1990), nterleukin-2 (Buhler et al., Bio/Technology 8:140, 1990), and antihemophilic factor IX (Clark et al., Bio/Technology 7:487 1989). Notably, these proteins are all simple single-chain polypeptides that do not require multimerization or assembly prior to secretion.
It has now been found that when a transgenic mammal is created carrying paired immunoglobulin light and heavy chain genes under the control of the casein promoter, such an animal produces large amounts of assembled immunoglobulins which arc secreted in its milk. Using the DNA constructs of the present invention, a surprisingly high efficiency of co-integration of heavy and light chain genes is observed. Using the metod and constructs of the present invention, it is possible for the first time to program a mammary epithelial cell to produce and assemble complex tetrameric glycoproteins and secrete them in high qUantities.
Accordingly, it is an object of the present invention to provide methods for the large-scale production of immunoglobulins in the milk of transgenic mammals.
Another object of the invention is to provide methods for the design of synthetic immunoglobulins that can be produced in large quantities in milk.
Yet another object of the invention is to provide methods forroid methods for administering therapeutically beneficial antibodies to suckling young, by creating female mammals that excrete such antibodies into their milk.
A further object of the invention is a non- Anetinisatransgenlc on human mammal having germ and somatic cells with recombinant
DNA
sequences encoding imunoglobulin light and heavy chains, where said sequences are operatively linked at their 5' termini to a mammary specific promoter and at their 3' end to a sequence comprising a polyadenylation site.
A further object of the invention is a casein promoter cassette comprising in the 5' to 3' direction: a) 5' promoter sequences from the beta casein gene, 9 b) an XhoI restriction site, and 30 c) 3' untranslated sequences from the goat beta casein gene.
These and other objects of the present invention will be apparent to those of ordinary skill in the art in light of the present specification, drawings, and claims.
Brief Di tloL of th Drawl s 4 Figure 1 is a schematic representation of the Bc62 plasmid, which contains a 13.9 kb Sal I fragment that comprises cDNA encoding immunoglobulin light chain, flanked on its 5' and 3' termini by goat beta casein sequences.
Figure 2 is a schematic representation of the Bc61 plasmid, which contains a 14.6 kb Sal I fragment that comprises cDNA encoding immunoglobulin heavy chain, flanked on its 5' and 3' termini by goat beta casein sequences.
Figure 3 depicts the immunoblot detection of human immunoglobulin heavy chain in the milk of transgenic mice that were created using the beta casein promoter-linked immunoglobulin genes shown in Figures 1 and 2.
Figure 4 depicts the immunoblot detection of human immunoglobulin light chain in the milk of transgenic mice that were created using the beta casein promoter-linked immunoglobulin genes shown in Figures 1 and 2.
Summary of the Invention The present invention provides a DNA construct comprising a heterologous immunoglobulin protein-coding sequence operatively linked to a promoter sequence that results in the preferential expression of said protein-coding sequence in 5 mammary gland epithelial cells, thereby providing a heterologous and assetbled immunoglobulin in the milk of a transgenic mammal.
The parent invention relates to a method for obtaining heterologous immunoglobulins from the milk of transgenic mammals. Another aspect of the parent invention comprises the 10 method for creating transgenic mammals by introducing into their germline immunoglobulin cDNA linked to a milk-specific promoter.
In another aspect, the parent invention comprises transgenic mammals having germ cells and somatic cells having recombinant DNA sequences comprising immunoglobulin cDNA linked to a milk-specific promoter.
-4a- In still another aspect, the parent invention comprises an isolated DNA comprising an expression cassette having 51 and 3' non-coding sequences derived from the groat beta casein gene linked via a unique restriction site that serves as a convenient cloning site for immunoglobulin coding sequences.
DetaLiled -eci~t fthe Invention All patent applications, patents and literature cited in this specification are hereby incorporated by reference in o 0..
0 09* t1Leir entirety. In the case of inconsistencies, the present disclosure will prevail.
The present invention pertains to a method for the production of monoclonal antibodies that are excreted into the milk of transgenic animals and the method for production of such animals. This is achieved by engineering DNA constructs in which DNA segments encoding specific paired irmmunoglobulin heavy and light chains are cloned downstream of a promoter sequence that is preferentially expressed in mammary epithelial cells. The recombinant DNAs containing the promoter-linked heavy and light chain genes are then coinjected into preimplantation embryos.
The progeny are screened for the presence of both transgenes.
Representative females from these lines are then milked, and the milk is analyzed for the presence of the monoclonal antibody. In order for the antibody to be present, both heavy and light chain genes must be expressed concurrently in the same cell. The antibodies may be purified from the milk, or the milk itself, comprising the immunoglobulins, may be used to deliver the antibodies to a recipient. This is discussed below.
The immunoglobulin genes useful in the present invention may be obtained from natural sources e.g. individual
B
cell clones or hybridomas derived therefrom. Alternately, they may comprise synthetic single-chain antibodies in which the light and heavy variable regions are expressed as part of a single polypeptide. Furthermore, recombinant antibody genes may be used that have been predictively altered by nucleotide substitutions that do or do not change the amino acid sequence, by addition or deletion of sequences, or by creation of hybrid genes in which different regions of the polypeptide are derived from different sources. Antibody genes by their nature are extremely diverse, and thus naturally tolerate a great deal of variation. It will be appreciated by those skilled in the art that the only limitation for producing an antibody by the method of the present invention is that it must assemble into a functional configuration and be secreted in a stable form into the milk.
The transcriptional promoters useful in practicing the present invention are those promoters that are preferentially activated in mammary epithelial cells, including promoters that control the genes encoding milk proteins such as caseins, beta lactoglobulin (Clark et al., (1989) Bio/Technology7: 487-492), whey acid protein (Gordon et al., (1987) Bio/Technlmology 5: 1183- 1187), and lactalbumin (Soulier et al., (1992) FEES Letts. 297: 13). Casein promoters may be derived from the alpha, beta, or kappa casein genes of any mammalian species; a preferred promoter is derived from the goat beta casein gene (DiTullio, (1992) Bio/Technology 1Q0:74-77).
For use in the present invention, a unique Xhol restriction site is introduced at the 3' terminus of the promoter sequence to allow the routine insertion of immunoglobulin coding sequences. Preferably, the inserted immunoglobulin gene is flanked on its 3' side by cognate genomic sequences from a Smammary-specific gene, to provide a polyadenylation site and transcript-stabilizing sequences. Transcription of the construct in vivo results in the production of a stable mRNA containing 20 casein-derived 5' untranslated sequences upstream of the translational initiator codon of the immunoglobulin gene and 3' untranslated sequences downstream of the translational termination codon of the immunoglobulin gene. Finally, the entire cassette promoter-immunoglobulin-3, region) is flanked by restriction sites that enable the promoter-cDNA S. cassette to be easily excised as a single fragment. This facilitates the removal of unwanted prokaryotic vector-derived DNA sequences prior to injection into fertilized eggs.
The promoter-linked immunoglobulin heavy and light 30 chain DNAs are then introduced into the germ line of a mamnal e.g. cow, sheep, goat, mouse, oxen, camel or pig. Mammals are defined herein as all animals, excluding humans, that have mammary glands and produce milk. Mammalian species that produce milk in large amounts over long periods of time are preferred.
Typically, the DNA is injected into the pronuclei of fertilized eggs, which are then implanted into the uterus of a recipient female and allowed to gestate. After birth, the Putative transgenic animals are tested for the presence of the introduced DNA. This is easily achieved by Southern blot hybridization of DNA extracted from blood cells or other available tissue, Using as a probe a segment of the injected gene that shows no cross hybridization with the DNA of the recipient species. Progeny that show evidence of at least one copy of both heavy and lightchain immunoglobulin genes are selected for further analysis.
Transgenic females may be tested for ihmunoglobulin secretion into milk, using any of the immunological techniques that are standard in the art Western blot, radioimmunoassay, ELISA). The anti immunoglobulin antibodies used in this analysis may be polyclonal or monoclonal antibodies that detect isolated heavy or light chains or others that react only with fully assembled (H2L2) immunoglobulins.
The recombinant immunoglobulins are also characterized with respect to their functionality, i.e. binding specificity and S. affinity for a particular antigen. This is achieved using 20 immunological methods that are standard in the art, such as Scatchard analysis, binding to immobilized antigen, etc. The 4 stability characteristics of an immunoglobulin in the milk of a given species are also assayed, by applying the above-described detection methods to milk that has been incubated for increasing 25 times after recovery from the animal.
The immunoglobulins produced by the methods of the present invention may be purified from milk, using adsorption to immobilized Protein G, column chromatography, and other methods known to those of ordinary skill in the art 'of antibody purification.
The level of production of recombinant immunoglobulins in an individual transgenic mammal is primarily determined by the site and manner of integration of the transgene after injection into the fertilized egg. Thus, transgenic progeny derived from different injected eggs may vary with respect to this parameter.
The amount of recombinant imunoglobulin in milk is therefore monitored in representative progeny, and the highest -producing females are preferred.
Those. skilled in the art will recognize that the methods of the present invention can be used to optimize the production of natural and synthetic immunoglobulins. The steps of creating a transgenic animal, testing for the presence of both heavy and light-chain genes, assaying the secretion of imunoglobulin into the milk of female progeny, and, finally, assessing the quality of the resulting. antibodies, can be repeated sequentially, without undue experimentation, to establish preferred constructs for different applications.
According to the present invention,.the nature of the recombinant immunoglobulins and their specific mode of use can vary. In one embodiment, the present invention encompasses highlevel expression of antibodies that are harvested and purified from milk and used in purified form. High-level expression is defined herein as the production of about 1 mg/ml of protein. In another embodiment, antibodies are engineered that provide protection to humans against infectious diseases; therapeutic administration is then achieved by drinking the milk. In a still further embodiment, lactating animals are engineered to produce antibodies specifically beneficial to their offspring, which acquire them through suckling. In*a. still further embodiment, 25 animals produce an antibody that protects the lactating mammal itself against breast pathogens e.g. bacteria that produce mastitis.
***The unexpectedly high-volume expression of iununoglobulins using the method and constructs of the present invention also allows the use of such immunoglobulins in pharmaceutical and chemical settings. By way of non-limiting example the method of the present invention can be used to produce high levels of tetrameric antibodies directed against various pathogens E. coli, Salmonella, hepatitis B virus), biologically active peptides e rythropoietin, tissue 9 plasminogen activator, gamma interferon) arnd for use in chemical reactions directed against various enzymes. Monoclonal antibodies that bind to the transition state of a chemical.
reaction c an be used in industrial -scale production.
Furthermore, monoclonal antibodies are often immobilized on columns for use in the purification of biopharmaceuticals; in such cases, production of the antibodies represents a significant fraction of the cost of purification. The methods of the present invention facilitate the production of *high-volume low cost antibody stocks for use in these types of applications.
The present invention is further described in the following working examples, which are intended to illustrate the invention without limiting its scope.
Example 1: Construction of a ilk-Sipe if ic Promoter Cassette The present invention encompasses a recipient vector into which many different ixmunoglobulin ,genes can be :0 interchangeably inserted. The vector contains 5' milk-specific promoter sequences and 3' untranslated genomic sequences that flank an XhoI cloning site. This cloning is unique because it is 20 teonly oepresent in the vector. Preferably, the entire expression cassette should be flanked by restriction sites that allow the easy excision of the promoter-link]ed izmunoglobulin ***gene.
In this Example, the promoter and 3' genomic sequences 25 were derived from the goat beta casein gene. The gene was cloned and characterized as described by Roberts et al., 1992, Gene 121~:255-262, which is hereby incorporated by reference.
::*The expression cassette, prior to insertion of immunoglobulin genes, consists of 6.2 kb upstream of the translational start of the beta casein coding sequence and 7.1 kb of genomic sequence downstream of the translational stop of the beta casein gene. The TaqI site just upstream of the translational start codon was changed to an XhoI site. This unique XhioI cloning site is at the junction of the upstream and downstream sequences. It is this XhoI site, included in the sequence CGCGGATCCTCGAGGACC, into which recombinant immunoglobulin genes are inserted. (D Tullio, (1992) Bio/Technology 1l:74-77) The 3' beta casein region begins at the PpuMI site found in Exon 7 and continues for 7.1 kb downstream. Included in this sequence are the remaining 18 bp of Exon 7, and all of Exon 8 and Exon 9. These encode the 3' untranslated regions of the goat beta casein gene, and terminate with the sequence: 0 TAAGGTCCACAGACCGAGACCCACTCACTAGGCAACTGGTCCGTCCAGCTGTTAAG
TGA.
e To engineer restriction sites flanking the casein cassette, the goat beta casein control sequences were first cloned into the SuperCosi vector (#251301, Stratagene La JollA, CA) with flanking NotI and SaII sites. This plasmid was then modified by changing the NotI site to a SalI site. This created a 13.3 kb SalI fragment containing the beta casein expression cassette within the gbc163 vector.
Example 2: Construction of Promoter-linked Monclonal Antibody Genes In this Example, the genes encoding a human monoclonal 20 antibody directed against a colon cancer cell-surface marker were linked to the casein promoter. cDNAs encoding the light and heavy chains of this antibody were cloned from an antibodysecreting hybridoma cell line into a pUC19-derived vector. The light and heavy chain cDNAs were present on HindIII/EcoRI fragments of 702 bp and 1416 bp, respectively.
To adapt the genes for insertion into the casein promoter cassette, XhoI restriction sites were engineered at both ends of each DNA segment as detailed below. In the same step, 3" the region upstream of the immunoglobulin translation initiation 30 codon was modified so that it contained sequences similar to those in the analogous region of the beta casein gene.
Light chain gene: The pUC19 plasmid containing the light chain cDNA insert was digested with HindIII, blunt-ended by treatment with the Klenow fragment of DNA Polymerase I, and ligated to an oligonucleotide containing an XhoI recognition sequence (#1030, New England Biolabs, Beverly,
MA).
The region immediately upstream of the initiating
ATG
was then mutagenized using an oligonucleotide with the following sequence: 5' AGT GAA TTC ATG CTC GAG AGC CAT GGC CTG GATC 3'.
Digestion of the final plasmid with XhoI produced the modified light chain cDNA that was flanked by Xhol cohesive ends.
The light chain cDNA was then inserted into the unique XhoI cloning site of the gbcl63 expression vector described in Example 1, yielding plasmid Bc62 (Figure 1).
Heavy chain gene: The pUC19 plasmid containing the heavy chain cDNA was mutagenized using an oligonucleotide with the following sequence: 5' AGT GAA TTC ATG CTC GAG AGC CAT GAA GCA CCTG The resulting plasmid contains an XhoI site upstream of the heavy chain translation initiation codon.
SThe downstream HindIII site was converted to an Xhol site using a synthetic adapter with the sequence 5' AGC TCC TCG AGG CC Digestion of the modified plasmid with XhoI produced S: the the 1.4 kb modified heavy chain cDNA flanked by XhoI cohesive S 20 ends. This fragment was then inserted into the unique XhoI cloning site of gbc163 to yield Bc61 (Figure 2).
Prior to injection, promoter-linked light and heavy Schain genes were isolated from Bc61 and Bc62, respectively, by digestion with SalI. The fragments were then purified by gel 25 electrophoresis followed by CsCI equilibrium gradient centrifugation. The DNA was dialyzed extensively against distilled water prior to quantitation.
Example 3: Production of Transqenij Mice The casein promoter-linked DNA fragments encoding the immunoglobulin heavy and light chains, obtained as described in Example 2, were injected into fertilized mouse eggs using procedures that are standard in the art, as described in Hogan, Constantini, and Lacey, Manipulating the Mouse Embryo: A Laboratory Manual (Cold Spring Harbor Laboratories, 1986). The resulting progeny were then analyzed for the presence of both antibody gene sequences. DN~A was extracted from tail biopsy material and probed using Southern blot analysis.* The probes used in the hybridization were the original cDNAs encoding the heavy and light chains. As seen in Table 1, most of the f irst generation transgenic progeny had incorporated both transgenes.
Summary of Bc~l -Bc62 Mice ex i I 1-2 14 Pos. Pos.
1-3 M Pos. Pos. light chain only 1-9 M Pos. Pos. 1-15 F Neg. Pos. Low level -lambda chain 1-16 F Pos. Neg.
1-19 F Pos. Pos.
N.D.
1-23 F Pos. Pos. 1-3 mg/mi 1-24 F Pos. Pos. low level 1-25 14 Pos. Neg.
1-39 14 Pos. Pos. 1-13 F Pos. Pos.
N.D.
1-56 F Pos. Pos.
N.D.
1-64 M Pos. Pos.
2-76 F Pos. Pos. 1-3 mg/mi1 2-82 F Pos. Pos. 1-3 mg/mi 1-72 14 Pos. Pos.
2-92 F Pos. Pos. 0.2 0.5 mg/mi 2-95 F Pos. Pos. 0.2 0.5 mg/mi -13- Example 4: Analysis of Recombinant ITmunoglobulins in Milk Samples of milk from the transgenic mice obtained as described in Example 3 were analyzed for the presence of the heterologous immunoglobulin by Western blot. The heavy chain of the antibody was detected using a horseradish peroxide-linked polyclonal antibody directed against human gamma heavy chain (Antibody #62-8420, Zymed, South San Francisco, CA.) as shown in Figure 3. The light chain was detected using antibodies to the human lambda light chain, (Antibody #05-4120, Zymed, South San Francisco, CA.) shown in Figure 4. In these Figures, it can be seen that immunoreactive heavy and light chains can be detected in the milk of several animals, but not in the negative control animal CD-1. Human immunoglobulin can be detected in milk from founder 1-23 and from the progeny of the 1-76 and 1-72 founders.
15 These animals are the second-generation females, 2-76, 2-82, 2- 92, and 2-95. The levels of expression range between 0.2 mg/ml to over 1 mg/ml.
Throughout this specification and the claims which follow, unless the context requires otherwise, the word "comprise", or variations such as "comprises" or "comprising", will be understood to imply the inclusion of a stated integer or group of integers but not the exclusion of any other integer or group of integers.
The reference to any prior art in this specification is not, and should not be taken as, an acknowledgment or any form of suggestion that that prior art forms part of the common general knowledge in Australia.

Claims (9)

14- THE CLAIMS DEFINING THE INVENTION ARE AS FOLLOWS: 2. A method for obtaining heterologous immunoglobulin from the milk of a transgenic mammal comprising the steps of: a. introducing into the germline of said mammal DNA comprising the protein-coding sequences of said immunoglobulin, said DNA operatively linked at its 5' terminus to a promoter sequence that supports the preferential expression of said genes in mammary gland epithelial cells, and said DNA operatively linked at its 3' terminus to a sequence containing a polyadenylation site, and b. obtaining milk from said mammal. o 2. The method of claim I wherein said mammal is selected from the group consisting of mice, cows, sheep, goats, oxen, camels, and pigs. The method of claim 1 wherein said promoter is selected from the group consisting of the casein promoter, the beta lactoglobulin promoter, the whey acid protein promoter, and the lactalbumin promoter. 4. The method of claim 1 wherein said immunoglobulin comprises heavy and light chains. The method of claim 1 wherein said immunoglobulin comprises a single polypeptide chain. 6. The method of claim l wherein said immunoglobulin is of human origin. 7. The method of claim 1 wherein said immunoglobulin is purified from the milk of said mammal. 8. A transgenic non-human mammal all of whose germ cells and somatic cells contain recombinant DNA sequences encoding immunoglobulin heavy and light chains, wherein said sequences are operatively linked at their 5' termini to a promoter sequence that supports the preferential expression of said genes in mammary gland epithelial cells, and operatively linked at their 3' termini to a sequence containing a polyadenylation site. 9. The transgenic mammal of claim 8 wherein said mammal is selected from the group consisting of mice, cows, sheep, goats, oxen, camels, and pigs. 10. The transgenic mammal of claim 8 wherein said promoter is selected from the group consisting of the casein promoter, the beta lactoglobulin promoter, the whey acid protein promoter, and the lactalbumin promoter. 11. The transgenic mammal of claim 8 wherein said immunoglobulin comprises heavy and light chains. 12. The transgenic mammal of claim 8 wherein said immunoglobulin comprises a single polypeptide chain. 13. The transgenic mammal of claim 8 wherein said immunoglobulin is of human origin. 14. An isolated purified DNA comprising in the 5' to 3' direction a) 5' promoter sequences from the beta casein gene, b) a unique Xho I restriction site, and c) 3' untranslated sequences from the goat beta casein gene, wherein a) comprises nucleotides -6168 to -1 of the goat beta casein, wherein nucleotide 1 is the first nucleotide of the beta casein translation initation codon, b) comprises the sequence CGCGGATCCTCGAGGACC, and c) comprises the sequence -16- starting at the PpuMI site found at bp648 of the beta casein cDNA sequence, and continuing for 7.1 kb downstream, termininating in the sequence TAAGGTCCAGAGACCGAGACCCACTCACTAGGCAACTGGTCCGRCCAGCTGTTAAGTGA. The DNA of claim 14 wherein an immunoglobulin cDNA is inserted into said DNA directing the mammary-gland- specific expression of said immunoglobulin in transgenic animals.
16. The DNA of claim 15 wherein said immunoglobulin comprises heavy and light chains.
17. The DNA of claim 15 wherein said immunoglobulin comprises a single polypeptide chain.
18. The DNA of claim 15 wherein said immunoglobulin is o ~of human origin.
19. A DNA construct comprising a heterologous immunoglobulin protein-coding sequence operatively linked to a promoter sequence that results in the preferential expression of said protein-coding sequence in mammary gland epithelial cells, thereby providing a heterologous and assembled immunoglobulin in the milk of a transgenic mammal. The construct of claim 19 wherein said mammal is selected from the group consisting of mice, sheep, goats, pigs and cows.
21. The construct of claim 19 wherein said promoter is selected from the group consisting of the beta lactoglobulin promoter, whey acid protein promoter, and the lactalbumin promoter. P:\OPER\MKR\SPECI73079-98-div.doc.08i/9/00 -17-
22. The construct of claim 19 immunoglobulin comprises heavy and light chains. wherein said
23. The construct immunoglobulin is of human origil of claim 19 wherein said cc r r r
24. The construct of claim 19 wherein said immunoglobulin is purified from the milk of said mammal. The construct of claim 19 wherein said promoter is the casein promoter. DATED this 8th day of September, 2000 GENZYME TRANSGENIC CORPORATION By DAVIES COLLISON CAVE Patent Attorneys for the Applicant
AU56578/00A 1993-12-20 2000-09-08 Transgenic production of antibodies in milk Abandoned AU5657800A (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
AU56578/00A AU5657800A (en) 1993-12-20 2000-09-08 Transgenic production of antibodies in milk
AU2003248473A AU2003248473B2 (en) 1993-12-20 2003-10-01 Transgenic production of antibodies in milk

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
AU56578/00A AU5657800A (en) 1993-12-20 2000-09-08 Transgenic production of antibodies in milk
US170579 2008-07-10

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
AU73079/98A Division AU7307998A (en) 1993-12-20 1998-06-19 Transegenic production of antibodies in milk

Related Child Applications (1)

Application Number Title Priority Date Filing Date
AU2003248473A Division AU2003248473B2 (en) 1993-12-20 2003-10-01 Transgenic production of antibodies in milk

Publications (1)

Publication Number Publication Date
AU5657800A true AU5657800A (en) 2000-11-23

Family

ID=3742150

Family Applications (2)

Application Number Title Priority Date Filing Date
AU56578/00A Abandoned AU5657800A (en) 1993-12-20 2000-09-08 Transgenic production of antibodies in milk
AU2003248473A Ceased AU2003248473B2 (en) 1993-12-20 2003-10-01 Transgenic production of antibodies in milk

Family Applications After (1)

Application Number Title Priority Date Filing Date
AU2003248473A Ceased AU2003248473B2 (en) 1993-12-20 2003-10-01 Transgenic production of antibodies in milk

Country Status (1)

Country Link
AU (2) AU5657800A (en)

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4873316A (en) * 1987-06-23 1989-10-10 Biogen, Inc. Isolation of exogenous recombinant proteins from the milk of transgenic mammals

Also Published As

Publication number Publication date
AU2003248473A1 (en) 2003-11-06
AU2003248473B2 (en) 2007-05-10

Similar Documents

Publication Publication Date Title
EP0741515B1 (en) Transgenic production of antibodies in milk
EP0463151B1 (en) Generation of xenogeneic antibodies
JP2014121337A (en) C1 inhibitor produced in milk of transgenic mammals
US20040092719A1 (en) Isolation of immunoglobulin molecules that lack inter-heavy chain disulfide bonds
US20060026695A1 (en) Transgenically produced fusion proteins
AU782840B2 (en) Transgenically produced fusion proteins
AU2003248473B2 (en) Transgenic production of antibodies in milk
AU2007205719A1 (en) Transgenic production of antibodies in milk
WO1994025586A1 (en) Transgenic animals having an engineered immune response
WO2020053661A1 (en) Methods of purifying antibodies from the milk of transgenic non-human mammals comprising the use of chitosan

Legal Events

Date Code Title Description
TC Change of applicant's name (sec. 104)

Owner name: GTC BIOTHERAPEUTICS, INC.

Free format text: FORMER NAME: GENZYME TRANSGENICS CORPORATION

MK5 Application lapsed section 142(2)(e) - patent request and compl. specification not accepted