CA1296276C - DNA STRAND CODING FOR .alpha.-ACETOLACTATE DECARBOXYLASE AND YEAST TRANSFORMED WITH THE DNA STRAND - Google Patents
DNA STRAND CODING FOR .alpha.-ACETOLACTATE DECARBOXYLASE AND YEAST TRANSFORMED WITH THE DNA STRANDInfo
- Publication number
- CA1296276C CA1296276C CA000532171A CA532171A CA1296276C CA 1296276 C CA1296276 C CA 1296276C CA 000532171 A CA000532171 A CA 000532171A CA 532171 A CA532171 A CA 532171A CA 1296276 C CA1296276 C CA 1296276C
- Authority
- CA
- Canada
- Prior art keywords
- dna strand
- yeast
- nucleotide sequence
- amino acid
- alpha
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Lifetime
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
ABSTRACT OF THE DISCLOSURE
DNA strand having an ability in biotechnological production of .alpha.-acetolactate decarboxylase is disclosed.
The DNA strand is characterized in that it has a nucleotide sequence coding for a polypeptide whose amino acid sequence is substantially from A to B of Fig. 1 and which has .alpha.-acetolactate decarboxcylase activity. Also disclosed is a yeast which belongs to Saccharomyces cerevisiae and which has been transformed by the DNA
strand. The yeast is characterized by the fact that its .alpha.-acetolactate producing ability is reduced, and will thus produce an alcoholic liquor such as beer which contains no or little diacetyls which have come from their precursor, namely .alpha.-acetolactate.
DNA strand having an ability in biotechnological production of .alpha.-acetolactate decarboxylase is disclosed.
The DNA strand is characterized in that it has a nucleotide sequence coding for a polypeptide whose amino acid sequence is substantially from A to B of Fig. 1 and which has .alpha.-acetolactate decarboxcylase activity. Also disclosed is a yeast which belongs to Saccharomyces cerevisiae and which has been transformed by the DNA
strand. The yeast is characterized by the fact that its .alpha.-acetolactate producing ability is reduced, and will thus produce an alcoholic liquor such as beer which contains no or little diacetyls which have come from their precursor, namely .alpha.-acetolactate.
Description
~3$~76 DNA STRAND CODING FOR a-ACETOLAC~ATE
DECARBOXYLASE AND YEAST TRANSFORMED WITH THE DNA STRAND
BACKGROUND OF THE INVENTION
5 Field field of the Art This invention relates to a DNA strand having an ability in biotechnological production o a~acetolactate decarboxylase (hereinafter called ~-ALDCase) as produced by Enterobacter aeroqenes IFO 13534 and also to a yeast 10 belonging to Saccharomyces cerevisiae transformed with the DNA strand so that its a-acetolactate ~hereinaLter called a-AL)producing ability is reduced.
Prior art Alcoholic liquors such as beer, sake, wine, etc., 15 are generally produced by adding a yeast belonging to Saccharomyces cerevisiae to a starting material liquid for fermentation such as wort, fruit juice, etc., and subjecting the mixture to alcoholic fermentation. In the fermentation process, the yeast will produce a-AL as the 20 intermediate substance for biosynthesis of valine and leucine which are amino acids necessary for the growth of j itself, and leak it inevitably out of the cell, namely ¦ into the fermented liquor. The a-AL which has thus become to exist in the fermented liquor will change 25 spontaneously to diacetyl (hereinafter called DA) through B~e non-enzymatical reaction in the fermented liquor.
DA is a substance having strong objectionable odor called generally as "cooked odor" or "DA odor" and~ in order to produce an alcoholic liquor excellent in flavor 30 (namely without DA odor), the content of a-AL and DA in the fermented liquor is required to be decreased to at a low level so that the total DA content will not finally exceed the discrimination threshold of DA odor in the j alcoholic liquor (e.g. 0.05 to 0.1 mg/liter in the case 35 of beer) even if a-AL may be all changed to DA.
While DA in the fermented liquor is converted to acetoin which is tasteless and odorless relatively ,"
~t~ 7 ~
rapidly in the co-presence of yeast, ~-AL in the fermented li~uor will not be changed by yeast, but it becomes decomposable with yeast only after it is changed to DA by non-enzymatical chemical reaction. However, since the convergence reaction from ~-AL to DA in the fermented liquor proceeds at a very slow rate, this reaction becomes the rate-limiting step, whereby the fermented liquor is required to be aged under the co-presence of yeast for a long time in order to obtain an alcoholic liquor with low content of ~-AL and DA (namely without DA odor).
~-ALDCase is an enzyme having the property of convert-ing N-AL to acetoin and has been known to be produced by various kinds of bacteria such as Enterobacter aerogenes, Bacillus licheniformis, Lactobacillus casei, Bacillus brevis, Enterobacter cloacae, Acetobacter bacteria (such as A. rancens, A. aceti, etc), etc. The principal enzymological properties of the ~-ALDCase produced by Enterobacter aerogenes were investigated by the present inventors to obtain the results shown below.
Molecular weight: 28000 ~ 29000 Isoelectric point: pH 5.0 ~ 6.0 Optimal pEI: 6.5 ~ 7.5 Optimal temperature: 40 ~ 50C
Thermal stability: stable to around 60C
There is also a report about the enzymological properties of the ~-ALDCase produced by Enterobacter aerogenes [European Journal of Biochemistry (Eur. J. Biochem. 14 (1970)) 133 - 137].
BRIEF DESCRIPTION OF THE DRAWINGS
Fig. 1 illustrates a nucleotide sequence of the DNA
B
3 ~ ~9~ 6 strand codin~ for ~-ALDCase determined in EXPERIMENTAL EXAMPLES, ~1) Cloning of a-ALDCase gene and the amino acid sequence deduced from the nucleotide sequence;
Fig. 2 illustrates the structure of pAL~5034; and Fig. 3 illustrates the structure of pIARLl.
SUMMARY OF THE INVENTION
. .
The present invention provides a DNA strand having an ability to biotechnologically produce a-ALDCase, which is useful for production of alcoholic liquors having no DA odor within by far shorter period as compared with the prior art method, and a yeast of which a-AL producing ability is reduced by transforma-tion with the D~A strand.
More specifically, the DNA strand having an ability to biotechnologically produce a-ALDCase according to the present invention is characterized in that it has a nucleotide sequence, or, in other words, a base sequence coding for a polypeptide having N-ALDCase activity, of which amino acid sequence, namely an amino acid sequence of the polypeptide, is substantially from A to B of the amino acid sequence shown in Fig. 1.
The yeast belonging to Saccharomyces cerevislae according to the present invention is characterized in that its a-AL producing ability is reduced by transformation with a DNA
strand which has a nucleotide sequence coding for the polypeptide having a-ALDCase activity, of which amino acid sequences substantially from A to B of the amino acid sequence shown in Fig. 1.
The present invention also relates to the use of the DNA strand and the yeast.
~31 4 ~$~6 The DNA strand according to the present invention can impart ~-ALDCase producing ability to various microorganisms, for example, Saccharomyces cerevisiae to reduce its a-AL proaucing ability (as described in detail below), or it can be effectively utilized in biotechnological production of a-ALDCase.
Also, since the yeast according to the present invention is reduced in its ability to produce ~-AL (correctly leaking of a-AL out of the cell~, if the starting material liquor for fermentation is fermented with this yeast, the level of a-AL
in the fermented liquor will become very low to give a result that the aging period required for treatment of a-AL in the fermented liquor, and therefore the production period of alcoholic liquor can be remarkably shortened. In the yeast of the present invention, its a-AL producing ability is reduced probably because the ~-AL, even if produced within the cell in the fermentation process, will be converted to acetoin by a-ALDCase also produced similarly within the cell.
DETAILED DESCRIPTION OF THE INVENTION
a-ALDCase gene Definition . .
The DNA strand according to the present invention having an ability in biotechnological production of a-ALDCase, namely the ~-ALDCase gene codes for a polypeptide having a-ALDCase activity, of which amino acid se~uence is substantially ~rom A to B of the amino acid sequence shown in Fig. 1.
Here, the "DNA strand" means complementary double strands of polydeo~yribonucleic acid having a certain length.
And, since the "DNA strand" is specified by the amino acid ~: Bl
DECARBOXYLASE AND YEAST TRANSFORMED WITH THE DNA STRAND
BACKGROUND OF THE INVENTION
5 Field field of the Art This invention relates to a DNA strand having an ability in biotechnological production o a~acetolactate decarboxylase (hereinafter called ~-ALDCase) as produced by Enterobacter aeroqenes IFO 13534 and also to a yeast 10 belonging to Saccharomyces cerevisiae transformed with the DNA strand so that its a-acetolactate ~hereinaLter called a-AL)producing ability is reduced.
Prior art Alcoholic liquors such as beer, sake, wine, etc., 15 are generally produced by adding a yeast belonging to Saccharomyces cerevisiae to a starting material liquid for fermentation such as wort, fruit juice, etc., and subjecting the mixture to alcoholic fermentation. In the fermentation process, the yeast will produce a-AL as the 20 intermediate substance for biosynthesis of valine and leucine which are amino acids necessary for the growth of j itself, and leak it inevitably out of the cell, namely ¦ into the fermented liquor. The a-AL which has thus become to exist in the fermented liquor will change 25 spontaneously to diacetyl (hereinafter called DA) through B~e non-enzymatical reaction in the fermented liquor.
DA is a substance having strong objectionable odor called generally as "cooked odor" or "DA odor" and~ in order to produce an alcoholic liquor excellent in flavor 30 (namely without DA odor), the content of a-AL and DA in the fermented liquor is required to be decreased to at a low level so that the total DA content will not finally exceed the discrimination threshold of DA odor in the j alcoholic liquor (e.g. 0.05 to 0.1 mg/liter in the case 35 of beer) even if a-AL may be all changed to DA.
While DA in the fermented liquor is converted to acetoin which is tasteless and odorless relatively ,"
~t~ 7 ~
rapidly in the co-presence of yeast, ~-AL in the fermented li~uor will not be changed by yeast, but it becomes decomposable with yeast only after it is changed to DA by non-enzymatical chemical reaction. However, since the convergence reaction from ~-AL to DA in the fermented liquor proceeds at a very slow rate, this reaction becomes the rate-limiting step, whereby the fermented liquor is required to be aged under the co-presence of yeast for a long time in order to obtain an alcoholic liquor with low content of ~-AL and DA (namely without DA odor).
~-ALDCase is an enzyme having the property of convert-ing N-AL to acetoin and has been known to be produced by various kinds of bacteria such as Enterobacter aerogenes, Bacillus licheniformis, Lactobacillus casei, Bacillus brevis, Enterobacter cloacae, Acetobacter bacteria (such as A. rancens, A. aceti, etc), etc. The principal enzymological properties of the ~-ALDCase produced by Enterobacter aerogenes were investigated by the present inventors to obtain the results shown below.
Molecular weight: 28000 ~ 29000 Isoelectric point: pH 5.0 ~ 6.0 Optimal pEI: 6.5 ~ 7.5 Optimal temperature: 40 ~ 50C
Thermal stability: stable to around 60C
There is also a report about the enzymological properties of the ~-ALDCase produced by Enterobacter aerogenes [European Journal of Biochemistry (Eur. J. Biochem. 14 (1970)) 133 - 137].
BRIEF DESCRIPTION OF THE DRAWINGS
Fig. 1 illustrates a nucleotide sequence of the DNA
B
3 ~ ~9~ 6 strand codin~ for ~-ALDCase determined in EXPERIMENTAL EXAMPLES, ~1) Cloning of a-ALDCase gene and the amino acid sequence deduced from the nucleotide sequence;
Fig. 2 illustrates the structure of pAL~5034; and Fig. 3 illustrates the structure of pIARLl.
SUMMARY OF THE INVENTION
. .
The present invention provides a DNA strand having an ability to biotechnologically produce a-ALDCase, which is useful for production of alcoholic liquors having no DA odor within by far shorter period as compared with the prior art method, and a yeast of which a-AL producing ability is reduced by transforma-tion with the D~A strand.
More specifically, the DNA strand having an ability to biotechnologically produce a-ALDCase according to the present invention is characterized in that it has a nucleotide sequence, or, in other words, a base sequence coding for a polypeptide having N-ALDCase activity, of which amino acid sequence, namely an amino acid sequence of the polypeptide, is substantially from A to B of the amino acid sequence shown in Fig. 1.
The yeast belonging to Saccharomyces cerevislae according to the present invention is characterized in that its a-AL producing ability is reduced by transformation with a DNA
strand which has a nucleotide sequence coding for the polypeptide having a-ALDCase activity, of which amino acid sequences substantially from A to B of the amino acid sequence shown in Fig. 1.
The present invention also relates to the use of the DNA strand and the yeast.
~31 4 ~$~6 The DNA strand according to the present invention can impart ~-ALDCase producing ability to various microorganisms, for example, Saccharomyces cerevisiae to reduce its a-AL proaucing ability (as described in detail below), or it can be effectively utilized in biotechnological production of a-ALDCase.
Also, since the yeast according to the present invention is reduced in its ability to produce ~-AL (correctly leaking of a-AL out of the cell~, if the starting material liquor for fermentation is fermented with this yeast, the level of a-AL
in the fermented liquor will become very low to give a result that the aging period required for treatment of a-AL in the fermented liquor, and therefore the production period of alcoholic liquor can be remarkably shortened. In the yeast of the present invention, its a-AL producing ability is reduced probably because the ~-AL, even if produced within the cell in the fermentation process, will be converted to acetoin by a-ALDCase also produced similarly within the cell.
DETAILED DESCRIPTION OF THE INVENTION
a-ALDCase gene Definition . .
The DNA strand according to the present invention having an ability in biotechnological production of a-ALDCase, namely the ~-ALDCase gene codes for a polypeptide having a-ALDCase activity, of which amino acid se~uence is substantially ~rom A to B of the amino acid sequence shown in Fig. 1.
Here, the "DNA strand" means complementary double strands of polydeo~yribonucleic acid having a certain length.
And, since the "DNA strand" is specified by the amino acid ~: Bl
2'^~6 4a se~uence of the polypeptide encoded thereby and the polypeptide has a finite length as mentioned above, the DNA strand also has a finite length. However, while the DNA strand contains a gene coding for ~-ALDCase and is useful for biotechnological production of the polypeptide, such biotechnological production cannot be effected only by the DNA strand having the finite length, ~ut biotechnological production of the polypeptide is rendered possible under the state where a DNA strand of a suitable length is linked upstream to its 5'-side and/or down-stream to its 3'-side.
Accordingly, the "DNA strand" as mentioned in the present invention is inclusive, in addition to the DNA strand of a specific length (the length of A-B in terms of the correspond-ing amino acid sequence in Fig. 1), of ;2~6 those in the form of a linear DNA or a circular DNA
strand containing the DNA strand of the specific length.
Of the existing forms of the DNA strand according to the present invention, typical are the plasmid form containing the DNA strand as a part of the constituent and the form existing in a microorganism, particularly E.
coli and yeast, as the plasmid form or the integrated form in the genome.
The preferable existing form of the DNA strand according to the present invention comprises the DNA
strand of the present invention as a foreign gene linked to the promoter and the terminator so that the a-ALDCase gene can be expressed stably in a microorganism, which exists in the microorganism as the plasmid form or the integrated form in the genome. As the promoter and the terminator, known promoters and terminators can be used in a suitable combination.
Polypeptide encoded bY the_~n~
As mentioned above, the DNA strand according to the present invention is specified by the amino acid sequence of the polypeptide encoded thereby. The polypeptide has a-ALDCase activity and has an amino acid sequence which is substantially from A to B of the amino acid sequence shown in Fig. 1. Here, "amino acid sequence which is substantialIy from A to B of the amino acid sequence shown in Fig. 1" indicates that some of the amino acids may be deleted, substituted or added, etc., so long as the peptide has a-ALDCase activity.
A typical polypeptide having a-ALDCase activity in the present invention is from A to B of the amino acid sequence in Fig. 1, consisting of 260 amino acids, which amino acid sequence has not been known in the prior art.
Nucleotide sequence of DNA strand The DNA strand coding for a-ALDCase is one having ; 35 the nucleotide sequence from A to B in Fig. 1 and those having nucleotide seyuences corresponding to the changes in amino acid sequence of a-ALDCase as mentioned above or . .
degenerative isomers thereof. Here, the "degenerative isomer" means a DN~ strand which is different only in degenerative codon and can code for the same polypeptide.
For example, relative to the DNA strand having the nucleotide sequence of A to B in Fig. 1, the DNA chain having a codon corresponding to any one of the amino acids changed from, for example, the codon (AAC) corresponding to Asn at the carboxy terminal end to, for example, AAT which is in degenerative relationship therewith, is called the degenerative isomer in the present invention.
A preferable specific example of the DNA strand according to the present invention has at least one stop codon (e.g. TAA) in contact with the 3'-side end.
lS Further, upstream to the 5'~side and/or downstream to the 3'-side of the DNA strand of the presen.
invention, a DNA strand with a certain length may be continuo~ls as the non-translation region (the initial portion downstream of the 3'-side is ordinarily a stop codon such as TA~).
The nucleotide sequence of the DNA strand shown in Fig. 1 was determined for the gene coding for the a-ALDCase cloned from Enterobacter aeroqenes IFO 13534 according to the Ma~am-Gilbert method and the dideoxy method.
Obtention of DNA strand One means for obtaining the DNA strand having the nucleotide sequence coding for the amino acid sequence of the above a-ALDCase is to synthesize chemically at least a part of the DNA strand according to the method for synthesis of polynucleotide..
In view of the fact that the number of amino acids of a-ALDCase is at least 260, rather than the chemical synthetic method mentioned above, it would be prefera~le to obtain the DNA strand from the genomic library of Enterobacter aeroqenes IFO 13534 according to the method conventionally used in the field of genetic engineering, i2~6 for example, the hybridization method with the use of a suitable probe.
In this invention, the present inventors cloned the DNA strand of the present invention from the above genomi~ library by use of the shot gun method, because the nucleotide sequence coding for the a-ALDCase of Enterobacter aeroqenes IFO 13534 and the amino acid sequence of a-ALDCase were not known (see Examples shown below about its details).
Yeast with reduced in ability to Produce a-acetolactate The DNA strand of the present invention cloned as described above contains the genetic information for making ~-ALDCase, and therefore this can be introduced into the yeast used generally as the yeast for fermentation of alcoholic liquors ISaccharomyces cerevisiae) to transform the yeast, whereby a yeast for ermentation with reduced a-AL producing ability can be obtained.
Yeast The yeast to be transformed in the present invention may be a yeast belonging to Saccharomyces cerevisiae as described in "The ~easts, a Taxonomic Study" third edition (Yarrow, D., ed. by N.J.W. Kreger-Van Rijo Elsevier Science Publishers B.V., Amsterdam (1984), p.379) and its synonym or a mutant, but for the purpose of the present invention, a yeast for fermentation of alcoholic liquors belonging to Saccharomyces cerevisiae, specifically beer yeast, wine yeast, sake yeast, etc., are preferred. Specific examples may include wine yeast:
ATCC 38637, ATCC 38638, beer yeast: ATCC 26292, ATCC
2704, ATCC 32634, sake yeast: ATCC 4134, ATCC 26421, etc.
To further comment on the properties of these yeasts for fermentation, as the result of selection and pure cultivation over long years for the properties suitable for fermentation, namely efficient fermentation of the starting material liquid for fermentation, production of alcoholic liquors with good flavor and stable genetic properties, etc., as the index, they have become polyploids which will undergo geneticall~ cross-segregation with extreme difficulty and have lost spore forming ability substantially completely. For example, in the case of beer yeast practically used, ~hile it is enhanced in the ability to assimilate maltose, maltotriose which are sugar components in the wort, it has lost its wild nature, for example, it is crystal violet sensitive, etc.
Transformation It has been confirmed for the first time by the present inventors that transformation of a yeast with the DNA strand of the present invention resulted in reduction of its a-AL producing ability. However, the procedure or the method itself for preparation of the transformant can be one conventionally employed in the field of molecular biology, bioengineerin~ or genetic engineering, and therefore the present invention may be practiced according to these conventional techniques except for those as described below.
For expression ~f the gene of the DNA strand of the present invention in a yeast, it is first required that the gene should be carried on the plasmid vector existing stably in the yeast. As the plasmid vector to be used in this operation, all of the various kinds known in the art such as YRp, YEp, YCp, YIp, etc., can be used. These plasmid vectors are not only known in iiteratures, but also they can be constructed with ease.
On the other hand, for the gene of the DNA strand of the present invention to be expressed in a yeast, the ~enetic information possessed by the gene is required to be transcribed and translated. For that purpose, as the unit for controlling transcription and translation, a promoter and a terminater may be linked upstream to the ~35 5'-side and downstream to the 3'-side of the DNA strand ;of the present invention, respectively. As such promoter and terminator, various kinds such as ADH, GAPDH, PHO, .
.
~ t~ Z76 g GAL, PGK, ENO, TRP, HIP, etc., have been already known and any of these can be utilized also in the present invention. These are not only known in literatures, but also they can be prepared with ease.
AS the marker for selecting the transformant to be obtained by the present invention, a resistant gene to G418, hygromycin B, a combination of methotrexate and sulfanylamide, tunicamycin, ethionine, compactin, copper ion, etc., can be employed.
For having the DNA strand of the present invention held more stably in a yeast, this can be also integrated into the genome of the yeast. In this case, for making easier integration of the DNA strand of the present invention carried on the plasmid vector into the genome, it is desirable to insert a DNA having high homology with the genome DNA into the plasmid vector, and examples of DNA for this purpose may include rRNA gene, ~O gene, etc.
Among them, it has been known that rRNA gene is repeated tandemly for about 140 times in haploid yeast genome (Journal of Molecular Biology 40, 261-277 (1969)).
Due to this specific feature, when this sequence is utilized as the target sequence for recombination, there are the following advantages as compared with the case when utilizing other gene sequence. l. It is expected that th~ transformation frequency may be elevated. 2.
The change in the corresponding trait o~ the target sequence by recombination may be considered to be negligible. 3~ By use of the plasmid having the structure as shown in Examples (pIARL lin Fig. 3~, it becomes possible to integrate a plural number of foreign genes into the genome by repeating a series of operations of incorporation of plasmid and excision of the vector se~uence.
Also, the DNA strand which can be used for transformation of a yeast in the present invention can also code for a polypeptide different from the polypeptide of A to B shown in Fig. 1, so long as it has a-ALDCase activity, as mentioned previously. Examples of such polypeptide may include the polypeptide of A to B
shown in Fig. 1 to which one or more of amino acids have been inserted or added, from which one or more amino acids have been deleted or substituted with other amino acids, and also a-ALDCase produced by Bacillus licheniformis, Lactobacillus casei, Bacillus brevis, Enterobactor cloacae, Acetobacter bacteria (Ao rancens, A. aceti, etc)etc. Such DNA strands would be readily available by utilizing contemporary genetic engineering techniques.
Transformation of a yeast with the plasmid thus prepared can be done according to any method suited for the purpose conventionally used in the field of genetic engineering or bioengineering, for example, the spheroplast method [proceedings of National Academy of Sciences of the United States of America (Proc. Natl.
Sci. USA), 75, 1929 (1978)~, the lithium acetate method ~Journal of Bacteriology (J. Bacteriol.), 153, 163 (1983)], etc.
The yeast of the present invention thus obtained is the same as the yeast before transformation in its geno type or phenotype except for the new trait according to the genetic information introduced by the DNA strand of the present invention (that is, endowed with a ALDCase producing ability to consequently decompose a-~L within the cell, thereby lowering the amount of a~AL leaked out of the cell), the trait derived from the vector used and the defective corresponding trait due to the defect of a part of the genetic information during recombination of the gene which might have sometimes occurred. Further, the beer yeast obtained by integrating the DNA strand of the present invention into the yeast genome by use of YIp type plasmid, followed by excision of unnecessary vector sequence (see Example t6) shown below about its details~
has no trait derived from the vector employed. Thus, the yeast of the present invention is substantially the same $2~6 as the yeast for fermentation conventionally usedO
Accordingly, the yeast according to the present invention can be used under essentially the same fermentation conditions for the yeast for fermentation of the prior art, besides it has reduced a-AL producing ability in the fermented liquor, and therefore the a-AL content in the fermented liquor is consequently low, whereb~ the aging period of the fermented liquor required for its treatment can be remarkably shortened.
EXPERIMENTAL EXAMPLES
(1) Cloninq of a-ALDCase qene (i) Purification of chromosomal DNA of a-ALDCase producing strain By culturing under aeration Enterobacter aeroqenes IFO 13534 (procured from Institute for Fermentation, Osaka, Japan) in L-medium containing 0.5~ glucose at 37C
for 10 hours, 0.5 9 of wet microorganism cells was obtained.
This was resuspended in 5 ml of saline EDTA buffer [0.15 M NaCl, 0.1 M EDTA (pH 8.0)]. Subsequently, it was treated with 400 ~g/ml of lysozyme (produced by Seikagaku Kogyo), 20 ~g/ml of ribonuclease A (produced by Sigma Co.) at 37C for 20 minutes. Next, it was treated with 0.5% of sodium dodecylsulfate (SDS) and 500 ~g/ml of proteinase K (produced by Sigma Co.) dt 65C for 4 hours.
This was loaded onto a previously prepared sucrose density gradient solution (50 mM tris-HCl ~pH 7.4), 0.1 M
NaCl, 5 mM EDTA, 0c1% SDS, 5~20% sucrose), and subjected to centrifugation by Hitachi Ultra-centrifugal Rotor RPS
27 at 25 krpm at 20C for 3 hours. After fractionation in fractions each of 2.5 ml, the fractions were examined for molecular weight according to 0.4% agarose gel electrophoresis and the ~ractions containing high molecular weight DNA were collected. This was precipitated with ethanol and the precipitate was dissolved in l ml of TE buffer (10 mM tris-HCl (pH B.0), ,, rr~J~
2~
1 mM EDTA) and dialyzed against one liter of TE buffer~
300 ~9 of chromosomal DNA was obtained.
(ii) Preparation oE cosmid library 120 ~9 of the chromosomal DNA obtained in ~i) was partially digested with a restriction enzyme Sau3AI to about 40 kbp. This was loaded onto a previously prepared r ~ sucrose density gradient solution (20 mM tris-HCl (8 0)~
1 M NaC1, 5 mM EDTA, 10~40% sucrose) and subjected to centrifugation by Hitachi Ultra-centrifugal Rotor RPS 27 at 26 krpm at 20C for 22 hours. After fractionation in fractions of each 0.5 ml, the fractions were examined for molecular weight by 0.4% agarose gel electrophoresis and the fractions containing DNA fragments of about 40 kbp were collected. After ethanol precipitation OL the fractions, the precipitate was dissolved in 500 ~l of TE
buffer and dialyzed against one liter of TE buffer.
0.2 ~g of the DNA fragments of about 40 kbp obtained was ligated with 0.3 ~lg oE a cosmid pJB8 Arm ~produced by Amersham International) by T4 ligase. This DNA was in vitro packaged by use of A DNA in v tro packaying kit (produced by Amersham International) and was used to transfect E. coli DHl ~F-, gyrA96, recAl, relAl?, endAl, thi-l, hsdRl7, supE44, A-) [Journal of Molecular Biology (J. Mol. Biol.), 166 557-580 (1983): ATCC 33849] to obtain a cosmid library of E. aeroaenes genome.
(iii) Screaning of a-ALDCase gene holding transductant By selecting transductants exhibiting a-ALDCase activity from the cosmid library obtained in (ii~, a-ALDCase gene holding transductants were obtained.
Specifically, 300 transductants from cosmid library were inoculated one by one onto L-agar medium containing 50 ~g/ml of ampicillin and 0.5~ of glucose, followed by cultivation at 37C for 8 hours, and each culture was assayed for a-A~DCase activity. That is, each transductant was suspended in l ml of 30 mM potassium phosphate buffer (pH 6.2) and vortexed vigorously with addition of lO ul of toluene for 30 seconds. For the ~3$27 cell suspension, a-ALDCase activity was assayed following the method of Godfredsen et al. [Carlsberg. Research Communication (Carlsberg. Res. Commun., 47, 93 (1982)~.
As the result, two a-ALDCase activity holding transductants were obtained. The plasmids of the clones obtained were designated as pCA3 and pCA13, respectively.
(iv) Determination of a-ALDCase gene DNA nucleotide sequence By carrying out subcloning from pCA13, the DNA
fragment of 1.4kbp excised with restriction enzymes BamHI
and EcoRV was turned out to code for u-ALDCase. To the EcoRV cleavage site was ligated HindIII linker (dCAAGCTTG: produced by Takara Shuzo Co., Japan), and the ligated product was inserted between the cleavage sites of Bam~I and HindIII of a plasmid pUC9 (produced by Pharmacia Co.) to construct a plasmid, which was designated as pUAR5.
For the BamHI-EcoRV fragment, DNA nucleotide sequence was determined according to the dideoxy [Proc.
Natl. Acad. Sci. USA, 74, 5463 (1977)] and the Maxam-Gilbert method [Proc. Natl. Acad. Sci. USA, 74, 560 (1977)] (Fig. 1). As the result of analysis of this nucleotide sequence, an open reading frame oE 780bp wa~
found to exist. Here, it may be estimated that a protein having 260 amino acids and a molecular weight of 29000 is encoded, and the molecular weight was found to be substantially coincident with the above molecular weight of a-ALDCase.
(2) Introduction of a-ALDCase qene into yeast (i) Construction of ADHl promoter From Saccharomyces cerevisiae 5288C [(ar suc2r mal, gal2, CUP1): Biochemical and Biophysical Research Communications (Biochem. Biophys. Res. Commun.), 50, 18S-191 (1973): ATCC26108], chromosomal DNA was prepared according to a conventional method. According to the same method as described in Example (1) (ii), a DNA
fragment of about 10 kbp was obtained by partial .
7~
1~
digestion with the restriction enzyme Sau3AI. This was ligated with pBR322 cleaved with the restriction enzyme BamHI by T4 ligase to construct a genomic library. The synthetic oligomer corresponding to the nucleotide sequence from the seventh to the 36th in the coding region of ADHl gene [Journal of Biological Chemistry (J.
B. C.) 257, 3018 (1982)] was end-labelled with 32p and by use of this as probe, ADHl gene was cloned from the genomic library. Further 7 this was cleaved with restriction enzymes SphI and Sau3AI to obtain a DNA
fragment of 542 bp containing the promoter and a part of the coding region of the ADHl gene. By treating the Sau3AI end of this fragment with an endonuclease Bal31 to have the coding region completely lost, and thereafter HindIII linker (dCAAGCTTG: produced by Takara Shuzo Co., Japan) was ligated therewith. This DNA fragment was used as ADHl promoter.
(ii) Construction of expression vector and introduction into yeast By using basically the plasmid YEpl3 (Gene, 8, 121 (1979): ATCC37115~, an expression vector was constructed according to the following procedure.
First, SalI-SacI fragment and XhoI-SmaI fragment existing on both ends of the LEU2 gene of YEpl3 were removed. By this, the plasmi~became to have no cleavage site of the restriction enzymes XhoI, SacI, SmaI and BglII, but have only one cleavage site of the restriction enzyme SalI. Next, between the HindIII site derived from pBR322 and the HindIII site derived from 2 ~m DNA in the plasmid, the synthetic oligonucleotide 41 mer was inserted. The synthetic oligonucleotide has the following nucleotide sequence containing the cleavage site of the restriction enzymes SacI, SmaI, BglII and XhoI. In the present invention, this plasmid was designated as YEpl3K.
.
..
~9~276 AGCTTATGATTACGAGCTCCCGGGCAGATCTCGGCCTCGAG
ATACTAATGCTCGAGGGCCCGTCTAGAGCCGGAGCTCTCGA
Next, the SphI-~indIII fragment of YEpl3K was substituted with the ADHl promoter prepared in (i) to construct an expression plasmid vector pAK503.
The plasmid pUAR5 having the a-ALDCase gene fragment obtained in (1) (iv) was cleaved with the restriction enzyme HincII and after addition of HindIII linker (dCAAGCTTG~ produced by Takara Shuzo Co., Japan), cleaved with the restriction enzymes HindIII and BamHI. The HindIII-BglII fragment of pAK503 was replaced with the a-ALDCase gene fragment of 940 bp obtained to construct a plasmid pAL503.
Further, pUC-4K (produced by Pharmacia Co.) containing the G418 resistant gene was cleaved with the restriction enzyme SalI, and the fragment containing the G418 resistant gene obtained was inserted at the SalI
site of pAL503 to construct the desired plasmid pALG5034 tFi9. 2).
When pALG5034 was introduced into yeast [TD4 (a, his, ura, leu, trp; a mutant strain of Saccharomyces cerevisiae S288C and beer yeast IF0 0751 strain]
according to the lithium acetate method [Journal of Bacteriology (J. Bacteriol.) 153, 163, (1983)], a-ALDCase activities of 1.9-3.3. U/mg protein and 1.8-3.5 V/mg protein were exhibited, respectively.
The IFO 0751 transformed with pALG5034 is called SKB101 and the TD4 strain containing pALG5034 is called SKB102.
The a-ALDCase gene has three ATG's which is the translation initiation codon continuously at its 5'-end of the coding region. After removing one or two of the three ATG's from the 5'-side by treatment with endonuclease Bal31 from the HincII site of the 5'-side of the a-ALDCase gene fragment, the genetic information of the obtained fragments was expressed within the yeast TD4 to see the effect on the activity. As the result, no great difference in enzyme activity of the ALDCase obtained was recognized.
Accordingly, the "DNA strand" as mentioned in the present invention is inclusive, in addition to the DNA strand of a specific length (the length of A-B in terms of the correspond-ing amino acid sequence in Fig. 1), of ;2~6 those in the form of a linear DNA or a circular DNA
strand containing the DNA strand of the specific length.
Of the existing forms of the DNA strand according to the present invention, typical are the plasmid form containing the DNA strand as a part of the constituent and the form existing in a microorganism, particularly E.
coli and yeast, as the plasmid form or the integrated form in the genome.
The preferable existing form of the DNA strand according to the present invention comprises the DNA
strand of the present invention as a foreign gene linked to the promoter and the terminator so that the a-ALDCase gene can be expressed stably in a microorganism, which exists in the microorganism as the plasmid form or the integrated form in the genome. As the promoter and the terminator, known promoters and terminators can be used in a suitable combination.
Polypeptide encoded bY the_~n~
As mentioned above, the DNA strand according to the present invention is specified by the amino acid sequence of the polypeptide encoded thereby. The polypeptide has a-ALDCase activity and has an amino acid sequence which is substantially from A to B of the amino acid sequence shown in Fig. 1. Here, "amino acid sequence which is substantialIy from A to B of the amino acid sequence shown in Fig. 1" indicates that some of the amino acids may be deleted, substituted or added, etc., so long as the peptide has a-ALDCase activity.
A typical polypeptide having a-ALDCase activity in the present invention is from A to B of the amino acid sequence in Fig. 1, consisting of 260 amino acids, which amino acid sequence has not been known in the prior art.
Nucleotide sequence of DNA strand The DNA strand coding for a-ALDCase is one having ; 35 the nucleotide sequence from A to B in Fig. 1 and those having nucleotide seyuences corresponding to the changes in amino acid sequence of a-ALDCase as mentioned above or . .
degenerative isomers thereof. Here, the "degenerative isomer" means a DN~ strand which is different only in degenerative codon and can code for the same polypeptide.
For example, relative to the DNA strand having the nucleotide sequence of A to B in Fig. 1, the DNA chain having a codon corresponding to any one of the amino acids changed from, for example, the codon (AAC) corresponding to Asn at the carboxy terminal end to, for example, AAT which is in degenerative relationship therewith, is called the degenerative isomer in the present invention.
A preferable specific example of the DNA strand according to the present invention has at least one stop codon (e.g. TAA) in contact with the 3'-side end.
lS Further, upstream to the 5'~side and/or downstream to the 3'-side of the DNA strand of the presen.
invention, a DNA strand with a certain length may be continuo~ls as the non-translation region (the initial portion downstream of the 3'-side is ordinarily a stop codon such as TA~).
The nucleotide sequence of the DNA strand shown in Fig. 1 was determined for the gene coding for the a-ALDCase cloned from Enterobacter aeroqenes IFO 13534 according to the Ma~am-Gilbert method and the dideoxy method.
Obtention of DNA strand One means for obtaining the DNA strand having the nucleotide sequence coding for the amino acid sequence of the above a-ALDCase is to synthesize chemically at least a part of the DNA strand according to the method for synthesis of polynucleotide..
In view of the fact that the number of amino acids of a-ALDCase is at least 260, rather than the chemical synthetic method mentioned above, it would be prefera~le to obtain the DNA strand from the genomic library of Enterobacter aeroqenes IFO 13534 according to the method conventionally used in the field of genetic engineering, i2~6 for example, the hybridization method with the use of a suitable probe.
In this invention, the present inventors cloned the DNA strand of the present invention from the above genomi~ library by use of the shot gun method, because the nucleotide sequence coding for the a-ALDCase of Enterobacter aeroqenes IFO 13534 and the amino acid sequence of a-ALDCase were not known (see Examples shown below about its details).
Yeast with reduced in ability to Produce a-acetolactate The DNA strand of the present invention cloned as described above contains the genetic information for making ~-ALDCase, and therefore this can be introduced into the yeast used generally as the yeast for fermentation of alcoholic liquors ISaccharomyces cerevisiae) to transform the yeast, whereby a yeast for ermentation with reduced a-AL producing ability can be obtained.
Yeast The yeast to be transformed in the present invention may be a yeast belonging to Saccharomyces cerevisiae as described in "The ~easts, a Taxonomic Study" third edition (Yarrow, D., ed. by N.J.W. Kreger-Van Rijo Elsevier Science Publishers B.V., Amsterdam (1984), p.379) and its synonym or a mutant, but for the purpose of the present invention, a yeast for fermentation of alcoholic liquors belonging to Saccharomyces cerevisiae, specifically beer yeast, wine yeast, sake yeast, etc., are preferred. Specific examples may include wine yeast:
ATCC 38637, ATCC 38638, beer yeast: ATCC 26292, ATCC
2704, ATCC 32634, sake yeast: ATCC 4134, ATCC 26421, etc.
To further comment on the properties of these yeasts for fermentation, as the result of selection and pure cultivation over long years for the properties suitable for fermentation, namely efficient fermentation of the starting material liquid for fermentation, production of alcoholic liquors with good flavor and stable genetic properties, etc., as the index, they have become polyploids which will undergo geneticall~ cross-segregation with extreme difficulty and have lost spore forming ability substantially completely. For example, in the case of beer yeast practically used, ~hile it is enhanced in the ability to assimilate maltose, maltotriose which are sugar components in the wort, it has lost its wild nature, for example, it is crystal violet sensitive, etc.
Transformation It has been confirmed for the first time by the present inventors that transformation of a yeast with the DNA strand of the present invention resulted in reduction of its a-AL producing ability. However, the procedure or the method itself for preparation of the transformant can be one conventionally employed in the field of molecular biology, bioengineerin~ or genetic engineering, and therefore the present invention may be practiced according to these conventional techniques except for those as described below.
For expression ~f the gene of the DNA strand of the present invention in a yeast, it is first required that the gene should be carried on the plasmid vector existing stably in the yeast. As the plasmid vector to be used in this operation, all of the various kinds known in the art such as YRp, YEp, YCp, YIp, etc., can be used. These plasmid vectors are not only known in iiteratures, but also they can be constructed with ease.
On the other hand, for the gene of the DNA strand of the present invention to be expressed in a yeast, the ~enetic information possessed by the gene is required to be transcribed and translated. For that purpose, as the unit for controlling transcription and translation, a promoter and a terminater may be linked upstream to the ~35 5'-side and downstream to the 3'-side of the DNA strand ;of the present invention, respectively. As such promoter and terminator, various kinds such as ADH, GAPDH, PHO, .
.
~ t~ Z76 g GAL, PGK, ENO, TRP, HIP, etc., have been already known and any of these can be utilized also in the present invention. These are not only known in literatures, but also they can be prepared with ease.
AS the marker for selecting the transformant to be obtained by the present invention, a resistant gene to G418, hygromycin B, a combination of methotrexate and sulfanylamide, tunicamycin, ethionine, compactin, copper ion, etc., can be employed.
For having the DNA strand of the present invention held more stably in a yeast, this can be also integrated into the genome of the yeast. In this case, for making easier integration of the DNA strand of the present invention carried on the plasmid vector into the genome, it is desirable to insert a DNA having high homology with the genome DNA into the plasmid vector, and examples of DNA for this purpose may include rRNA gene, ~O gene, etc.
Among them, it has been known that rRNA gene is repeated tandemly for about 140 times in haploid yeast genome (Journal of Molecular Biology 40, 261-277 (1969)).
Due to this specific feature, when this sequence is utilized as the target sequence for recombination, there are the following advantages as compared with the case when utilizing other gene sequence. l. It is expected that th~ transformation frequency may be elevated. 2.
The change in the corresponding trait o~ the target sequence by recombination may be considered to be negligible. 3~ By use of the plasmid having the structure as shown in Examples (pIARL lin Fig. 3~, it becomes possible to integrate a plural number of foreign genes into the genome by repeating a series of operations of incorporation of plasmid and excision of the vector se~uence.
Also, the DNA strand which can be used for transformation of a yeast in the present invention can also code for a polypeptide different from the polypeptide of A to B shown in Fig. 1, so long as it has a-ALDCase activity, as mentioned previously. Examples of such polypeptide may include the polypeptide of A to B
shown in Fig. 1 to which one or more of amino acids have been inserted or added, from which one or more amino acids have been deleted or substituted with other amino acids, and also a-ALDCase produced by Bacillus licheniformis, Lactobacillus casei, Bacillus brevis, Enterobactor cloacae, Acetobacter bacteria (Ao rancens, A. aceti, etc)etc. Such DNA strands would be readily available by utilizing contemporary genetic engineering techniques.
Transformation of a yeast with the plasmid thus prepared can be done according to any method suited for the purpose conventionally used in the field of genetic engineering or bioengineering, for example, the spheroplast method [proceedings of National Academy of Sciences of the United States of America (Proc. Natl.
Sci. USA), 75, 1929 (1978)~, the lithium acetate method ~Journal of Bacteriology (J. Bacteriol.), 153, 163 (1983)], etc.
The yeast of the present invention thus obtained is the same as the yeast before transformation in its geno type or phenotype except for the new trait according to the genetic information introduced by the DNA strand of the present invention (that is, endowed with a ALDCase producing ability to consequently decompose a-~L within the cell, thereby lowering the amount of a~AL leaked out of the cell), the trait derived from the vector used and the defective corresponding trait due to the defect of a part of the genetic information during recombination of the gene which might have sometimes occurred. Further, the beer yeast obtained by integrating the DNA strand of the present invention into the yeast genome by use of YIp type plasmid, followed by excision of unnecessary vector sequence (see Example t6) shown below about its details~
has no trait derived from the vector employed. Thus, the yeast of the present invention is substantially the same $2~6 as the yeast for fermentation conventionally usedO
Accordingly, the yeast according to the present invention can be used under essentially the same fermentation conditions for the yeast for fermentation of the prior art, besides it has reduced a-AL producing ability in the fermented liquor, and therefore the a-AL content in the fermented liquor is consequently low, whereb~ the aging period of the fermented liquor required for its treatment can be remarkably shortened.
EXPERIMENTAL EXAMPLES
(1) Cloninq of a-ALDCase qene (i) Purification of chromosomal DNA of a-ALDCase producing strain By culturing under aeration Enterobacter aeroqenes IFO 13534 (procured from Institute for Fermentation, Osaka, Japan) in L-medium containing 0.5~ glucose at 37C
for 10 hours, 0.5 9 of wet microorganism cells was obtained.
This was resuspended in 5 ml of saline EDTA buffer [0.15 M NaCl, 0.1 M EDTA (pH 8.0)]. Subsequently, it was treated with 400 ~g/ml of lysozyme (produced by Seikagaku Kogyo), 20 ~g/ml of ribonuclease A (produced by Sigma Co.) at 37C for 20 minutes. Next, it was treated with 0.5% of sodium dodecylsulfate (SDS) and 500 ~g/ml of proteinase K (produced by Sigma Co.) dt 65C for 4 hours.
This was loaded onto a previously prepared sucrose density gradient solution (50 mM tris-HCl ~pH 7.4), 0.1 M
NaCl, 5 mM EDTA, 0c1% SDS, 5~20% sucrose), and subjected to centrifugation by Hitachi Ultra-centrifugal Rotor RPS
27 at 25 krpm at 20C for 3 hours. After fractionation in fractions each of 2.5 ml, the fractions were examined for molecular weight according to 0.4% agarose gel electrophoresis and the ~ractions containing high molecular weight DNA were collected. This was precipitated with ethanol and the precipitate was dissolved in l ml of TE buffer (10 mM tris-HCl (pH B.0), ,, rr~J~
2~
1 mM EDTA) and dialyzed against one liter of TE buffer~
300 ~9 of chromosomal DNA was obtained.
(ii) Preparation oE cosmid library 120 ~9 of the chromosomal DNA obtained in ~i) was partially digested with a restriction enzyme Sau3AI to about 40 kbp. This was loaded onto a previously prepared r ~ sucrose density gradient solution (20 mM tris-HCl (8 0)~
1 M NaC1, 5 mM EDTA, 10~40% sucrose) and subjected to centrifugation by Hitachi Ultra-centrifugal Rotor RPS 27 at 26 krpm at 20C for 22 hours. After fractionation in fractions of each 0.5 ml, the fractions were examined for molecular weight by 0.4% agarose gel electrophoresis and the fractions containing DNA fragments of about 40 kbp were collected. After ethanol precipitation OL the fractions, the precipitate was dissolved in 500 ~l of TE
buffer and dialyzed against one liter of TE buffer.
0.2 ~g of the DNA fragments of about 40 kbp obtained was ligated with 0.3 ~lg oE a cosmid pJB8 Arm ~produced by Amersham International) by T4 ligase. This DNA was in vitro packaged by use of A DNA in v tro packaying kit (produced by Amersham International) and was used to transfect E. coli DHl ~F-, gyrA96, recAl, relAl?, endAl, thi-l, hsdRl7, supE44, A-) [Journal of Molecular Biology (J. Mol. Biol.), 166 557-580 (1983): ATCC 33849] to obtain a cosmid library of E. aeroaenes genome.
(iii) Screaning of a-ALDCase gene holding transductant By selecting transductants exhibiting a-ALDCase activity from the cosmid library obtained in (ii~, a-ALDCase gene holding transductants were obtained.
Specifically, 300 transductants from cosmid library were inoculated one by one onto L-agar medium containing 50 ~g/ml of ampicillin and 0.5~ of glucose, followed by cultivation at 37C for 8 hours, and each culture was assayed for a-A~DCase activity. That is, each transductant was suspended in l ml of 30 mM potassium phosphate buffer (pH 6.2) and vortexed vigorously with addition of lO ul of toluene for 30 seconds. For the ~3$27 cell suspension, a-ALDCase activity was assayed following the method of Godfredsen et al. [Carlsberg. Research Communication (Carlsberg. Res. Commun., 47, 93 (1982)~.
As the result, two a-ALDCase activity holding transductants were obtained. The plasmids of the clones obtained were designated as pCA3 and pCA13, respectively.
(iv) Determination of a-ALDCase gene DNA nucleotide sequence By carrying out subcloning from pCA13, the DNA
fragment of 1.4kbp excised with restriction enzymes BamHI
and EcoRV was turned out to code for u-ALDCase. To the EcoRV cleavage site was ligated HindIII linker (dCAAGCTTG: produced by Takara Shuzo Co., Japan), and the ligated product was inserted between the cleavage sites of Bam~I and HindIII of a plasmid pUC9 (produced by Pharmacia Co.) to construct a plasmid, which was designated as pUAR5.
For the BamHI-EcoRV fragment, DNA nucleotide sequence was determined according to the dideoxy [Proc.
Natl. Acad. Sci. USA, 74, 5463 (1977)] and the Maxam-Gilbert method [Proc. Natl. Acad. Sci. USA, 74, 560 (1977)] (Fig. 1). As the result of analysis of this nucleotide sequence, an open reading frame oE 780bp wa~
found to exist. Here, it may be estimated that a protein having 260 amino acids and a molecular weight of 29000 is encoded, and the molecular weight was found to be substantially coincident with the above molecular weight of a-ALDCase.
(2) Introduction of a-ALDCase qene into yeast (i) Construction of ADHl promoter From Saccharomyces cerevisiae 5288C [(ar suc2r mal, gal2, CUP1): Biochemical and Biophysical Research Communications (Biochem. Biophys. Res. Commun.), 50, 18S-191 (1973): ATCC26108], chromosomal DNA was prepared according to a conventional method. According to the same method as described in Example (1) (ii), a DNA
fragment of about 10 kbp was obtained by partial .
7~
1~
digestion with the restriction enzyme Sau3AI. This was ligated with pBR322 cleaved with the restriction enzyme BamHI by T4 ligase to construct a genomic library. The synthetic oligomer corresponding to the nucleotide sequence from the seventh to the 36th in the coding region of ADHl gene [Journal of Biological Chemistry (J.
B. C.) 257, 3018 (1982)] was end-labelled with 32p and by use of this as probe, ADHl gene was cloned from the genomic library. Further 7 this was cleaved with restriction enzymes SphI and Sau3AI to obtain a DNA
fragment of 542 bp containing the promoter and a part of the coding region of the ADHl gene. By treating the Sau3AI end of this fragment with an endonuclease Bal31 to have the coding region completely lost, and thereafter HindIII linker (dCAAGCTTG: produced by Takara Shuzo Co., Japan) was ligated therewith. This DNA fragment was used as ADHl promoter.
(ii) Construction of expression vector and introduction into yeast By using basically the plasmid YEpl3 (Gene, 8, 121 (1979): ATCC37115~, an expression vector was constructed according to the following procedure.
First, SalI-SacI fragment and XhoI-SmaI fragment existing on both ends of the LEU2 gene of YEpl3 were removed. By this, the plasmi~became to have no cleavage site of the restriction enzymes XhoI, SacI, SmaI and BglII, but have only one cleavage site of the restriction enzyme SalI. Next, between the HindIII site derived from pBR322 and the HindIII site derived from 2 ~m DNA in the plasmid, the synthetic oligonucleotide 41 mer was inserted. The synthetic oligonucleotide has the following nucleotide sequence containing the cleavage site of the restriction enzymes SacI, SmaI, BglII and XhoI. In the present invention, this plasmid was designated as YEpl3K.
.
..
~9~276 AGCTTATGATTACGAGCTCCCGGGCAGATCTCGGCCTCGAG
ATACTAATGCTCGAGGGCCCGTCTAGAGCCGGAGCTCTCGA
Next, the SphI-~indIII fragment of YEpl3K was substituted with the ADHl promoter prepared in (i) to construct an expression plasmid vector pAK503.
The plasmid pUAR5 having the a-ALDCase gene fragment obtained in (1) (iv) was cleaved with the restriction enzyme HincII and after addition of HindIII linker (dCAAGCTTG~ produced by Takara Shuzo Co., Japan), cleaved with the restriction enzymes HindIII and BamHI. The HindIII-BglII fragment of pAK503 was replaced with the a-ALDCase gene fragment of 940 bp obtained to construct a plasmid pAL503.
Further, pUC-4K (produced by Pharmacia Co.) containing the G418 resistant gene was cleaved with the restriction enzyme SalI, and the fragment containing the G418 resistant gene obtained was inserted at the SalI
site of pAL503 to construct the desired plasmid pALG5034 tFi9. 2).
When pALG5034 was introduced into yeast [TD4 (a, his, ura, leu, trp; a mutant strain of Saccharomyces cerevisiae S288C and beer yeast IF0 0751 strain]
according to the lithium acetate method [Journal of Bacteriology (J. Bacteriol.) 153, 163, (1983)], a-ALDCase activities of 1.9-3.3. U/mg protein and 1.8-3.5 V/mg protein were exhibited, respectively.
The IFO 0751 transformed with pALG5034 is called SKB101 and the TD4 strain containing pALG5034 is called SKB102.
The a-ALDCase gene has three ATG's which is the translation initiation codon continuously at its 5'-end of the coding region. After removing one or two of the three ATG's from the 5'-side by treatment with endonuclease Bal31 from the HincII site of the 5'-side of the a-ALDCase gene fragment, the genetic information of the obtained fragments was expressed within the yeast TD4 to see the effect on the activity. As the result, no great difference in enzyme activity of the ALDCase obtained was recognized.
(3) Fermentation test ~Confirmation of reduction in amount of diacetyl produced) Fermentation tests were conducted for the two kinds of yeasts of the TD4 and the IFO 0751 into which a-ALDCase gene had been introduced as described in t2)-(ii), and reduction of the amounts of the total diacetyl (hereinafter called TDA: TDA consists of vicinal diketones and acetohydroxy acids, mainly DA and its precursor a-AL) in the fermented wort by these transformed yeasts was confirmed according to the following method.
(i) Obtention of a-ALDCase producing yeast cells The two kinds of yeasts transformed with pALG5034 as described above (SKBl01 and SKBl02) and the respective host yeasts (IFO 0751 and TD4) were cultured in YPD
medium. For the strains having introduced pALG5034, G418 was added into the medium to 600 ~g/ml.
The respective cells grown by shaking cultivation at 30C for 16 hours were collected by centrifugation at 3000 x q for 10 minutes, washed with distilled water and then provided for fermentation test.
(ii) Fermentation test To a wort prepared to 11 P was added the yeast obtained in (i) to a yeast addition ratio of 0.5~ (wet.
w/v) and, after sufficient aeration, stationary fermentation was carried out at 8C for 7 days. After completion of fermentation, the cells were removed by centrifugation at 3000 x q for 10 minutes and filtration, and the filtrate was subjected to measurement of amount TDA (total diacetyl amount).
The results were as shown in the following Table.
In fermentation by use of the yeast of the present invention, it can be seen that TDA amount in the fermentted yeast is reduced to a great extent as compared $~
with control strains.
~: , :
: : :
~ 35 `
. ~.
~_t~J~ ~76 The in amount of total diacetyl (TDA) in the fermented wort Strain ~ (mg/liter) TD4 (9 0.26 (~ 0.30 AYerage 0.28 TD4 + pALG5034 (D 0.03 (SKB 10~) ~ 0.05 l O Ave~age 0.04 _ IFO0751 q) 0.28 0.28 (~) 0.32 Avera~e 0.29 IFO 0751 + pALG5034 (D <0.04 15(SKB 101) (~3 0 07 Average < 0.06 t4) Construction of inteqration_type ~lasmid (i) Structure and characteristic of plasmid pIARLl In order to have the a-ALDCase gene held stably within the yeast, a plasmid pIARLl having no autovomously replicating ability which can be held by the yeast only through integration into the genome was constructed. The plasmid has the G418 resistant gene and the ~-galactosidase gene as the markers within yeast and also has rRNA gene sequence as the sequence necessary for the plasmid to be integrated into the genomeDNA by homologous recombination. The u-ALDCase gene is rRNA gene sequence sandwiched between the ADHl promoter at 5'-end and HIPl terminatorat 3'- end, and the combined fragment is inserted in the rRNA gene sequence. The plasmid, in order to be integrated efficiently into the rRNA gene on the chromosome, is cleaved previously at the KpnI site within the rRNA gene sequence before used for transformation. As the result, in the transformant obtained, the rRNA gene sequence derived from the plasmid ~ ~62~
exists next to that existing originally in the chromosome. Accordingly, when the transformant is grown in a complete medium, spontaneous recombination between the two rRNA gene sequences occurs, whereby G418 sensitive, Lac~ cells will appearO ~ part of these will exhibit a-ALDCase activity, and only ADH1 promoter, a-ALDCase gene and HIPl terminator remain on the chromosome in these microorganisms, with other vector portions being excised.
(ii) Construction of pIARLl The pIARLl was constructed from a yeast integrating plasmid YIp5 (Prot. Natl, Acad. Sci. USA 76r 1035-1039 (1979))-First, the G418 resistant gene fragment prepared after cleavage of pUC4R ~produced by Pharmacia) with SalIwas inserted at the SalI site of YIp5 to construct a plasmid pIG7.
Subsequentlyr as HIPl gene promoter + lacZ gene fragmentr the BglII-BamHI fragment compristing the BamHI
fragment containing the lac Z gene from the plasmid pMC1871 (produced by Pharmacia) linked to the BglII
fragment containing about 0.6 kb of the 5'-non translation region and 0.4 kb of the translation region of the yeast HIPl gene (Gener 38, 205-214 (1985)) was inserted at the BamHI site of pIG7 to construct plasmid pILG2.
The rRNA gene was cloned from the library used for cloning of the ADHl yene by use of a 5' end-labelled oligomer correspondîng to the nucleotide of the 4 to 32nd from the 5'-end of the 5,8SrRNA gene (J.B.C. 252r 8118-8125 (1977)). And ther EcoRI fragment of about 3 kb containing a part of each of 5.BSrRNA gene and 25SrRNA
gene was introduced at the EcoRI site derived from pBR322 of pILG2 to construct a plasmid pIRL9.
ADHl promoter + a-ALDCase gene + HIPl terminator fragment was obtained according to the method shown below.
~2~o2~6 After cleavage of the plasmid pUAR5 having a-ALDCase gene with HincII, the frayment was treated with Bal31 and ligated to HindIII linker, and thereafter cleaved with HindIII and BamHI. The a-ALDCase gene fragment obtained 5 was inserted between the BamHI and the HindIII sites of pUC12 (produced by Pharmacia Co.), and the nucleotide sequence was determined to obtain a plasmid pALDC3 having about 40 bp upstream of 5'-end and the initial ATG of a-ALDCase gene deleted. The pALDC3 was digested with BamHI
10 and made to have a blunt end with klenow fragment and then the HindIII-SmaI fragment of pAK503 was substituted with the a-ALDC gene fragment obtained by HindIII
digestion to construct a plasmid pAL503-3. Further, the SphI site of the pAL503-3 was digested with SphI and then converted to the BamHI site by Sl nuclease treatment and BamHI linker addition, and thereafter ADHI promoter + a-ALDCase gene fragment was obtained as BamHI-BalII
fragment.
On the other hand, the plasmid where the BamHI-SalI
fragment of pBR322 was substituted with the BamHI-SalI
fragment haviny about 0.9 kbp of the 3'-end non-translation region and about 0.1 kb of the 3' translation region of the HIP] gene was constructed and the above ADHI promoter -~ a-ALDCase gene fragment was inserted at the BamHI csite of this plasmid to construct a plasmid pALT18 in which ADHl promoter + a-ALDCase gene + HIPl terminater are linked in this order mentioned.
The ADHl promoter ~ a-ALDCase gene + HIPl terminator fragment, obtained as the BarmHI fragment after digestion 30 of pALT18 with SalI and subsequent treatment with klenow fragment, addition oE BamHI linker and BamHI digestion was inserted at the BglII site of pIRL~ to construct the desired plasmid pIARLI.
(5) Introduction of PIARLl into yeast and expression of ~-ALDCase By use of the pIARL1 constructed as described above, yeast was transformed as follows. Beer yeast IFO0751 ~_ t~ $~
strain was cultured in YPD medium at 30C to OD600 = l.0, and the microorganism cells were collec~ed and transformed with pIARLl according to the lithium acetate method. For promoting recombination in the rRNA gene 5 sequence, pIARLl was completely digested at the KpnI
within the rRNA gene sequence to be made linear before transformation. ~fter transformation, 108 of the of the yeast cells were suspended in l ml of YPD medium and shaked at 30C for 18 hours, and the culture was then lO spreaded onto YPD agar medium containing an antibiotic G418 ~500 ~g/m). Subsequently, the plate was incubated at 30C for 3 to 5 days to obtain colonies. In these colonies, in addition to the transformed cells, cells having acquired G418 resistance independently on pIARLl 15 were contained, and therefore they were transferred with a toothpick onto the agar medium containing X-gal (51_ bromo-4'-chloro-3'-indoyl-~-D galactoside) of Ruby et al ~Method in Enzymology, vol. lOl, p. 253 ~1983)) and incubated at 30C for 2 to 5 days. Those which color 20 formed blue colony on this plate by ~-galactosidase activity ~Lac~ strain) were judged to be transformants.
Such cells all exhibited ~-~LDCase activity of 0.8-l.8U/mg protein. The transformant exhibiting the highest a-ALDCase activity ~SKBl03 strain) was cultured in YPD
25 medium non-selectively for ~0 generations. The a-ALDCase activity after cultivation was found to be 0.9 U/mg protein, indicating that the gene exhibiting a-ALDCase activity was stably held in the chromosome.
(6) Excision of undesired sequence and expression of a-ALDCase qene After non-selective cultivation of the transformant obtained in 15) (SKBl03 strain) in YPD medium for 20 to 30 generations, the culture broth was adequately diluted and spreaded onto the agar medium containing X-gal of 35 Ruby et al as described above. The plate was cultured at 30C for 5 to 7 days, and the strain without blue color formation (Lac~ strain) were selected. Of these str~ins, , ~
2~6 those exhibiting G418 sensitivity on YPD agar medium ~ontaining 500 ~g/ml G418 were selected. Further, strains exhibiting a-ALDCase activity were obtained. In these strains, as shown in (4)-(i), it may be considered 5 that, recombination occurred between the duplicated rRNA
gene sequences, whereby only ADHl promoter, a-ALDCase gene and HIPl terminator remain on the chromosome, with other vector portions being excised..
Of these strains, the strain exhibiting a-ALDCase lO activity of 0.2 U/mg protein (SKBl04 strain) was cultured in YPD medium for 40 generations and activity of 80~ or more was maintained.
(7) Fermentation test Fermentation tests were conducted for the SKBl03 15 strain obtained in (5~ and the SKBl04 strain obtained in (6), and reduction of TDA in fermented wort was confirmed according to the following method. Two kinds of yeasts were subjected to stationary cultivation non selectively in YPD medium at 20C for 3 days andsubsequently at 10C
20 for lO days, and the respective cells were collected by I centrifugation at 3000 x q for 10 minutes, washed with distilled water and then provided for fermentation test.
To a wort ad~usted to ll P was added the yeast to a yeast addition ratio of 0.6~ (wet. w/v) and, after 25 sufficient aeration, stationary fermentation was carried out at 10C for 8 to lO days. After completion of fermentation, cells were removed by centrifugation at 3000 x q for 10 minutes and filtration, and the filtrate was subjected to measurement of amount of TDA and 30 apparent extract. The results were as shown in the following Tables. Although both cultivation and fermentation were conducted under non-selective conditions, marked decrease in amount of TDA in fermented wort was seen as compared with control strain, thus 35 indicating that a-ALDCase activity was stably exhibited.
. .
7~i Results of fermentation test of SKB103 strain TDA Apparent Strain (mg/liter) extract IFO 0751 (~ 0.68 2.4 ~ 0.69 2.2 Average 0.69 2.3 SKB 103 ~) 0.14 2.7 (~) 0.14 2.9 Average 0.14 2.8 Results of fermentation test of SKB104 strain _ . TDA Apparent Strain (mg/liter) extract IFO 0751 (~) 1.02 2.3 @~ 0.94 2.2 20~verage 0.98 2.3 SKB 104 (i) 0.44 2.2 @~ 0.51 2.0 ~vernge 0 48 2.1 Deposition of microorqanism The microorganisms shown below related to the present invention have been deposited at the Institute of Fermentation Research, Agency of Industrial Science &
Technology, Ministry of International Trade and Industry under the following deposition numbers under the Budapest 3 Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure.
(1) SKB101 (containing pALG5034 ) . . . FERM-BP No . 1228 (2) SKB102 (containing pALGS034 j . . . FERM-BP No. 1229 Both of (l)~and (2) were deposited on December 11, 1985.
(3) SKB104 ... FERM-BP No. 1227 (3) was deposited on December 2, 1986.
(i) Obtention of a-ALDCase producing yeast cells The two kinds of yeasts transformed with pALG5034 as described above (SKBl01 and SKBl02) and the respective host yeasts (IFO 0751 and TD4) were cultured in YPD
medium. For the strains having introduced pALG5034, G418 was added into the medium to 600 ~g/ml.
The respective cells grown by shaking cultivation at 30C for 16 hours were collected by centrifugation at 3000 x q for 10 minutes, washed with distilled water and then provided for fermentation test.
(ii) Fermentation test To a wort prepared to 11 P was added the yeast obtained in (i) to a yeast addition ratio of 0.5~ (wet.
w/v) and, after sufficient aeration, stationary fermentation was carried out at 8C for 7 days. After completion of fermentation, the cells were removed by centrifugation at 3000 x q for 10 minutes and filtration, and the filtrate was subjected to measurement of amount TDA (total diacetyl amount).
The results were as shown in the following Table.
In fermentation by use of the yeast of the present invention, it can be seen that TDA amount in the fermentted yeast is reduced to a great extent as compared $~
with control strains.
~: , :
: : :
~ 35 `
. ~.
~_t~J~ ~76 The in amount of total diacetyl (TDA) in the fermented wort Strain ~ (mg/liter) TD4 (9 0.26 (~ 0.30 AYerage 0.28 TD4 + pALG5034 (D 0.03 (SKB 10~) ~ 0.05 l O Ave~age 0.04 _ IFO0751 q) 0.28 0.28 (~) 0.32 Avera~e 0.29 IFO 0751 + pALG5034 (D <0.04 15(SKB 101) (~3 0 07 Average < 0.06 t4) Construction of inteqration_type ~lasmid (i) Structure and characteristic of plasmid pIARLl In order to have the a-ALDCase gene held stably within the yeast, a plasmid pIARLl having no autovomously replicating ability which can be held by the yeast only through integration into the genome was constructed. The plasmid has the G418 resistant gene and the ~-galactosidase gene as the markers within yeast and also has rRNA gene sequence as the sequence necessary for the plasmid to be integrated into the genomeDNA by homologous recombination. The u-ALDCase gene is rRNA gene sequence sandwiched between the ADHl promoter at 5'-end and HIPl terminatorat 3'- end, and the combined fragment is inserted in the rRNA gene sequence. The plasmid, in order to be integrated efficiently into the rRNA gene on the chromosome, is cleaved previously at the KpnI site within the rRNA gene sequence before used for transformation. As the result, in the transformant obtained, the rRNA gene sequence derived from the plasmid ~ ~62~
exists next to that existing originally in the chromosome. Accordingly, when the transformant is grown in a complete medium, spontaneous recombination between the two rRNA gene sequences occurs, whereby G418 sensitive, Lac~ cells will appearO ~ part of these will exhibit a-ALDCase activity, and only ADH1 promoter, a-ALDCase gene and HIPl terminator remain on the chromosome in these microorganisms, with other vector portions being excised.
(ii) Construction of pIARLl The pIARLl was constructed from a yeast integrating plasmid YIp5 (Prot. Natl, Acad. Sci. USA 76r 1035-1039 (1979))-First, the G418 resistant gene fragment prepared after cleavage of pUC4R ~produced by Pharmacia) with SalIwas inserted at the SalI site of YIp5 to construct a plasmid pIG7.
Subsequentlyr as HIPl gene promoter + lacZ gene fragmentr the BglII-BamHI fragment compristing the BamHI
fragment containing the lac Z gene from the plasmid pMC1871 (produced by Pharmacia) linked to the BglII
fragment containing about 0.6 kb of the 5'-non translation region and 0.4 kb of the translation region of the yeast HIPl gene (Gener 38, 205-214 (1985)) was inserted at the BamHI site of pIG7 to construct plasmid pILG2.
The rRNA gene was cloned from the library used for cloning of the ADHl yene by use of a 5' end-labelled oligomer correspondîng to the nucleotide of the 4 to 32nd from the 5'-end of the 5,8SrRNA gene (J.B.C. 252r 8118-8125 (1977)). And ther EcoRI fragment of about 3 kb containing a part of each of 5.BSrRNA gene and 25SrRNA
gene was introduced at the EcoRI site derived from pBR322 of pILG2 to construct a plasmid pIRL9.
ADHl promoter + a-ALDCase gene + HIPl terminator fragment was obtained according to the method shown below.
~2~o2~6 After cleavage of the plasmid pUAR5 having a-ALDCase gene with HincII, the frayment was treated with Bal31 and ligated to HindIII linker, and thereafter cleaved with HindIII and BamHI. The a-ALDCase gene fragment obtained 5 was inserted between the BamHI and the HindIII sites of pUC12 (produced by Pharmacia Co.), and the nucleotide sequence was determined to obtain a plasmid pALDC3 having about 40 bp upstream of 5'-end and the initial ATG of a-ALDCase gene deleted. The pALDC3 was digested with BamHI
10 and made to have a blunt end with klenow fragment and then the HindIII-SmaI fragment of pAK503 was substituted with the a-ALDC gene fragment obtained by HindIII
digestion to construct a plasmid pAL503-3. Further, the SphI site of the pAL503-3 was digested with SphI and then converted to the BamHI site by Sl nuclease treatment and BamHI linker addition, and thereafter ADHI promoter + a-ALDCase gene fragment was obtained as BamHI-BalII
fragment.
On the other hand, the plasmid where the BamHI-SalI
fragment of pBR322 was substituted with the BamHI-SalI
fragment haviny about 0.9 kbp of the 3'-end non-translation region and about 0.1 kb of the 3' translation region of the HIP] gene was constructed and the above ADHI promoter -~ a-ALDCase gene fragment was inserted at the BamHI csite of this plasmid to construct a plasmid pALT18 in which ADHl promoter + a-ALDCase gene + HIPl terminater are linked in this order mentioned.
The ADHl promoter ~ a-ALDCase gene + HIPl terminator fragment, obtained as the BarmHI fragment after digestion 30 of pALT18 with SalI and subsequent treatment with klenow fragment, addition oE BamHI linker and BamHI digestion was inserted at the BglII site of pIRL~ to construct the desired plasmid pIARLI.
(5) Introduction of PIARLl into yeast and expression of ~-ALDCase By use of the pIARL1 constructed as described above, yeast was transformed as follows. Beer yeast IFO0751 ~_ t~ $~
strain was cultured in YPD medium at 30C to OD600 = l.0, and the microorganism cells were collec~ed and transformed with pIARLl according to the lithium acetate method. For promoting recombination in the rRNA gene 5 sequence, pIARLl was completely digested at the KpnI
within the rRNA gene sequence to be made linear before transformation. ~fter transformation, 108 of the of the yeast cells were suspended in l ml of YPD medium and shaked at 30C for 18 hours, and the culture was then lO spreaded onto YPD agar medium containing an antibiotic G418 ~500 ~g/m). Subsequently, the plate was incubated at 30C for 3 to 5 days to obtain colonies. In these colonies, in addition to the transformed cells, cells having acquired G418 resistance independently on pIARLl 15 were contained, and therefore they were transferred with a toothpick onto the agar medium containing X-gal (51_ bromo-4'-chloro-3'-indoyl-~-D galactoside) of Ruby et al ~Method in Enzymology, vol. lOl, p. 253 ~1983)) and incubated at 30C for 2 to 5 days. Those which color 20 formed blue colony on this plate by ~-galactosidase activity ~Lac~ strain) were judged to be transformants.
Such cells all exhibited ~-~LDCase activity of 0.8-l.8U/mg protein. The transformant exhibiting the highest a-ALDCase activity ~SKBl03 strain) was cultured in YPD
25 medium non-selectively for ~0 generations. The a-ALDCase activity after cultivation was found to be 0.9 U/mg protein, indicating that the gene exhibiting a-ALDCase activity was stably held in the chromosome.
(6) Excision of undesired sequence and expression of a-ALDCase qene After non-selective cultivation of the transformant obtained in 15) (SKBl03 strain) in YPD medium for 20 to 30 generations, the culture broth was adequately diluted and spreaded onto the agar medium containing X-gal of 35 Ruby et al as described above. The plate was cultured at 30C for 5 to 7 days, and the strain without blue color formation (Lac~ strain) were selected. Of these str~ins, , ~
2~6 those exhibiting G418 sensitivity on YPD agar medium ~ontaining 500 ~g/ml G418 were selected. Further, strains exhibiting a-ALDCase activity were obtained. In these strains, as shown in (4)-(i), it may be considered 5 that, recombination occurred between the duplicated rRNA
gene sequences, whereby only ADHl promoter, a-ALDCase gene and HIPl terminator remain on the chromosome, with other vector portions being excised..
Of these strains, the strain exhibiting a-ALDCase lO activity of 0.2 U/mg protein (SKBl04 strain) was cultured in YPD medium for 40 generations and activity of 80~ or more was maintained.
(7) Fermentation test Fermentation tests were conducted for the SKBl03 15 strain obtained in (5~ and the SKBl04 strain obtained in (6), and reduction of TDA in fermented wort was confirmed according to the following method. Two kinds of yeasts were subjected to stationary cultivation non selectively in YPD medium at 20C for 3 days andsubsequently at 10C
20 for lO days, and the respective cells were collected by I centrifugation at 3000 x q for 10 minutes, washed with distilled water and then provided for fermentation test.
To a wort ad~usted to ll P was added the yeast to a yeast addition ratio of 0.6~ (wet. w/v) and, after 25 sufficient aeration, stationary fermentation was carried out at 10C for 8 to lO days. After completion of fermentation, cells were removed by centrifugation at 3000 x q for 10 minutes and filtration, and the filtrate was subjected to measurement of amount of TDA and 30 apparent extract. The results were as shown in the following Tables. Although both cultivation and fermentation were conducted under non-selective conditions, marked decrease in amount of TDA in fermented wort was seen as compared with control strain, thus 35 indicating that a-ALDCase activity was stably exhibited.
. .
7~i Results of fermentation test of SKB103 strain TDA Apparent Strain (mg/liter) extract IFO 0751 (~ 0.68 2.4 ~ 0.69 2.2 Average 0.69 2.3 SKB 103 ~) 0.14 2.7 (~) 0.14 2.9 Average 0.14 2.8 Results of fermentation test of SKB104 strain _ . TDA Apparent Strain (mg/liter) extract IFO 0751 (~) 1.02 2.3 @~ 0.94 2.2 20~verage 0.98 2.3 SKB 104 (i) 0.44 2.2 @~ 0.51 2.0 ~vernge 0 48 2.1 Deposition of microorqanism The microorganisms shown below related to the present invention have been deposited at the Institute of Fermentation Research, Agency of Industrial Science &
Technology, Ministry of International Trade and Industry under the following deposition numbers under the Budapest 3 Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure.
(1) SKB101 (containing pALG5034 ) . . . FERM-BP No . 1228 (2) SKB102 (containing pALGS034 j . . . FERM-BP No. 1229 Both of (l)~and (2) were deposited on December 11, 1985.
(3) SKB104 ... FERM-BP No. 1227 (3) was deposited on December 2, 1986.
Claims (18)
PROPERTY OR PRIVILEGE IS CLAIMED ARE DEFINED AS FOLLOWS:
1. A DNA strand having an ability in biotechnological production of .alpha.-acetolactate decarboxylase, the said DNA strand comprising a nucleotide sequence coding for a polypeptide having an .alpha.-acetolactate decarboxylase activity and an amino acid sequence substantially from A to B of the amino acid sequence shown below:
2. A DNA strand according to claim 1, wherein the nucleotide sequence coding for the polypeptide is from A to B of the nucleotide sequence shown in claim 1 or its degenerative isomer.
3. A yeast belonging to Saccharomyces cerevisiae, having an .alpha.-acetolactate producing ability that has been reduced by transformation with a DNA strand which has a nucleotide sequence coding for a polypeptide having the .alpha.-acetolactate decarboxylase activity and an amino acid sequence substantially from A to B of the amino acid sequence shown below:
4. A yeast according to claim 3, wherein the transformation is conducted with a plasmid containing a DNA strand having a nucleotide sequence coding for the polypeptide having a sequence from A to B of the amino acid sequence shown in claim 3 under conditions adapted for expression of its genetic information.
5. A yeast according to claim 3, wherein the DNA strand has the nucleotide sequence from A to B of the nucleotide sequence shown in claim 3.
6. A process for producing a yeast belonging to Saccharomyces cerevisiae which has a reduced .alpha.-acetolactate producing ability, which process comprises transforming a host yeast belonging to Saccharomyces cerevisiae with a DNA strand which has a nucleotide sequence coding for the polypeptide having .alpha.-acetolactate decarboxylase activity, of which amino acid sequence is substantially from A to B of the amino acid sequence shown below:
7. A process as claimed in claim 6, wherein the nucleotide sequence coding for the polypeptide is from A to B of the nucleotide sequence shown in claim 6 or its degenerative isomer.
8. A process as claimed in claim 6, wherein transformation is conducted with a plasmid containing a DNA strand having a nucleotide sequence coding for the polypeptide from A to B of the amino acid sequence shown in claim 6 under conditions adapted for expression of its genetic information.
9. A process as claimed in claim 6, wherein the DNA strand has the nucleotide sequence from A to B of the nucleotide sequence shown in claim G.
10. A process for producing an alcoholic liquor, which process comprises causing a yeast to act upon its substrate to produce ethanol therefrom, wherein the yeast belongs to Saccharomyces cerevisiae having an .alpha.-acetolactate producing ability that has been reduced by transformation with a DNA strand which has a nucleotide sequence coding for a polypeptide having the .alpha.-acetolactate decarboxylase activity and an amino acid sequence substantially from A to B of the amino acid sequence shown below:
11. The process as claimed in claim 10, wherein the transformation is effected with a plasmid containing a DNA strand having a nucleotide sequence coding for the polypeptide from A to B of the amino acid sequence shown in claim 10 under conditions adapted for expression of its genetic information.
12. The process as claimed in claim 10, wherein the DNA
strand has the nucleotide sequence from A to B of the nucleotide sequence shown in claim 10.
strand has the nucleotide sequence from A to B of the nucleotide sequence shown in claim 10.
13. The process as claimed in claim 10, wherein the alcoholic liquor is beer.
14. A yeast according to claim 3, wherein the nucleotide sequence coding for the polypeptide is from A to B of the nucleotide shown in claim 3 or its degenerative isomer.
15. A DNA strand according to claim 1, which is plasmid pALG5034.
16. A yeast according to claim 3, wherein the DNA strand is plasmid pALG5034.
17. A DNA strand according to claim 1, which is plasmid pIARLI.
18. A yeast according to claim 3, wherein the DNA strand is plasmid pIARLI.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| JP289571/1986 | 1986-12-04 | ||
| JP61289571A JPH0614865B2 (en) | 1985-12-13 | 1986-12-04 | DNA chain encoding α-acetolactate decarboxylase and yeast transformed with this DNA chain |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CA1296276C true CA1296276C (en) | 1992-02-25 |
Family
ID=17744951
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CA000532171A Expired - Lifetime CA1296276C (en) | 1986-12-04 | 1987-01-30 | DNA STRAND CODING FOR .alpha.-ACETOLACTATE DECARBOXYLASE AND YEAST TRANSFORMED WITH THE DNA STRAND |
Country Status (1)
| Country | Link |
|---|---|
| CA (1) | CA1296276C (en) |
-
1987
- 1987-01-30 CA CA000532171A patent/CA1296276C/en not_active Expired - Lifetime
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP0717107B1 (en) | Transformant line of candida utilis yeast and expression of heterogene therewith | |
| EP0228009B1 (en) | Dna strand coding for alpha-acetolactate decarboxylase and yeast transformed with the dna strand | |
| Yoshimoto et al. | Characterization of the ATF1 and Lg-ATF1 genes encoding alcohol acetyltransferases in the bottom fermenting yeast Saccharomyces pastorianus | |
| NZ257561A (en) | Recombinant method for preparing xylitol | |
| AU672974B2 (en) | Alcohol acetyltransferase genes and use thereof | |
| Watari et al. | Construction of flocculent brewer's yeast by chromosomal integration of the yeast flocculation gene FLO1 | |
| EP0260404A2 (en) | Amylolytic enzymes producing microorganisms constructed by recombinant DNA technology and their use for fermentation processes | |
| US5100794A (en) | Amylolytic enzymes producing microorganisms, constructed by recombinant DNA technology and their use for permentation processes | |
| Yamano et al. | Construction of a brewer's yeast having α-acetolactate decarboxylase gene from Acetobacter aceti ssp. xylinum integrated in the genome | |
| US6723540B1 (en) | Manufacture of xylitol using recombinant microbial hosts | |
| CA2149171C (en) | Recombinant yeast producing a decreased amount of hydrogen sulfide in beer production | |
| CA1302322C (en) | DNA STRAND CODING FOR .alpha.-ACETOLACTATE DECARBOXYLASE AND YEAST TRANSFORMED WITH THE DNA STRAND | |
| US5585271A (en) | Yeast agglutination genes and yeast containing them | |
| JPH06253826A (en) | Production of wine reduced in ester flavor | |
| JP3426633B2 (en) | Beer production method | |
| CA1296276C (en) | DNA STRAND CODING FOR .alpha.-ACETOLACTATE DECARBOXYLASE AND YEAST TRANSFORMED WITH THE DNA STRAND | |
| JPH0671428B2 (en) | Uricase DNA sequence and process | |
| JPH07171A (en) | Production of liquors | |
| JPH089977A (en) | Yeast promotor | |
| JPH0560918B2 (en) | ||
| US5459046A (en) | Cytochrome C gene derived from hydrogen bacterium | |
| Ashikari et al. | Alcohol Production fey Genetically Improved Yeast | |
| JPH11243957A (en) | New alcoholacyl transferase gene | |
| JPH05192155A (en) | Gene capable of suppressing production of hydrogen sulfide with yeast and yeast for brewing containing the same gene transduced thereinto | |
| JPH09224676A (en) | New promoter |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| MKEX | Expiry |
