EP1877069A2 - Novel use of spiegelmers - Google Patents

Novel use of spiegelmers

Info

Publication number
EP1877069A2
EP1877069A2 EP06742799A EP06742799A EP1877069A2 EP 1877069 A2 EP1877069 A2 EP 1877069A2 EP 06742799 A EP06742799 A EP 06742799A EP 06742799 A EP06742799 A EP 06742799A EP 1877069 A2 EP1877069 A2 EP 1877069A2
Authority
EP
European Patent Office
Prior art keywords
helix
nucleic acid
section
hmga
nucleotides
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
EP06742799A
Other languages
German (de)
French (fr)
Inventor
Florian Jarosch
Christian Maasch
Sven Klussmann
Axel Vater
Dirk Eulberg
Werner Purschke
Klaus Buchner
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
TME Pharma AG
Original Assignee
Noxxon Pharma AG
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Noxxon Pharma AG filed Critical Noxxon Pharma AG
Priority to EP09016125A priority Critical patent/EP2206501A3/en
Publication of EP1877069A2 publication Critical patent/EP1877069A2/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07HSUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H21/00Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
    • C07H21/04Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids with deoxyribosyl as saccharide radical
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/115Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00Drugs for skeletal disorders
    • A61P19/02Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • A61P35/02Antineoplastic agents specific for leukemia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • A61P35/04Antineoplastic agents specific for metastasis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • A61P9/10Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/16Aptamers
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2500/00Screening for compounds of potential therapeutic value
    • G01N2500/04Screening involving studying the effect of compounds C directly on molecule A (e.g. C are potential ligands for a receptor A, or potential substrates for an enzyme A)

Definitions

  • the present invention relates in one aspect to a new use of aptmers.
  • the present invention relates to HMG protein binding aptmers.
  • the target molecules can basically be divided into two groups.
  • the first group comprises target molecules which are present extracellularly and thus in principle be brought into contact with it by administering an active substance into a body fluid or a body cavity containing the target molecule.
  • the first group of target molecules are also referred to herein as extracellular target molecules.
  • the second group of target molecules includes target molecules that are present in cells, which cells are related to the disease to be treated or the disposition for the disease. It is not necessary that the target molecule is directly responsible for the disease state or is directly related to the disposition for the disease.
  • the second group of target molecules are also referred to herein as intracellular target molecules.
  • target molecule ie, extracellular or intracellular target molecule
  • target molecule basically determines the class of compounds that can be used to provide the therapeutic or preventive effect necessary interaction between the drug, typically the pharmaceutical agent, and the target molecule.
  • small molecules can be used almost ubiquitously, ie chemical compounds with a molecular weight of typically 1000 or less daltons. These molecules can interact directly with extracellular but also with intracellular target molecules as desired.
  • new classes of drugs have been developed by the biotechnology industry, such as antibodies, in particular monoclonal antibodies, antisense molecules, siRNA molecules, aptamers and aptmers.
  • aptamers and spiegelmers d. H. functional nucleic acids with a defined three-dimensional structure, which allows the specific interaction with the respective target molecules.
  • the use of aptamers to target intracellular target molecules uses genetic engineering methods, more specifically, gene therapy.
  • the aptamers directed against an intracellular target molecule, also called intramers are introduced into the respective target cells by means of genetic engineering methods.
  • intracellular expression of intracellular expression of an intracellular nucleic acid coding for the respective aptamer is in principle closed to the Spiegelmers since no biological system exists, which Spiegelmers, d. H. L-nucleotide aptamers would be able to build up.
  • the object is achieved in a first aspect by the use of an L-nucleic acid as intracellular active agent.
  • the L-nucleic acid is a spiegelmer.
  • the L-nucleic acid interacts with an intracellular receptor.
  • the intracellular receptor is selected from the group comprising molecular receptors, enzymes, chaperone molecules, signal peptides, intracellular structures and metabolic intermediates.
  • the intracellular receptor is selected from the group comprising polypeptides, carbohydrates, nucleic acids, lipids and combinations thereof.
  • the L-nucleic acid interacts with an intracellular receptor within a cell.
  • the intracellular receptor is selected from the group comprising transcription factors and an AT hook-binding DNA-binding protein.
  • the intracellular receptor is selected from the group comprising the HMG proteins, preferably from the group comprising HMGA1, HMGA1a, HMGA1b, and HMGA2.
  • the object is achieved in a second aspect by a method for binding an intracellular receptor comprising:
  • the incubation is carried out under conditions such that the L-nucleic acid binds to the intracellular receptor in the cell.
  • the L-nucleic acid is a spiegelmer.
  • a binding, in particular an intracellular binding, of the L-nucleic acid takes place at the intracellular receptor is determined after incubation of the cell with the L-nucleic acid, whether a binding, in particular an intracellular binding, of the L-nucleic acid takes place at the intracellular receptor is.
  • the intracellular receptor is selected from the group comprising molecular receptors, metabolic intermediates and enzymes.
  • the intracellular receptor is selected from the group comprising polypeptides, carbohydrates, nucleic acid, lipids and combinations thereof.
  • the intracellular receptor is selected from the group comprising transcription factors and an AT hook-binding DNA-binding protein.
  • the intracellular receptor is selected from the group comprising HMG proteins, preferably selected from the group comprising HMGA1, HMGA1a, HMGA1b and HMGA2.
  • the object is achieved in a third aspect by the use of an L-nucleic acid for the production of a medicament for the treatment and / or prevention of a disease, wherein the target molecule of the medicament is an intracellular target molecule.
  • the intracellular receptor is selected from the group comprising molecular receptors, enzymes, chaperone molecules, signal peptides, intracellular structures and metabolic intermediates.
  • the intracellular receptor is selected from the group comprising polypeptides, carbohydrates, nucleic acids, lipids, and combinations thereof.
  • the target molecule is selected from the group comprising transcription factors and an AT hook-binding DNA-binding protein.
  • the target molecule is selected from the group comprising HMG proteins, preferably selected from the group comprising HMGA1, HMGA1a, HMGA1b and HMGA2.
  • the disease is selected from the group comprising tumor diseases, viral infections and arteriosclerosis.
  • the tumor disease is selected from the group comprising mesenchymal tumors, epithelial tumors, benign tumors, malignant tumors and metastatic tumors.
  • the target molecule HMGA and the disease are selected from the group comprising carcinomas of the prostate, pancreas, thyroid, cervix, stomach, breast, colon / Rectum, ovaries; neuroblastomas; Lymphomas, uterine leiomyomas; lipomas; endometrial polyps; chondroid hamartomas of the lung; pleomorphic adenomas of the salivary glands; Hämangiopericytome; chondromatous tumors; aggressive angiomyomas; diffuse astrocytomas; osteoclastomas; Skin cancer; Burkitts lymphoma; Lewis lung cancer; Leukemia; non-small cell lung carcinoma; and in each case metastases and / or metastatic forms thereof.
  • arteriosclerosis is triggered or caused by HMGA1, HMGA1a, HMGIb and / or HMGA2 mediated formation of atherosclerotic plaques.
  • the intracellular target molecule is intracellular.
  • the object is achieved in a fourth aspect by the use of an L-nucleic acid for the production of a diagnostic agent for diagnosis, wherein the target molecule of the diagnostic agent is an intracellular target molecule.
  • the intracellular receptor is selected from the group comprising molecular receptors, enzymes, chaperone molecules, signal peptides, intracellular structures and metabolic intermediates.
  • the intracellular receptor is selected from the group comprising polypeptides, carbohydrates, nucleic acids, lipids and combinations thereof.
  • the target molecule is selected from the group comprising transcription factors and AT hook-binding DNA-binding proteins.
  • the target molecule is selected from the group comprising HMG proteins, preferably selected from the group comprising HMGA, HMGAIa, HMGAIb and HMGA2.
  • the disease is selected from the group comprising tumor diseases, viral infections and arteriosclerosis.
  • the tumor disease is selected from the group comprising mesenchymal tumors, epithelial tumors, benign tumors, malignant tumors, and metastatic tumors.
  • the target molecule is HMGA and the disease is selected from the group comprising carcinomas of the prostate, pancreas, thyroid, cervix, stomach, breast, Colon / rectum, ovaries; neuroblastomas; Lymphomas, uterine leiomyomas; lipomas; endometrial polyps; chondroid hamartomas of the lung; pleomorphic adenomas of the salivary glands; Hämangiopericytome; chondromatous tumors; aggressive angiomyomas; diffuse astrocytomas; osteoclastomas; Skin cancer; Burkitts lymphoma; Lewis lung cancer; Leukemia; non-small cell lung carcinoma; and in each case metastases and / or metastatic forms thereof.
  • arteriosclerosis is triggered by HMGA1, HMGA1a
  • the intracellular target molecule is intracellular.
  • the object is achieved in a fifth aspect by a composition comprising an L-nucleic acid binding to an intracellular target molecule and a delivery vehicle.
  • the delivery vehicle is a delivery vehicle suitable for intracellular delivery of the L-nucleic acid.
  • the delivery vehicle is selected from the group comprising vehicles, conjugates and physical measures.
  • the delivery vehicle is a vehicle, wherein the vehicle is selected from the group comprising liposomes, nanoparticles, microparticles, cyclodextrins or dendrimers, or a vesicle consisting of Polypeptides, polyethylenimine and / or amphipathic molecules.
  • the delivery vehicle is a conjugate, wherein the conjugate is a receptor-mediated endocytosis conjugate, a fusogenic peptide conjugate, a signal peptide conjugate, a conjugate with a nucleic acid, preferably a conjugate with a aptmer or a lipophilic conjugate.
  • the conjugate is a receptor-mediated endocytosis conjugate, a fusogenic peptide conjugate, a signal peptide conjugate, a conjugate with a nucleic acid, preferably a conjugate with a aptmer or a lipophilic conjugate.
  • the delivery vehicle is a physical measure, wherein the dimensional preferably is selected from the group comprising electroporation, iontophoresis, pressure, ultrasound and shock waves.
  • the delivery vehicle comprises polyethyleneimine.
  • the polyethyleneimine is a branched polyethyleneimine having a molecular weight of about 25 kDa.
  • the polyethyleneimine forms a micelle or a micelle-like structure.
  • the L-nucleic acid is a spiegelmer.
  • the aptmer carries a modification, wherein the modification is selected from the group comprising PEG residues.
  • the PEG moiety has a molecular weight of about 1,000 to 10,000 Da, preferably a molecular weight of about 1,500 to 2,500 Da, and most preferably a molecular weight of about 2,000 Da ,
  • the modification is bound to the 5 'terminus or the 3' terminus of the L-nucleic acid.
  • the ratio of the total number of the nitrogen groups of the polyethyleneimine and the total number of the phosphate groups of the nucleic acid contained in the composition is about 1 to 20, before- usually about 1.5 to 10, more preferably about 2 to 5, and most preferably about 2 to 3.
  • the composition provides the L-nucleic acid intracellularly.
  • the object is achieved in a sixth aspect by the pharmaceutical composition
  • the pharmaceutical composition comprising a composition according to the fifth aspect, and a pharmaceutically acceptable carrier.
  • the L-nucleic acid is a composition according to the fifth aspect.
  • the L-nucleic acid is a composition according to the fifth aspect.
  • the L-nucleic acid is a composition according to the fifth aspect.
  • the L-nucleic acid is a composition according to the fifth aspect.
  • an HMGA-binding nucleic acid characterized in that the nucleic acid comprises a section box Al and a section box A2, wherein the section box Al and the section box A2 are interconnected by an intermediate section and wherein Box Al and Box A2 are individually and independently selected from the group comprising GGGCG, GGGUG and GGGAG.
  • the intermediate section consists either of an intermediate section Z1 comprising six or seven nucleotides or of an intermediate section Z2 comprising 12 to 25 nucleotides.
  • the nucleic acid at the 5 'end of the section Box Al has a first portion and at the 3' end of the portion Box A2 a second portion, preferably both Sections independently comprise four to eight nucleotides each.
  • the two sections are at least partially or completely hybridized with each other, wherein the hybridization extends over four to eight nucleotide pairs.
  • the nucleic acid has a section Helix A1 at the 5 'end of the section Box Al and a section Helix A2 at the 3' end of the section Box A2 , wherein preferably the portion Helix Al comprises four to eight nucleotides, and preferably the portion Helix A2 comprises four to eight nucleotides, and wherein preferably the portion helix Al represents the first portion at the 5 'end of the portion box Al or a part thereof, and wherein preferably the section Helix A2 represents the second section at the 3 'end of the section Box A2 or a part thereof, wherein the length of the section Helix Al is independent of the length of the section Helix A2.
  • the sections Helix Al and Helix A2 are at least partially or completely hybridized with each other, the hybridization extending over four to eight nucleotide pairs.
  • a section Helix B2 is arranged, wherein preferably the length of the section Helix Bl and Helix B2 individually and independently comprises a length of four to eight nucleotides.
  • the sections Helix Bl and Helix B2 are at least partially or hybridized completely to each other, wherein the hybridization extends over four to eight nucleotide pairs.
  • nucleotides are arranged between the 3 'end of the section Helix Al and the 5' end of the section Helix Bl.
  • nucleotides are located between the 3 'end of the Helix Al section and the 5' end of the Helix Bl section.
  • nucleotides are arranged between the 3 'end of the section Helix B2 and the 5' end of the section Helix A2.
  • a nucleotide is between the 3 'end of the helix B2 portion and the 5' end of the helix A2 portion arranged.
  • the sum of nucleotides of section Helix A1 and section Helix Bl is 10 to 12 nucleotides and the sum of nucleotides from section Helix A2 and from section Helix B2 10 to 12 nucleotides.
  • the sum of the hybridized nucleotides resulting from the hybridization of section Helix A1 with section Helix A2 and section Helix Bl with section Helix B2 is 10 to 12 nucleotide pairs.
  • the nucleic acid does not comprise a section Helix Al and Helix A2, which at the 5 'end of the nucleic acid portion Helix Bl and at the 3' end the helix B2 is arranged, wherein preferably the length of the section Helix Bl and Helix B2 each individually and independently comprises a length of four to eight nucleotides.
  • the sections Helix Bl and Helix B2 are at least partially or completely hybridized with each other, wherein the hybridization extends over four to eight nucleotide pairs.
  • between the 3 'end of the section Helix Al and the 5' end of the section Box Al are one to five nucleotides and between the 3 ' End of the section box A2 and the 5 'end of the section Helix A2 one to three nucleotides arranged.
  • a seventeenth embodiment of the seventh aspect which is also an embodiment of the sixth, seventh, eighth, ninth, tenth, eleventh, twelfth, thirteenth, fourteenth and fifteenth embodiment, are between the 3 'end of the section Helix Bl and the 5' - End of the section box Al two nucleotides and arranged between the 3 'end of the section box A2 and the 5' end of the section helix B2 one to seven nucleotides.
  • an eighteenth embodiment of the seventh aspect which is also an embodiment of the first, second, third, fourth, fifth, sixth, seventh, eighth and tenth embodiments insofar as it is an embodiment of the sixth, seventh and eighth embodiments, the twelfth and thirteenth embodiments Embodiment, as far as these embodiments of the sixth, seventh, eighth and tenth embodiments, the fourteenth and fifteenth embodiment, as far as these embodiments of the sixth, seventh, eighth, tenth, twelfth and thirteenth embodiment, or the seventeenth embodiment, as far as these embodiments of the sixth , eighth, tenth, twelfth, thirteenth and fifteenth embodiments, each within the scope limited herein, includes the intermediate section Zl six or seven nucleotides.
  • the intermediate portion Zl has the sequence NiN 2 GNgN 3 N 4 Ns, wherein
  • the nucleic acid comprises a section Box Al and a section Box A2, with the 3 'end of the section Box Al directly connected to the 5' end of the intermediate section Zl is connected, and the 3 'end of the intermediate portion Zl is connected directly to the 5' end of the section box A2.
  • the nucleic acid comprises a section Helix Bl and a section Helix B2.
  • the sections Helix Bl and Helix B2 each individually and independently of each other comprise four to eight nucleotides, which are preferably fully or partially hybridized with each other.
  • helix is provided between the 3 'end of the section box A2 and the 5' end of the section B2 no nucleotide, or arranged in the 5'-3 'direction, the nucleotide sequence GN y , wherein N y comprises zero to six nucleotides, preferably 0 or 6 nucleotides.
  • the nucleic acid comprises a section Helix A1 and Helix A2.
  • the sections Helix A1 and Helix A2 each independently and independently of each other comprise four to eight nucleotides, and preferably the sections Helix A1 and Helix A2 are completely or partially hybridized with each other.
  • a nucleotide sequence N x is disposed between the 3 'end of the section Helix Al and the 5' end of the section Helix Bl, where N x zero to five nucleotides.
  • a nucleotide sequence N z is disposed between the 3 'end of the helix B2 portion and the 5' end of the helix A2 portion N 2 zero to six nucleotides.
  • a twenty-ninth embodiment of the seventh aspect which is also an embodiment of the twenty-first, twenty-second, twenty-third, twenty-fourth, twenty-fifth, twenty-sixth, twenty-seventh and twenty-eighth embodiments, the sum of the hybridized nucleotides from the hybridization of section Helix A1 with section Helix A2 and of Section Helix Bl with section Helix B2 10 to 12 nucleotide pairs.
  • a thirtieth embodiment of the seventh aspect which is also an embodiment of the twenty-fourth, twenty-fifth, twenty-sixth, twenty-seventh, twenty-eighth and twenty-ninth embodiments, between the 3 'end of the section Box A2 and the 5' end of the section helix B2 in FIG '-3' direction the nucleus nucleotide GN y , where N y comprises zero to six nucleotides, preferably 0 or 6 nucleotides.
  • the HMGA-binding nucleic acid has the following structure
  • N 1 U, C, A or G;
  • N 2 G or U
  • N 3 U or C
  • N 4 U or A
  • N 5 G or A
  • N 6 G, A or U
  • N 7 G or U
  • N 8 U or no nucleotide
  • N x zero to five nucleotides
  • N 2 zero to six nucleotides
  • section Box Al and section box A2 are each individually and independently selected from the group of nucleotide sequences comprising GGGCG, GGGUG and GGGAG;
  • section Helix A1 and the section Helix A2 each individually and independently comprise four to eight nucleotides, wherein preferably the sections Helix Al and Helix A2 are completely or partially hybridized with each other, and
  • the sections Helix Bl and Helix B2 each individually and independently comprise four to eight nucleotides, wherein preferably the sections Helix Bl and Helix B2 are completely or partially hybridized with each other and the hybridizing region four to eight Nucleotides, and wherein the sum of the hybridized nucleotides from the hybridization of section Helix Al with section Helix A2 and of section Helix Bl with section Helix B2 is 10 to 12 nucleotide pairs.
  • the HMGA-binding nucleic acid comprises a sequence selected from the group comprising SEQ. ID. No. 1, SEQ. ID. No. 2, SEQ. ID. No. 3, SEQ. ID. No. 5, SEQ. ID. No. 6, SEQ. ID. No. 7 and SEQ. ID. No. 13th
  • the 3 'end of the section Box A2 immediately adjoins the 5' end of the section Helix B2 ,
  • the HMGA-binding nucleic acid has the following structure
  • N 2 G or U
  • N 3 U or C
  • N 4 U or A
  • N 5 G or A
  • N 6 G, A or U
  • N 7 G or U
  • Ng U or no nucleotide
  • N x zero to five nucleotides
  • N z zero to six nucleotides;
  • the section Box Al and section box A2 are each individually and independently selected from the group of nucleotide sequences comprising GGGCG, GGGUG and GGGAG;
  • section Helix A1 and the section Helix A2 each individually and independently comprise four to eight nucleotides, wherein preferably the sections Helix Al and Helix A2 are completely or partially hybridized with each other, and
  • the sections Helix Bl and Helix B2 each individually and independently comprise four to eight nucleotides, wherein preferably the sections Helix Bl and Helix B2 are fully or partially hybridized with each other and the hybridizing region comprises four to eight nucleotides, and wherein the sum of the hybridized nucleotides from the hybridization of section Helix Al with section Helix A2 and section Helix Bl with section Helix B2 is 10 to 12 nucleotide pairs.
  • the HMGA-binding nucleic acid comprises a sequence comprising SEQ. ID. No. Third
  • the HMGA-binding nucleic acid has the following structure
  • the HMGA-binding nucleic acid has the following structure
  • the HMGA comprises binding nucleic acid a sequence selected from the group comprising SEQ. ID. No. 15 and SEQ. ID. No. 16th
  • the HGMA-binding nucleic acid comprises an intermediate section Z 2 of 12 to 25 nucleotides.
  • the HGMA binding nucleic acid comprises an intermediate portion Z2, a portion Helix C1, and a portion Helix C2.
  • a central portion N c is disposed between the helix Cl portion and the helix C2 portion of the HMGA-binding nucleic acid.
  • the length of the helix C1 and helix C2 portion of the HGMA-binding nucleic acid is the same length.
  • the length of the helix Cl and helix C2 portion of the HGMA-binding nucleic acid is individually and independently three to six nucleotides.
  • helix Cl and helix C2 portions of the HMGA-binding nucleic acid are fully or partially hybridized with each other.
  • the central portion N c of the HMGA-binding nucleic acid comprises three to five nucleotides.
  • the HMGA-binding nucleic acid comprises a section Box Al and a section box A2, wherein between the 3 ' End of the section Box Al and the 5 'end of the section Helix Cl is a nucleotide sequence N b is arranged and comprises three nucleotides.
  • the HMGA-binding nucleic acid comprises a section Box Al and a section box A2, wherein between the 3'-end of the section Helix C2 and the 5 'end of the section Box A2 a nucleotide sequence N d is arranged and comprises two to five nucleotides.
  • the HMGA-binding nucleic acid comprises a section Helix A1 and a section Helix A2.
  • the sections Helix A1 and Helix A2 of the HMGA-binding nucleic acid each individually and independently of each other comprise five to six nucleotides, preferably the section Helix A1 and the section Helix A2 completely or partially hybridized with each other.
  • a nucleotide sequence N a is arranged between the 3 'end of the section Helix Al and the 5' end of the section Box Al of the HMGA-binding nucleic acid, wherein N 3 comprises one to five nucleotides.
  • a nucleotide sequence GN e between the 3 'end of the box A2 section and the 5' end of the helix A2 section of the HMGA binding nucleic acid in FIG '-3' direction a nucleotide sequence GN e , where N e comprises one to two nucleotides, preferably A or UU.
  • the helix Cl and helix C2 portions of the HMGA-binding nucleic acid are each independently and independently of one another five or six nucleotides in length , wherein preferably the sections Helix Cl and Helix C2 are completely or partially hybridized with each other.
  • the HMGA-binding nucleic acid has the following structure:
  • N 3 one to five nucleotides
  • N b three nucleotides
  • N c three to five nucleotides
  • N d two to five nucleotides
  • N e one to two nucleotides, preferably A or UU;
  • section Box Al and the section box A2 are each individually and independently selected from the group comprising GGGCG, GGGUG and GGGAG,
  • the sections Helix A1 and Helix A2 each individually and independently comprise five or six nucleotides, and ⁇
  • the sections helix Cl and helix C2 each comprise five or six nucleotides, which are preferably fully or partially hybridized with each other.
  • the HMGA-binding nucleic acid comprises a sequence selected from the group comprising SEQ. ID. No. 8, SEQ. ID. No. 9, SEQ. ID. No. 10, SEQ. ID. No. 11, SEQ. ID. No. 14, SEQ. ED. No. 22 and SEQ. ID. No. 24th
  • the nucleic acid comprises a portion of box Al and a portion of helix Cl of the HMGA-binding nucleic acid, wherein between the 3 ' End of the section box Al and the 5 'end of the section Helix Cl is a nucleotide A.
  • the HMGA-binding nucleic acid comprises a section helix C2 and a section box A2, wherein between the 3 'end of the section helix C2 and the 5' end of the Section box A2 a nucleotide G is arranged.
  • the central portion N c of the HMGA-binding nucleic acid comprises four nucleotides, wherein N c is preferably GAUG.
  • the HMGA-binding nucleic acid comprises a section Helix Bl and a section Helix B2.
  • the sections Helix Bl and Helix B2 of the HMGA-binding nucleic acid individually and independently each five Nucleotides, wherein preferably the section Helix Bl is hybridized with the section Helix B2.
  • a sixtieth embodiment of the seventh aspect which is also an embodiment of the fifty-eighth or fifty-ninth embodiment, between the 3 'end of section Helix Bl and the 5' end of section Box Al of the HMGA-binding nucleic acid is a nucleotide sequence comprising two nucleotides N j , where N j is preferably AG.
  • a nucleotide G is located between the 3 'end of the box A2 section and the 5' end of helix B2 of the HMGA binding nucleic acid.
  • the HGMA-binding nucleic acid comprises a section Helix A1 and a section Helix A2.
  • the sections Helix A1 and Helix A2 of the HMGA-binding nucleic acid individually and independently each six nucleotides and are preferably the section Helix Al and the section Helix A2 hybridized with each other ,
  • a nucleotide sequence comprising two nucleotides Nj is located between the 3 'end of section Helix Al and the 5' end of section Helix Bl, where Nj preferably CA is.
  • a nucleotide A is located between the 3 'end of the helix B2 section and the 5' end of the helix A2 section.
  • the sections helix Cl and helix C2 each comprise three nucleotides, wherein preferably the sections helix Cl and helix C2 are hybridized with each other.
  • the HMGA-binding nucleic acid has the following structure:
  • the sections Box Al and Box A2 are each individually and independently selected from the group comprising the sequences GGGCG, GGGUG and GGGAG;
  • the sections Helix A1 and Helix A2 each individually and independently comprise six nucleotides, which are preferably hybridized with each other;
  • the sections Helix Bl and Helix B2 individually and independently comprise five nucleotides, whereby preferably the section Helix Bl and the section Helix B2 are hybridized with each other;
  • the sections helix Cl and helix C2 each individually and independently comprise three nucleotides, wherein preferably the sections helix Cl and helix C2 are hybridized with each other.
  • the HMGA-binding nucleic acid comprises a sequence selected from the group comprising SEQ. ID. No. 12th
  • the nucleic acid is one which binds to transcription factors, particularly transcription factors having an AT-hook.
  • the object is achieved in an eighth aspect by a nucleic acid which binds to a transcription factor comprising an AT hook, wherein the nucleic acid comprises a construction according to the seventh aspect.
  • the L-nucleic acid is a nucleic acid according to the seventh aspect.
  • the L-nucleic acid is a nucleic acid according to the seventh aspect.
  • the L-nucleic acid is a nucleic acid according to the seventh aspect.
  • the L-nucleic acid is a nucleic acid according to the seventh aspect.
  • the L-nucleic acid is a nucleic acid according to the seventh aspect.
  • the object is achieved in a ninth aspect by a method for screening an HMGA antagonist or HMGA agonist comprising the following steps:
  • the object is achieved in a tenth aspect by a method for screening an HMGA agonist and / or an HMGA antagonist comprising the following steps:
  • HMGA immobilized on one phase preferably a solid phase
  • nucleic acid according to the seventh aspect preferably a nucleic acid according to the seventh aspect, which is labeled
  • the determination is made to test whether the nucleic acid is being replaced by the candidate HMGA agonist or by the candidate HMGA antagonist.
  • the object is achieved in an eleventh aspect by a kit for the detection of HMGA comprising a nucleic acid according to the seventh aspect.
  • the object is achieved in a twelfth aspect by an HMGA antagonist obtainable by a method according to the tenth aspect.
  • the object is achieved in a thirteenth aspect by a HMGA agonist obtainable by a method according to the tenth aspect.
  • the object is achieved in a fourteenth aspect by a complex comprising an HMGA protein and a nucleic acid according to the seventh aspect.
  • the present invention is based on the surprising finding that contrary to the prior art it is possible to use L-nucleic acids and in particular aptmers to address intracellular target molecules.
  • the intracellular target molecules are preferably target molecules present in a cell. It allows the functional L-nucleic acids by their structure of L-nucleotides inherent properties such as high specificity of the interaction with their target molecules with high stability and lack of toxic or immunologically active degradation products when applied in biological systems and in particular in the animal and human body not to use the cellular mechanisms to encode, as in the case of intramers, L-nucleic acids from a plasmid or, more generally, a vector and thus to provide the actual functional nucleic acid through the intracellular process of transcription.
  • Functional L-nucleic acids and in particular aptmers can be transported while maintaining their specificity with respect to their binding to their target molecule and their activity via a cytoplasmic membrane.
  • This patency of the functional L-nucleic acids is inherent in the Spiegelmers and may be exacerbated by the use of delivery vehicles or delivery techniques.
  • the present inventors assume that functional L-nucleic acids per se can overcome the cytoplasmic membrane or, in the case of involvement of endosomal transport mechanisms in overcoming the cytoplasmic membrane, they can become involved forming vesicle structures capable of releasing a two- or three-dimensional structure that allows the specific interaction of the functional nucleic acid with its target molecule.
  • the present teachings deliberately turn away from the aptamer-based principle of utilizing intracellular transcription mechanisms to produce aptamers in the cell and, for the first time, provide means for the application of functional L-nucleic acids, and in particular aptmers, to cells.
  • functional nucleic acids refers to those nucleic acids other than structural, especially naturally occurring, structural nucleic acids such as rRNAs or coding nucleic acids such as mRNAs.
  • functional nucleic acids are nucleic acids which, due to their two- and / or three-dimensional structure, are capable of binding to target molecules.
  • binding to the target molecule is not by hybridization or base pairing based on Watson-Crick base pairings or Hoogsteen base pairing.
  • Particularly preferred functional nucleic acids are aptamers and aptmers.
  • an L-nucleic acid is a nucleic acid which is completely, substantially or partially constructed of L-nucleotides. It is particularly preferred if the L-nucleic acid consists entirely of L-nucleotides.
  • the term "essentially” designates an embodiment in which that part of the L-nucleic acid which is responsible for the interaction with the target molecule or the part which mediates the binding to the target molecule consists of L-nucleotides or these is constructed.
  • a functional L-nucleic acid is a functional nucleic acid that is wholly, substantially or partially constructed of L-nucleotides.
  • L-nucleic acids The synthesis of L-nucleic acids is known to those skilled in the art and described, for example, in Nolte et al., Nat. Biotech, 14, 1116-1119, 1996; and Klussmann et al, Nat. Biotechnol, 14, 1112-1115, 1996.
  • aptamers consisting of L nucleotides rather than D nucleotides.
  • an intracellularly active agent is a chemical compound capable of binding to a molecule in a cell. It is particularly preferred if the cell is a cell isolated in a tissue or organ, but more preferably not in a human or animal body. If the intracellularly active agent is a aptmer, then it is preferably an intracellularly active agent if it is capable of binding to an intracellular target molecule.
  • the aptmer is an intracellularly active agent if it is capable of binding to its target molecule under conditions such as are present in a cell.
  • Assays to determine these properties are known to those of skill in the art and include, for example, equilibrium binding assays under buffer conditions as they are intracellular (ionic strength and parent compound, pH, temperature) as disclosed in Example 1.
  • the target molecule of the L-nucleic acid, in particular of the functional L-nucleic acid is an intracellular receptor.
  • An intracellular receptor as used herein is preferably a chemical compound or a chemical structure, or a portion thereof, with which the functional L-nucleic acid interacts, and preferably one to which the functional L-nucleic acid binds the intracellular receptor, ie the chemical compound or the chemical structure or a part thereof, intracellular, d. H. is present in a cell, as it is preferably described in the preceding paragraph, is present. It is within the scope of the present invention that the intracellular receptor is the target molecule in the production of the functional nucleic acid, in particular of the functional L-nucleic acid.
  • the term receptor refers to any interaction partner, preferably a specifically binding interaction partner of the functional nucleic acid, ie an interaction partner interacting with the functional nucleic acid, which have a specific spatial structure, charge distribution, hydrophobicity distribution, etc.
  • the interaction partner corresponds to the target molecule of the functional nucleic acid as used in the production of the functional nucleic acid. It is within the scope of the present invention that a receptor can also be different from the target molecule used in the production of the functional nucleic acid, but the specific interaction by a Cross-reactivity of the functional nucleic acid between the interaction partner and the target molecule used in the production of the functional nucleic acid is caused.
  • the term "intracellular receptor” refers to a receptor that is present in a cell, or a receptor that may be present in a cell, naturally occurring in a cell, or present among such in a cell
  • the term "intracellular receptor” also refers to a receptor that is in conditions such as they are in a cell.
  • the term cell refers to a cell selected from the group comprising prokaryotic and eukaryotic cells.
  • the eukaryotic cell is selected from the group comprising fungal cells, plant cells, animal cells and human cells.
  • the term cell herein generally refers to a compartment bounded by a phospholipid double membrane, which in a preferred embodiment corresponds to a cytoplasmic membrane, which is separated from the environment by the membrane. The separation from the environment is not a complete separation, but allows an energy exchange and a mass transfer between the cell and the environment. Preferably, the mass transfer is limited.
  • the restriction of mass transfer is defined in the case of delimitation of the cell from the environment by a cytoplasmic membrane or by a membrane similar to a cytoplasmic membrane by the transport properties of the membrane.
  • the term "cell” herein thus also encompasses vesicles and / or compartments of a prokaryotic or eukaryotic cell as defined herein, which in turn may be present or present within a prokaryotic or eukaryotic cell as well as outside such a prokaryotic or eukaryotic cell
  • a vesicle or parts of a prokaryotic or eukaryotic cell surrounded by a cytoplasmic membrane which in one embodiment may be in a body fluid.
  • the conditions within such a cell substantially correspond to those which are present in a prokaryotic or eukaryotic cell, in particular the factors which affect the binding of the functional nucleic acid to it Influence the target molecule.
  • the body fluid is selected from the group consisting of blood, urine, cerebrospinal fluid, lymphatic fluid, serum, plasma, vaginal secretions, saliva and semen.
  • the receptor is defined by its function in a cell. Accordingly, the receptor may be selected from the group consisting of molecular receptors, enzymes, metabolic intermediates, signal peptides, chaperone molecules, and intracellular structures such as ribosomes, mitochondria, cytoskeletal elements such as cytoskeletal cells. Tubulin and actin filaments, endosomal particles, lysosomes, other intracellular structures such as vesicles, in particular intracellular vesicles comprises.
  • the term molecular receptor refers to a molecule that receives and propagates information within a cell, tissue, organ, or organism. The information is typically mediated by a molecule that interacts with the molecular receptor.
  • the molecular receptor is able to produce a signal.
  • a signal may be due to or manifest in the change in conformation and / or activity of the receptor.
  • the signal itself is able to relay the recorded or represented information in a different form.
  • the signal may preferably be a chemical, biochemical or electrical signal.
  • the molecular receptor is part of a reaction cascade, more preferably a signal cascade.
  • the information transmitted by a molecular receptor may be quantitative and / or qualitative information, for example regarding the presence of a compound and / or its concentration.
  • metabolite intermediates refers to all those compounds which occur as a component of catabolism as well as anabolism through metabolic activities in a cell.
  • the receptor is defined by its chemical nature.
  • the receptor is selected from the group comprising polypeptides, carbohydrates, nucleic acid, lipids, and combinations thereof.
  • polypeptide preferably refers to any polymer of two or more amino acids.
  • the amino acids are L-amino acids, but also D-amino acids can be used in the context of the embodiment.
  • nucleic acids preferably refers to a polymer of two or more nucleotides or nucleotide analogs known to those skilled in the art, which are either D nucleotides or L nucleotides or mixtures thereof.
  • Preferred combinations include glycosylated polypeptides and glycosylated lipids
  • a particular group of intracellular receptors are transcription factors and DNA-binding proteins that bind to an AT hook.
  • Exemplary transcription factors are given in the following Table 1:
  • AhR Arnt AML3b ATBF 1 -A
  • ER-alpha ER-beta EZH 1 FOXJ2 (long isoform)
  • FXR RXR-alpha GLI3 HEB1-p94
  • IA-1 IRF-1 C / EBPbeta KLF15 iASPP IRF-2 KLF7 iASPP-RAI IRF-3 Kox1
  • LXR-alpha RXR-alpha MEF-2C / delta8.32 MTF-1
  • Nrf1 MafG p160MBP Pax-4a
  • Nrf1 MafK p28 Modulator Pax-5
  • Nrf2 MafG p38erg Pax-6 / Pd-5a
  • Nrf2 MafK p40x; HTLV-I, T-cell Pax-7
  • Nrf3 MafK p49erg Pax-8c
  • Pbx1A HoxA5 PITX2A: Nkx2.5 POU3F4
  • Pbx1a Hoxb8 PITX2B: Nkx2.5 POU4F1 (s)
  • Pbx1A HoxC8 PITX2C: Nkx2.5 POU4F3
  • Pbx1A HoxD4 PITX3 POU5F1
  • Pbx1 a IPF1 PKN0X1 POU5F1A
  • Pbx1 B HoxA5 PLAGL1 POU5F1C
  • Pbx1 B HoxB7 PLAGL2 POU6F1
  • Pbx1B HoxB8 PLZF PPAR-alpha
  • Pbx1B HoxC8 PML PPAR-alpha: RXR-
  • Pbx1 B HoxD4 PML-3 alpha
  • Pbx1b PKN0X1 Pmx2a PPAR-beta
  • RAR-alpha RXR-alpha RORalphal Six-3
  • RAR-alpha RXR-beta RORalpha2 Six-4
  • RAR-alpha RXR-RORalpha3 Six-5 gamma RORbeta Six-6
  • RAR-beta RXR-alpha RPF1 Smad2
  • Sox14 STAT1 STAT3 TAF (II) 31
  • Sox7 STAT5B STAT5B TaMbeta Tal-2 TCF-1D TFIID
  • TCF-1 E TFIIE did; HIV-1, immunode- TCF-1F TFIIE-alpha efficiency virus type 1 TCF-1G TFIIE-beta
  • TR2-5 VITF VITF
  • Intracellular target molecules Another group of intracellular receptors are the intracellular target molecules shown in Table 2 below. Table 2: Intracellular target molecules
  • Acetyl-CoA-carboxylase amyloid ⁇ I A4-protein catalase Catechol dihydrouracil glycerol phosphate
  • Hemoglobin M Iwate Hydroxysteroid N-Acetylglucuronidase Hemoglobin M Saskatoon Dehydrogenase NAD-dependent Sterol-4 Hemoglobin Nancy Hypoxanthine Guanine Carboxylase Hemoglobin Philly Phosphoribosyltransferase NADase Hemoglobin Quong Sze IMP Dehydrogenase NADPH-dependent 3-Hemoglobin Raleigh Indollyase Oxosteroid Reductase Hemoglobin Ranier Inositol Phosphate Nexin Hemoglobin S Phosphatase N-ras Oncogene protein Hemoglobin Sealy int-1 Oncogene protein Nuclear protein B23 Hemoglobin Seattle isocitrate lyase Nucleoside diphosphate hemoglobin St.
  • HMGA proteins preferably denotes, in summary, the following proteins: HMGA1, HMGA1a, HMGA1b, and HMGA2.
  • HMGA proteins are modular and each have three DNA-binding domains, called “AT-hooks” or “AT-hooks”, represented as DBD1 to DBD3 in Figure 2, and a very acidic C- terminal area. It is obvious to those skilled in the art that antagonists that bind to one of the "AT-hooks” not only recognize the HMGA1 proteins and thereby the two splice variants HMGAIa and HMGAIb (see FIG. 2), but also cross-reactivity with similar ones In addition to HMGA2, many other proteins have sequences similar to "AT-hooks" and are in any case other receptors. Such proteins include those listed in Table 3:
  • the present invention also relates to L-nucleic acids and in particular Spiegelmers which are directed against any of the target molecules mentioned in Tables 1 to 3.
  • L-nucleic acid as an intracellularly active agent, particularly within a cell, to bind to an intracellular receptor, intracellularly various forms of interactions between the intracellular receptor and its interaction partners are influenced.
  • the intracellular use of L-nucleic acids thus makes it possible to influence interactions of proteins, nucleic acids, lipids, carbohydrates or combinations of proteins, nucleic acids, lipids, carbohydrates with one another and with one another.
  • an L-nucleic acid in particular a Spiegeimers
  • an intracellular agent or the method for binding an intracellular receptor is noteworthy that it is preferably an in vitro application or an in vitro method.
  • the target molecule is an intracellular target molecule.
  • the intracellular target molecule is one which is causally or non-causally involved in the disease or disease to be prevented, treated or diagnosed, but in each case results in its binding to an L-nucleic acid specifically binding thereto; that in the case of a drug, the disease is alleviated, prevented, or cured and / or in the case of a diagnostic agent, the disease or a disposition can be detected or diagnosed.
  • diagnosis includes a first diagnosis as well as subsequent diagnoses, particularly diagnoses or examinations, to, for example, track or determine the course of the disease or the stages of the disease.
  • the target molecule is an intracellular receptor as described herein, in particular a transcription factor, an intracellular target molecule or an HMG protein. It is very particularly preferred in the context of the present invention that the target molecule is present intracellularly, ie within a cell and the interaction influencing the disease and / or diagnosis between the L-nucleic acid and in particular the spiegelmer and the target molecule, ie the receptor, intracellularly.
  • the target molecule is outside of a cell and the interaction between the L- Nucleic acid and especially the Spiegeimer and the target molecule, ie the receptor, extracellular takes place.
  • HMGA proteins are known to be associated with carcinomas (including the breast, lung, skin, thyroid), as well as leukemias and lymphomas, as well as other malignant tumors such as the like.
  • Sarcomas rhabdomyosarcoma, osteosarcoma
  • mesenchymal tumors i.a.
  • HMGA Hamartomas (breast and lung), adipose tissue tumors (lipomas), pleomorphic adenomas of the salivary glands, uterine leiomyomas, angiomyxomas, breast fibroadenomas, polyps of the endometrium, and atherosclerotic plaques.
  • HMGA is an interesting therapeutic target.
  • Blockade of HMGA may be a suitable starting point for the control of cancer and prevent its metastatic spread.
  • L-nucleic acids directed against HMGA proteins are also useful for the diagnosis and / or therapy of viral diseases and arteriosclerosis due to the involvement of the HMGA proteins in the regulation of transcription of a variety of viral genes or the high expression of HMGA and in particular HMGA1 in the atherosclerosis affected tissue associated with neointimal vascular smooth muscle cells, macrophages and new blood vessels
  • nucleic acids preferably L-nucleic acids and preferably spiegelmers are capable of penetrating as such a phospholipid double membrane as a cytoplasmic membrane and then being intracellularly functional in the sense of - specific - interaction with the intracellular receptor
  • the efficacy of the introduction of L-nucleic acid can be influenced and in particular increased by the use of different techniques. These techniques include the use of chemical compounds or molecules as well as the use of physical measures. Whatever the nature, these techniques are generally referred to herein as delivery vehicles.
  • aptamers also have this property and, like the aptamers thus also together with the erfmdungsge- According to the composition can be used or used for the basically same purposes, applications and uses.
  • nucleic acid When using chemical compounds or molecules, it is further possible to distinguish whether the nucleic acid has to be modified for delivery or whether it does not have to be modified.
  • Modification for purposes of using a delivery vehicle is typically not required when the delivery vehicle is or comprises a vesicle, such as in liposomes, polypeptide vehicles, cyclodextrins, dendrimers, nano- and microparticles, and polyethyleneimine.
  • modification for purposes of using a delivery vehicle is typically required when the delivery vehicle uses receptor-mediated endocytosis, fusogenic peptides, signal peptides, or biopsy conjugates.
  • the group of physical techniques includes in particular electroporation and iontophoresis.
  • a phospholipid double membrane such as a cytoplasmic membrane
  • a functional nucleic acid such as an aptamer and / or a gelator
  • Liposomes consist of artificial cationic lipids such as N- [1- (2,3-dioleoyloxy) propyl] -N, N, N-trimethylammonium chloride (DOTMA) and N- [1- (2,3-dioleoyloxy) propyl] - N, N, N-trimethylammonium sulfate (DOTAP), in which the cationic groups interact with the negatively charged nucleic acids and neutralize their anionic charge. Transport is via endocytosis (PNAS, 93: 11493-11498, 1996).
  • DOTMA N- [1- (2,3-dioleoyloxy) propyl] -N, N, N-trimethylammonium chloride
  • DOTAP N- [1- (2,3-dioleoyloxy) propyl] - N, N, N-trimethylammonium sulfate
  • Transport is via endocytosis (PNAS, 93:
  • cationic liposomes are cytotoxic, especially at higher concentrations, limiting their use in vitro and in vivo (Biochem Biophys Res Commun, 197: 818, 1993, Biochem Biophys Res Commun, 1372: 55-68, 1998).
  • a non-toxic formulation is the amphiphilic pyridinium-based lipid SAINT-2 (Nucleic Acids Res, 29: 2079-2087, 2001).
  • An alternative are also pH-sensitive liposomes consisting of amphipatic molecules such as cholesteryl hemisuccinate (CHEMS) and dioleoylphosphatidylethanolamine (DOPE) (J Pharmacol Exp Ther, 297: 1129-1136, 2001).
  • CHEMS cholesteryl hemisuccinate
  • DOPE dioleoylphosphatidylethanolamine
  • Receptor-mediated endocytosis utilizes transport mechanisms that are already present in the cell membrane.
  • the nucleic acid is covalently linked to a transporter protein ("carrier" protein) via a poly-L-lysine (PPL) linker, the selection of the transporter protein being dependent on the ability to particular receptors of the cell membrane
  • PPL poly-L-lysine
  • Cell-specific transport can be achieved, for example, by targeting an antisense phosphorothioate directed against c-myc into M-14 human melanoma cells (Anticancer Res, 17: 29-35
  • effective delivery by RME depends not only on the affinity of the receptor for the ligand but also on the limitation of the receptor selected on the cells, especially in vivo, and the inactivated or amplified ligand must be obtained be on the therapeutic result to avoid possible toxicity of the transport vehicle.
  • Fusogenic peptides have been used to allow peptide-oligonucleotide conjugates to fuse with the cell membrane and thus to facilitate transport into the cell (Bioconjug Chem., 9: 466-475, 1998; Bioconjug Chem., 6: 43-53 , Nucleic Acids Research, 25: 2730-2736, 1997).
  • NLS nuclear localization signals
  • IP signal import peptides
  • Blocks of polypeptides allow vesicles to be formed analogously to viral capsids that serve as potential delivery vehicles for intracellular transport (Nat Materials, 3 (4): 244-8, 2004).
  • lipophilic conjugates provide a way to increase the ability of oligonucleotides to bind to lipoproteins and thereby improve intracellular delivery.
  • the best studied conjugate is cholesterol (Antisense and Nucleic Acid Drug Development, 12: 103-128, 2002).
  • Cyclodextrins are cyclic oligosaccharides that have a central hydrophobic cavity and multiple hydroxyl groups on the outer surface. Cyclodextrins have thus already been used for the transport of antisense oligonucleotides into human T cell lines (Antisense Res Dev, 5: 185-192, 1995) and also in vivo for intracellular transport or intracellular delivery or delivery of immunogenic CpG sequences (Biochem Pharmacol, 52: 1537-1544, 1996). Various formulations of cyclodextrins can be found in the review by Davis and Brewster (Nature Reviews Drug Discovery 3: 1023-1035, 2004).
  • Dendrimers are highly branched macromolecules composed of repetitive units of - typically - polyamides.
  • the molecules carry on their surface functional groups such as primary amino groups, which interact with other molecules through electrostatic interaction.
  • surface functional groups such as primary amino groups, which interact with other molecules through electrostatic interaction.
  • complex, rapid, and highly reproducible complex formation occurs, resulting in complexes with weak cytotoxicity (Nucleic Acids Research, 28: 4225-4231, 2000, Clin Cancer Res, 7: 3606-3612, 2001;
  • Cyanoacrylate nanoparticles have been tested since the early 1990's for delivery or delivery of oligonucleotides.
  • the interaction of oligonucleotides with the nano- Particles are formed by ion pairs of the anionic charge of the oligonucleotides with different hydrophobic cations, primarily with charged nanoparticles.
  • PIHCA polyisohexyl
  • PIBCA polyisobutyl
  • PHCA polyhexycyanoacrylates
  • Nanoparticles have also been used for in vivo use (Biochem Biophys Res Commun, 279: 401-406, 2000, Pharm Res, 13: 38-43, 1996).
  • Microparticles or so-called microspheres are typically biodegradable polymers poly (d, l-lactide-co-glycolide [P (LA-GA)] and are used for the sustained release of oligonucleotides (J Pharm Sei, 91: 790-799, 2000; J Controlled Release, 69: 197-207, 2000; J Drug Traget, 5: 291-302, 1998).
  • poly d, l-lactide-co-glycolide [P (LA-GA)
  • Electroporation is a transport technology that uses a strong electric field to destabilize the lipid double membrane, thereby permeabilizing the cell membrane and thus allowing transport of the substance to be administered, which may also be ionized (iontophoresis), into the cell. Electroporation has been used successfully to facilitate transdermal delivery of oligonucleotides ex vivo and in vivo (Int J Pharm, 184: 147-156, 1999, J Drug Traget, 5: 275-289, 1998, Pharm Res, 15: 1596 Int J Cancer, 85: 260-266, 2000; Biochem Biophys Res Commun, 212: 286-292, 1995; Blood, 88: 731-741, 1996).
  • shock waves high pressure acoustic pulses
  • Ultrasound is also an acoustic technology comparable to the shock waves, but uses higher frequency ranges (MHz instead of Hz) and shorter use times (seconds to minutes) and has already been supportive for gene therapy. See (Gene Gene Ther, 7: 1339-1346, 1996; Invest Radiol, 32: 723-727, 1997; Ultrasound Med Bio, 25: 1451-1457, 1999).
  • a novel delivery vehicle which is particularly suitable for the transport of functional nucleic acids such as aptamers, preferably functional L-nucleic acids and most preferably Spiegelmeren.
  • the delivery vehicle is a micelle-like or liposomal-like structure based on polyethyleneimine.
  • polyethyleneimine may, in principle, be present as a linear or branched polyethylenimine and also be used, with branched polyethylenimine in the branched form being particularly preferred.
  • polyethyleneimine can be present as a high molecular weight or low molecular weight polyethyleneimine and also be used.
  • high molecular weight polyethyleneimine has a molecular weight of about 800 kDa and low molecular weight polyethyleneimine has a molecular weight of about 3 kDa.
  • a polyethyleneimine having an average molecular weight of about 25 kDa is preferred, which is more preferably a branched polyethylenimine having a molecular weight of about 25 kDa.
  • the nucleic acid to be delivered itself also carries a modification. It is preferred if the modification is selected from the group comprising PEG radicals. It is further preferred that the PEG moiety has a molecular weight of about 1,000 to 10,000 Da, more preferably about 1,200 to 5,000 Da, and more preferably about 1,500 to 2,500 Da, and most preferably about 2,000 Da.
  • a quotient of the total number of nitrogen groups of the polyethyleneimine and the total number of phosphate groups of the nucleic acid to be delivered or packaged with or by the delivery vehicle is from about 1 to 20, preferably Example of about 1.5 to 10, more preferably from 2 to 5 and most preferably adjusted from about 2 to 3 or realized.
  • the delivery vehicle according to the invention thus also makes it possible to use the mechanism of the intracellular transport of nucleic acids via condensation or packaging with charged particles or reagents and associated change in the charge of the overall complex, also for functional nucleic acids such as aptamers and in particular L-nucleic acids such as Spiegelmers.
  • This complex is easily absorbed via endocytosis and thus enters the cytosol of the cell.
  • a disadvantage of this method is the stability of the DNA / RNA or the release of the nucleic acid from the endosomal compartment.
  • a lysosome is rapidly formed from the constricted endosome by the introduction of proteases or nucleases and by protonation of the compartment.
  • Nucleases digest the nucleic acids there. However, this does not apply to aptmers, as they are nuclease-stable due to their unnatural configuration. In addition, nucleic acids are not stable in the acidic milieu of the lysosome. However, this applies more to nucleic acids from DNA, less to nucleic acids made up of RNA. Through exocytosis or degradation in the Golgi apparatus, the entire complex is quickly transported back out of the cell and thus only a few nucleic acids enter the cell. One of the challenges posed by a suitable transfection system is thus the stabilization as well as the release of the nucleic acid from the endosomes into the cytosol. In terms of stability, RNA aptmers have ideal properties for transfection of eukaryotic cells since they are not cleaved by enzymes as enantiomers.
  • the transfection system according to the invention provided or designed with the delivery vehicles according to the invention is based on the formation of micelles from nucleic acids and branched polyethyleneimine (PEI).
  • PEI polyethyleneimine
  • the phosphodiester backbone of the nucleic acids interacts with the free nitrogen positions of the PEI and cross-branches to form small micelles, which have a positive charge due to the PEI.
  • These micelles are easily taken up by constricting the plasma membrane as endosomes from a cell.
  • the PEI now buffers incoming protons, whereupon many chloride ions inside the endosome lead to a swelling of the compartment due to the osmotic pressure.
  • composition according to the invention is administered as an aerosol.
  • spiegelmers can be derivatized with signal peptides for intracellular as well as intranuclear delivery, as well as for organ specific delivery Coupling of signal peptides directly to the polyethyleneimine can be done for a localized localization to organs or within the cell can be used.
  • the present invention relates to L-nucleic acids, particularly aptmers, and more preferably RNA aptmers directed against HMGA proteins.
  • the disclosed herein Spiegelmers against HMGA proteins are particularly examples of the present application also underlying finding that L-nucleic acids and aptmers in particular are able to overcome a phospholipid double membrane or a cytoplasmic membrane of a cell and intracellularly with the intracellular To bind receptor on the specific binding of which they have been selected.
  • HMGA high mobility group
  • HMGB HMGB
  • HMGN HMGN
  • HMGA HMGA
  • AT-hook HMGA
  • the HMGA family includes two genes, HMGA1 and HMGA2. From HMGA1, three different proteins can be expressed by alternative splicing (HMGAIa [formerly HMG-I], HMGAIb [formerly HMG-Y], HMGAIc [formerly HMG-I / R]), HMGA2 only one (HMGA2 [earlier : HMGI-C]).
  • HMGA1a, HMGA1b and HMGA2 are polypeptides of approximately 100 amino acids in length and have a modular sequence organization: they have three strongly basic regions ("AT-hooks") which bind the narrow minor groove of double-stranded AT-rich DNA (Reeves & Nissen 1990)
  • the C-terminus contains many acidic amino acids, which have no stable secondary structure in solution and do not adopt a defined conformation until complexed with DNA or other proteins (Huth et al 1997) to the most highly modified proteins in the mammalian cell nucleus and are phosphorylated, acetylated, and methylated (Reeves & Beckerbauer 2001).
  • HMGA proteins do not have any transcriptional activity per se, but as so-called architectural transcription factors, through their protein-protein and protein-DNA interactions, they organize the formation of the nucleoprotein-DNA transcription complex (Wolffe 1994). They thus have an activating or inhibitory influence on the expression of a multiplicity of genes.
  • the most prominent example of a positive regulation is the involvement of HMGA1 in the regulation of IFN- / 3 (Thanos & Maniatis, 1992).
  • the HMGAIb stimulates the binding of NF- ⁇ B and ATF-2 to the DNA double helix and at the same time alters the DNA structure such that NF- ⁇ B and ATF-2 interact with each other and presumably also with the rest of the transcription machinery (Thanos & Maniatis 1992, Du et al 1993).
  • Another transcriptional activating effect associated with arteriosclerotic pathogenesis is HMGA1-induced CD44 gene regulation (Foster et al 1998).
  • CD44 is a cell surface glycoprotein and involved in the migration and proliferation of smooth muscle cells after endothelial injury (Jain et al 1996, Cuff et al 2001).
  • CD44 Transcriptional regulation of CD44 is induced by the binding of c-Fos and c-Jun to the AP-I binding site in the CZW promoter and enhanced by the binding of HMGA1.
  • Studies in rats have shown that CD44 overexpression leads to an increased recruitment of smooth muscle cells and has a direct influence on the development of arteriosclerotic lesions (Pellacani et al 1999, Foster et al., 1998, 2000).
  • HMGA1 gene located in the chromosomal band 6 ⁇ 21.3 and the HMGA2 gene localized in the region 12ql4-15 revealed that they are mainly active in processes of cellular differentiation. Accordingly, strong expression of these genes is found during embryonic development and in undifferentiated cells (Chiappetta et al 1996) as well as in growth factor-stimulated cells (Friedman et al 1993, Johnson et al 1990, Ogram et al 1995, Holth et al 1997).
  • HMGA1 In the adult, differentiated tissue HMGA1 is strongly expressed only in the retina, while in the other tissues HMGA2 is not found at all and HMGA1 is found only in very low concentrations (Bussemakers et al 1991, Chiappetta et al 1996, Rogalla et al 1996 Zhou et al 1995; Chau et al 2000).
  • HMGA proteins in differentiated normal tissue is thereby associated with the growth and differentiation of adipocytes (Zhou et al 1995, Anand & Chada 2000, Melillo et al 2001), the proliferation of smooth muscle cells in the blood vessels after vascular injury (Chin et al 1999), the immune response in inflammatory reactions (Pellacani et al 1999) and apoptotic processes (Diana et al 2001, Sgarra et al 2003).
  • the amount of HMGA1 varies depending on the proliferation rate of the cells (Johnson et al 1990).
  • HMGA1 expression is concentrated on specific organs of ecto-, meso- or endodermal origin, while HMGA2 is restricted to mesenchymal tissues. So far, there is no information on the phenotype of HMGA1 knockout mice, possibly because the lack of this factor damages embryonic development too much.
  • HMG ⁇ 2-knockout mice are dwarf and have low levels of adipose tissue (Zhou et al 1995) and are also resistant to diet-induced obesity (Anand & Chada 2000).
  • HMGA2 or HMGAlb expression is undetectable in adipose tissue of normal mice, but dramatically increased in fat of fat or diabetic mice (Chada et al., 2004), suggesting an association between obesity and HMGA expression
  • HMGA1 overexpression of HMGA1 influences (Reeves et al 2001):
  • Intermediary filament markers such as cytokeratin, type 1
  • apoptosis regulators such as TRARl 5
  • Oncogenic and tumor suppressor genes such as MET
  • Angiogenesis regulators such as FGFR2
  • cell-cell interaction genes such as cadherin 12
  • HMGA1 Abnormal regulation of HMGA1 could therefore lead to general alterations in gene expression, thereby significantly contributing to the formation of transformed and / or metastatic phenotypes.
  • HMGA proteins appear to play different roles in mesenchymal or epithelial tumors: in malignant epithelial tumors, HMGA expression is more associated with later stages of carcinogenesis, while benign - rarely-converting mesenchymal tumors - already express HMGA in early hyperplasia. This indicates that HMGA proteins in tissues of different embryonic origins perform different functions, which also directly affects the corresponding applications. fertilize the L-nucleic acids according to the invention in the diagnosis and / or treatment of - corresponding - diseases, as shown in more detail below darg Dead.
  • HMGA 1 expression of the tumor correlates with its metastatic potential and thus is a characteristic feature of a malignant transformed cell (Giancotti et al 1987).
  • HMGAl-associated - in this case benign, mesenchymal tumors - are characterized by chromosomal alterations in the chromosomal HMGL4 / region 6p21.3. Such aberrations have so far been among others for
  • HMGA proteins Aberrations in the genetic mechanisms that control growth and proliferation are the primary cause of carcinogenesis.
  • the expression of HMGA proteins is strongly associated with tumor development, as shown in a number of papers (Giancotti et al., 1987, 1989, 1993).
  • HMGA2 expression was found in chemically or virally generated as well as in spontaneously obtained tumors, whereas in non-transformed cells or healthy tissue this protein could not be detected (Giancotti et al., 1989).
  • oncogenic retrovirus-infected cells in which the synthesis of HMGA2 expression had been specifically blocked lacked various phenotypic markers for transformation (Berlingieri et al., 1995).
  • HMGA2 knockout MMse show dwarfism, d. H. the animals are about 60% smaller than wild-type mice. However, these dwarf mice have a high resistance to chemically induced skin tumors.
  • the main cause of mortality and morbidity of cancer patients is the metastatic spread of the primary neoplasm in the body. Metastasis is not a simple process, as successful colonization of distant organs by scattered neoplastic cells must pass through many stages. Neoplastic cells must detach from the primary neoplasm, enter the bloodstream, extravagate at distant locations, and finally proliferate again in the parenchyma of the corresponding organ. Many genes are involved in the different stages of this highly complex metastatic cascade express proteins such as proteases, adhesion molecules, motility factors and angiogenic factors.
  • HMGA1 HMGA1 gene as one of the most important factors controlling this process is a valid candidate for this.
  • the gene products of HMGA1 affect the transcription of many genes that are important for successful metastasis. For example, other metastasis-associated genes have been shown to be less expressed when suppressed by HMGA1 expression (Battista 1998, Vallone 1997).
  • HMGA1 is therefore an interesting therapeutic target molecule.
  • the blockade of HMGA1 is therefore in principle suitable for controlling the cancer and preventing its metastatic spread (Evans 2004, Sgarra 2004).
  • antisense RNAs directed against HMGA transcripts in cancer cells in vitro, it was possible to reduce cell proliferation or even to induce apoptosis (Masciullo 2003, Scala 2000, Chau 2003).
  • the animal model has shown that gene therapy (adoenoviral expression of antisense RNAs directed against HMGA transcripts) drastically reduces the growth of various pancreatic cancer xenografts (Trapasso et al 2004).
  • HMGA1 could continue to be used as a prognostic diagnostic marker to determine which patients would benefit from more aggressive cancer therapy. There is a close correlation between the degree of malignant transformation and the amount of HMGA1 expressed. This in turn can be correlated with a poor prognosis in many human cancers, such as prostate (Tamimi 1996, Bussemakers 1991) and colorectal carcinoma (Abe 1999) or neuroblastoma (Giannini 2000).
  • HMGA proteins are considered by many viruses to be control factors for the expression of viral genes or cofactors provided by the host cell, among others
  • herpes simplex virus Panagiotidis 1999, French et al 1996)
  • HIV-1 virus (Henderson et al 2000) used.
  • HMGA proteins are implicated in the regulation of transcription of a variety of viral genes in a host cell. Examples include the regulation of the expression of the early and late expressed genes of the human papovavirus JC (Leger et al., 1995), regulation of the EBNA1 (Epstein-Barr virus nuclear antigen 1) gene of the Ebstein-Bar virus (EBV), which is responsible for the control of viral latency is, (Schaefer et al., 1997), regulation of the IE-3 (immediate early) gene of herpes simplex virus-1 (HSV-I), which encodes the early expressed protein ICP4 (Panagiotidis et al., 1999 ), Regulation of the latent phase active promoter 2 of HSV-I (French et al., 1996) and regulation of the LTR (long terminal repeats) promoter of the human HIV-1 virus (Henderson et al., 2000).
  • EBNA1 Epstein-Barr virus nuclear antigen 1
  • HSV-I
  • HMGA1 also appears to play a decided role as an architectural cofactor in integrating the viral DNA of the HIV-I virus, the Moloney murine leukemia virus (MoMuLv) and sarcoma poultry flu virus (ASV) into the human genome and thus appears to be an interesting therapeutic approach of antiviral Therapy (Van Maele et al 2006, Li et al 1998, Hindmarsh et al., 1999)
  • inhibitors of HMGA proteins are also suitable for the treatment and diagnosis of viral infections (Reeves & Beckerbauer 2002).
  • HMGA proteins in various diseases or their suitability as diagnostic markers
  • directed L-nucleic acid and in particular aptmers can be used for the prevention, therapy and diagnosis of precisely these diseases.
  • Particularly preferred aptmers are the aptmer described herein.
  • the individual aptmers have been generated for a given HMGA protein, as a result of the domain approach illustrated in Example 2, these also allow cross-reactivity with other HMGA proteins, as can be seen in US Pat in Fig. 2 shows alignment.
  • nucleic acids of the invention have a number of structural motifs that define a class of aptmers that bind to HMGA proteins as intracellular receptors. The various structural motifs are further detailed in Example 1.
  • the nucleic acids according to the invention also comprise those nucleic acids which are substantially homologous to the sequences specifically disclosed herein.
  • the term "substantially homologous” herein is preferably understood to mean that the homology is at least 75%, preferably 85%, more preferably 90%, and most preferably more than 95, 96, 97, 98 or 99%.
  • nucleic acids or nucleic acids according to the present invention should furthermore also include those nucleic acids which comprise nucleic acid sequences as disclosed herein or parts thereof, preferably to the extent that the nucleic acids or the said parts thereof are involved in binding to HMGAs. Proteins are involved.
  • nucleic acid can be derived from those disclosed herein, e.g. B. by shortening or truncation.
  • a truncation may refer to either or both ends of the nucleic acids as disclosed herein.
  • a truncation may also involve the inner sequence of nucleotides, i. H. it may involve nucleotide (s) between the 5 'and 3' terminal nucleotides, respectively.
  • truncation should also refer to the deletion of as little as a single nucleotide from the sequence of the nucleic acids disclosed herein. Shortening may also refer to more than one region of the nucleic acid (s) of the invention, wherein each of these regions may be as small as one nucleotide in length.
  • the nucleic acids according to the present invention may furthermore be either D-nucleic acids or L-nucleic acids.
  • the nucleic acids according to the invention are L-nucleic acids.
  • one or more parts of the nucleic acid are present as D-nucleic acids, or at least one or more parts of the nucleic acids are L-nucleic acids.
  • the term "part" of the nucleic acids is not intended to refer to any nucleotide, and such nucleic acids are generally referred to herein as D- or L-nucleic acids.
  • the nucleic acids L-acids according to the present invention from L-nucleotides and comprise at least one D-nucleotide.
  • a D-nucleotide is preferably attached to a part other than the region (s) defining the nucleic acids according to the present invention, preferably those parts thereof which interact with other parts of the nucleic acids.
  • such a D-nucleotide is attached to the end of each region or nucleic acid according to the present invention.
  • such D-nucleotides may function as a spacer or a linker which preferably binds modifications such as PEG and HES to the nucleic acids of the present invention.
  • the nucleic acids according to the invention also include those which are part of a longer nucleic acid, wherein these longer nucleic acids can comprise several parts, wherein at least one part is a nucleic acid according to the present invention or a part thereof.
  • the other part or parts of these longer nucleic acids may be either a D-nucleic acid or an L-nucleic acid. Any combination may be used in connection with the present invention and for the purposes or uses as disclosed for the nucleic acids of the invention herein.
  • This other part or parts of the longer nucleic acid may have a function other than binding and in particular binding to HMGA protein.
  • One possible function is to interact with other molecules, e.g. B. for purposes of immobilization, cross-linking, detection, amplification or modification or molecular weight increase to allow.
  • L-nucleic acids as used herein are nucleic acids consisting of L-nucleotides, preferably consisting entirely of L-nucleotides.
  • D-nucleic acids are nucleic acids consisting of D-nucleotides, preferably consisting entirely of D-nucleotides.
  • the nucleic acid according to the invention consists of D-nucleotides, L-nucleotides or a combination thereof of both, wherein the combination, for. B., is a random combination or sequence of regions consisting of at least one L-nucleotide and at least one D-nucleic acid
  • the nucleic acid may consist of one or more deoxyribonucleotides, ribonucleotides, and combinations thereof.
  • the present invention relates to a pharmaceutical composition which consists of at least one of the nucleic acids according to the invention in combination with one or more other nucleic acids, wherein the other nucleic acids preferably bind / bind to target molecules other than HMGA protein or one of performs / exercise various functions on the nucleic acids of the invention.
  • L-nucleic acids are enantiomers of naturally occurring nucleic acids.
  • D-nucleic acids are not very stable in aqueous solutions and especially in biological systems and in biological samples due to the extensive presence of nucleases.
  • Naturally occurring nucleases, especially animal cell nucleases are unable to degrade L-nucleic acids.
  • the biological half-life of L-nucleic acid in such a system, including the human and animal body is significantly increased. Due to the lack of degradability of L-nucleic acids no nuclease degradation products are produced and thus no side effects are observed.
  • This aspect effectively delimits the L-nucleic acid from any other compounds used in the therapy of diseases and / or disorders, and the presence of HMGA or its causal involvement comprises L-nucleic acids that specifically bind to a target molecule through a mechanism, which is different from the Watso ⁇ -Crick base pairing, or aptamers which are partially or fully composed of L-nucleotides, especially those portions of the aptamer involved in the binding of the aptamer to the target molecule are referred to as Spiegelmers.
  • nucleic acids according to the invention are available as single-stranded or double-stranded nucleic acids. pelstrlindige nucleic acids may be present.
  • the nucleic acids according to the invention are single-stranded nucleic acids which, as a consequence of the primary sequence, have defined secondary structures and can thus also form tertiary structures.
  • the nucleic acids according to the invention can also be double-stranded in the sense that two strands which are complementary or partially complementary to one another are hybridized with one another. This confers stability to the nucleic acids, which will be particularly advantageous when the nucleic acid is present in the naturally occurring D-form rather than the L-form.
  • nucleic acids according to the invention can be modified. Such modifications may involve single nucleotides of the nucleic acid and are well known in the art. Examples of such modification include, inter alia, described in Venkatesan N. et al. (2003) Curr Med Chem. Oct; 10 (19): 1973-91; Kusser, W. (2000) J. Biotechnol. 74: 27-38; Aurup, H. et al. (1994) Nucleic Acids Res, 22, 20-4; Cummins, LL et al, (1995) Nucleic Acids Res, 23, 2019-24; Eaton, BE et al. (1995) Chem Biol, 2, 633-8; Green, LS.
  • nucleic acid according to the present invention may comprise at least one LNA nucleotide.
  • the nucleic acid according to the present invention consists of LNA nucleotides, preferably entirely of LN A nucleotides.
  • the nucleic acids according to the present invention may be a multi-part nucleic acid.
  • a multi-part nucleic acid as used herein is a nucleic acid consisting of at least two nucleic acid strands. These at least two nucleic acid strands form a functional unit, wherein the functional unit is a ligand for a target molecule.
  • the at least two strands of nucleic acid can be derived from one of the nucleic acids of the invention either by cleaving the nucleic acid to generate two strands, or by synthesizing one nucleic acid corresponding to a first part of the invention, ie total nucleic acid, and another nucleic acid corresponding to the second part of the total nucleic acid , It is recognized that Both cleavage and synthesis can be used to generate a multi-part nucleic acid where more than the two strands may be present as described above.
  • the at least two strands of nucleic acid are preferably different from two strands that are complementary to each other and hybridize to each other, although there may be some degree of complementarity between the different nucleic acid parts.
  • the present inventors have found that the nucleic acids according to the present invention have a very advantageous K D value range or dissociation value range and thus a very advantageous binding constant.
  • An example to determine the binding constant is the use of an equilibrium binding assay as described in Example 1.
  • the K D value of the nucleic acids according to the invention is preferably less than 1 ⁇ M.
  • a K D value of about one ⁇ M should be characteristic of non-specific binding of a nucleic acid to a target.
  • the KD value of a group of compounds such as the nucleic acids according to the present invention will vary within a particular range.
  • the above-mentioned K D of about 1 ⁇ M is a more preferred upper limit of the K D value.
  • the preferred lower limit for the KD of the target molecule-binding nucleic acids may be about picomolar or lower. It is within the scope of the present invention that the K D values of individual nucleic acids which bind to HMGA are preferably within this range.
  • Preferred ranges can be selected by selecting a first number within this range and a second number within that range.
  • Preferred upper values are 0.25 ⁇ M, 0.1 ⁇ M, preferred lower values are 100 nM, 10 nM, 1 nM and 0.05 nM.
  • the nucleic acids according to the invention preferably bind to HMGAIb at 37 ° C. in solution with a dissociation constant K D ⁇ 20 nM, as shown in Example 2.
  • the nucleic acids according to the present invention may be of any length provided that they are still capable of binding to the target molecule. It will be appreciated in the art that certain lengths of the nucleic acids according to the present invention are preferred. Typically, the length is between 15 and 120 nucleotides. It will be further appreciated by those skilled in the art that any integer between 15 and 120 is a preferred length of potential for the nucleic acids of the present invention. Preferred ranges for the length of the nucleic acids according to the present invention are lengths of about 20 to 100 nucleotides, about 20 to 80 nucleotides, about 20 to 60 nucleotides, about 20 to 50 nucleotides and about 30 to 50 nucleotides.
  • ⁇ nucleic acids of the invention can be modified.
  • a particularly preferred form of modification is pegylation. This is the modification of the nucleic acids according to the invention by coupling with polyethylene glycol (PEG) or other groups.
  • PEG polyethylene glycol
  • the nucleic acids according to the invention are provided as a physiological solution for local or systemic administration.
  • the pharmaceutical composition according to the present invention thus comprises at least one of the nucleic acids according to the present invention and preferably a pharmaceutically acceptable binder.
  • a binder may be any known or known binder in the art.
  • such a binder is any binder as described in connection with the preparation of the medicament as disclosed herein.
  • the pharmaceutical composition comprises another pharmaceutically active agent. It is within the scope of the present invention that the medicament described herein is the pharmaceutical composition as described herein.
  • the pharmaceutical composition is for intravenous administration.
  • compositions can be administered intramuscularly, intraperitoneally, or subcutaneously.
  • Other routes of administration are oral or intranasal, with the preferred mode of administration being the least invasive, while retaining the efficacy of the pharmaceutical composition or pharmaceutically active agent.
  • the nucleic acids of the invention are preferably contained or dissolved as such or in association with the pharmaceutical composition of the invention in a pharmaceutically acceptable solvent.
  • solvents are especially those selected from the group consisting of water, physiological saline, PBS, or a glucose solution, especially a 5% glucose solution.
  • a carrier can, for. B., water, buffer, PBS, glucose solution, preferably a 5% glucose solution (iso-osmotic), starch, sugar, gelatin or any other acceptable vehicle.
  • Such carriers are generally known to those skilled in the art.
  • the pharmaceutical composition contains at least one of the nucleic acids according to the invention in their various embodiments, including, but not limited to, the nucleic acid as a co-conjugate as described herein.
  • the medicament comprises a further pharmaceutically active agent.
  • Such further pharmaceutically active agents are, for example, protease inhibitors, proliferation inhibitors and angiogenesis inhibitors and / or agents which have a cystostatic effect.
  • another pharmaceutically active agent is another nucleic acid according to the present invention.
  • the medicament comprises at least one or more nucleic acids that bind to a target molecule other than HMGA or having a function different from any of the nucleic acids of the present invention.
  • the pharmaceutical composition according to the present invention may be used for the treatment, diagnosis and / or prevention of any of the diseases or disorders described herein.
  • the present invention relates to a method of treating a subject in need of such treatment, the method comprising administering a pharmaceutically active amount of at least one of the nucleic acids according to the present invention.
  • the subject is suffering from or at risk of contracting such a disorder, the disorder being any of those disclosed herein, in particular, any disorder associated with the use of any of the nucleic acids according to the present invention present invention for the preparation of a medicament is described.
  • HMGA proteins and their genes have been increasingly associated with the diagnosis and prognosis of neoplastic diseases and have been proposed as potential biomarkers.
  • the level of expression of HMGA la / b proteins is very low, if detectable at all.
  • Increased HMGA la / b protein expression is characteristic of the phenotype of a variety of tumors and metastases of various cancers (Sarhadi et al., 2006, Balcercak et al., 2005, Bliese et al., 2006, Chang et al., 2005, Peters et al.
  • HMGA1a / b expression level in biopsies and their histological characterization represents a diagnostic approach for the early detection, prognosis and identification of neoplastic diseases, in particular the diseases and conditions described above. Furthermore, an association of HMGA1 proteins with arteriosclerotic plaques is described in the literature (Schlueter et al., 2005).
  • HMGA1 regulates CD44, one of the major target genes for plaque formation. In comparison with the surrounding tissue, the affected regions, such as neointimal, vascular smooth muscle cells, macrophages and new blood vessels, show a high expression of HMGA1.
  • HMGA1 seems to be one of the mediators in the development of plaques and thus represents a target molecule for the diagnosis.
  • biotinylated HMGA1 a / b recognizes baclimeric 5 '-bio-NOX-A50 binding bacteria in the Western blot HMGA1 a / b as a single band in cancer cell lines. Furthermore, as described in Example 2, recombinantly expressed HMGAIb protein could be detected.
  • the detection of the biotinylated aptmer is carried out, for example, via an anti-biotin antibody conjugated by means of Horse Raddish Peroxidase (HRP).
  • HRP Horse Raddish Peroxidase
  • HMGA la / b Another approach is the in vivo diagnosis of HMGA la / b, in which the nucleic acids according to the invention can be used. Tumors and metastases are often embedded by necrotic tumor cells, which release HMGA1 a / b into the surrounding tissue. The detection of extracellular HMGA la / b represents an approach to the diagnosis of tumors and metastases embedded in healthy tissue.
  • a diagnostic or diagnostic agent or diagnostic agent is capable of detecting, either directly or indirectly, an HMGA protein, preferably HMGA la / b as described herein, and more preferably HMGAla / b as described herein in connection with U.S. Patent Nos. 4,646,974; different disorders and Diseases.
  • the diagnostic agent is suitable for detection and / or aftercare for any of the diseases or diseases described herein. Such detection is possible by the binding of the nucleic acids according to the present invention to HMGA1 a / b. Such binding can be detected either directly or indirectly.
  • the corresponding methods and means are known to those skilled in the art.
  • the nucleic acids according to the present invention may comprise a label which allows the detection of the nucleic acids according to the present invention, preferably the nucleic acid which is bound or capable of binding to HMGA protein and preferably HMGA1 a / b.
  • a label is preferably selected from the group consisting of radioactive, enzymatic and fluorescent labels.
  • any known antibody-engineered assays can be adapted for the nucleic acids of the present invention with the target-binding antibody replaced by a target-molecule-binding nucleic acid.
  • detection is preferably by a secondary antibody modified with radioactive, enzymatic or fluorescent labels and binding to the target-binding antibody on its Fc fragment.
  • the nucleic acid is modified with such a label, whereby preferably such a label is selected from the group consisting of biotin, CY-3 and CY-5, and such a label is detected by an antibody directed against such label, e.g. As an anti-biotin antibody, an anti-CY-3 antibody or an anti-CY5 antibody or in the case that the label is biotin, the label is detected by streptavidin or avidin, which binds naturally to biotin.
  • an antibody, streptavidin or avidin is in turn preferably modified with a corresponding label, e.g. As a radioactive, enzymatic or fluorescent label, analogous to a secondary antibody.
  • the nucleic acids according to the present invention are detected or analyzed by a second detection means, wherein the detection means is a molecular beacon
  • the detection means is a molecular beacon
  • molecular beacons are nucleic acid probes that have a reverse complement to the are the nucleic acid sample, and therefore hybridize with a portion of the nucleic acid sample to be detected which is to be detected.
  • the fluorophore groups of the molecular beacon are separated from each other, resulting in the change of the fluorescence signal, preferably a change in intensity. This change correlates with the amount of nucleic acid sample present.
  • nucleic acids according to the invention can be used correspondingly as L-nucleic acids within the scope of the various aspects disclosed herein.
  • the nucleic acids according to the invention can furthermore be used as starting material for the design of pharmaceutical active ingredients (English, drug design). Basically, there are two possible approaches. One approach is to screen libraries of compounds, such libraries of compounds being preferably low molecular weight (small molecule) libraries. Such libraries are known to those skilled in the art. In one embodiment, the screening is high throughput screening. Preferably, high-level screening is fast, efficient, and is performed as a trial-and-error evaluation of drugs in a target-molecule-based assay.
  • the nucleic acids can be used for the rational design of drugs.
  • the rational design of drugs is the design of a pharmaceutical drug candidate.
  • the target molecule which is usually determined by methods such as X-ray analysis or nuclear magnetic resonance spectroscopy (NMR)
  • NMR nuclear magnetic resonance spectroscopy
  • computer programs are used to search databases with structures of a variety of different chemical compounds. The selection is carried out by the computer. The selected compounds are additionally tested in the laboratory.
  • the rational design of active ingredients may here be based on any of the nucleic acids according to the present invention and comprises a structure, in particular a three-dimensional structure, which is similar to the structure of the nucleated nucleic acid according to the invention.
  • Liche acid (s) is or is identical to that part of the structure of the nucleic acid (s) of the invention, which mediates the binding to HMG proteins. In any case, such a structure still shows the same or at least a similar binding behavior as the nucleic acid (s) according to the invention.
  • the preferably three-dimensional structure of those parts of the HMG protein-binding nucleic acids is mimicked by chemical groups, which are preferably different from nucleotides and nucleic acids.
  • a compound can be constructed which is different from the nucleic acid or nucleic acids used as starting materials for the rational design of the active ingredient.
  • Such a compound or drug is preferably a small molecule (Engl., Small molecule) or a peptide.
  • HMG analogs In the case of screening of compound libraries using competitive assays known to those skilled in the art, appropriate HMG analogs, HMG agonists, and HMG antagonists can be found.
  • Such competitive assays can be constructed as follows.
  • the nucleic acid according to the invention preferably a spiegelmer, d. H. an L-nucleic acid binding the target molecule is coupled to a preferably solid phase.
  • labeled HMG protein is added to the test system.
  • the HMG protein could also be coupled to a solid phase and the nucleic acid according to the invention could be labeled.
  • a potential analogue or potential agonist or antagonist would compete with the HMG molecules that bind to the aptmer, which would be accompanied by a decrease in the signal obtained from the corresponding label. Screening for agonists or antagonists may involve the use of a cell culture assay system known to those skilled in the art.
  • the nucleic acids according to the invention can be used owing to their characteristic binding behavior to HMG protein for the target validation ("target” is English for "target molecule”).
  • the nucleic acids of the invention can be used in an ex vivo organ model to study the function of HMG protein. Basically ex vivo models exist in which HMG agonists / antagonists can be tested.
  • a kit according to the present invention may comprise at least one or more of the nucleic acids of the invention.
  • the kit may include at least one or more positive or negative controls. As positive controls can z.
  • HMG protein against which the nucleic acid of the invention has been screened or to which it binds, preferably in liquid form may be used.
  • a peptide can be used, which behaves in terms of its biophysical properties similar to HMG protein, which is not recognized by the nucleic acids of the invention or a peptide with the same amino acid composition but of HMG protein of different sequence.
  • the kit may comprise one or more buffers.
  • the various ingredients may be present in the kit in dry or lyophilized form, or dissolved in a liquid.
  • the kit may include one or more containers, which in turn may contain one or more of the components of the kit.
  • the vessels contain reaction mixtures as required for a one-time experiment using one or more components of the kit.
  • hybridizing the two sections is understood herein to mean that the sections can hybridize in vitro due to general base pairing rules, or that the sections can hybridize or hybridize under the conditions of use, but not necessarily together are hybridized or hybridized under the conditions of use.
  • nucleic acids can be freely selected according to the technical teaching disclosed herein, d. H. can be chosen so that they show the required binding behavior to the respective target molecule and / or the structures described herein, in particular secondary structures are able to form.
  • FIG. 1A shows aptamers generated by in vitro selection against D-21AS-HMGAla / b, which bind the 21 AS-HMGA1a / b domain;
  • Figure 1B is a representation of the identified recurring sequence regions of the aptamers produced by in vitro selection against D-2 IAS -HMGA la / b, which bind the 2 IAS-HMGAla / b domain;
  • FIG. 2 shows a sequence comparison of HMGA1 a / b and HMGA2;
  • FIG. 3 shows a truncation of HMGA 1 a / b-binding aptamer NOX-f
  • Figure 4 shows the binding properties of truncated HMGA1 a / b binding aptamer NOX-f; 5 shows a competition assay for measuring the binding of HMGA to the double-stranded natural target DNA in the multiwell plate assay; the binding of the aptmer competes with the binding of the recombinant HMGAIb to the biotinylated dsDNA (AT-hook motif).
  • Figure 6 is a comparison of aptmer NOX-A and aptmer NOX-f (48nt; 33nt) in the competitive multiwell plate assay; Spiegelmer NOX-A, as well as Spiegeimer NOX-f and its shortened version Spiegeimer NOX-D3 in the plate assay prevent the binding of recombinant HMGAIb to its natural occurring binding partner in the low nanomolar range.
  • Figure 7 shows the activity of 2kDa PEG-coupled aptamer NOX-A and non-functional control mirror mer in the competitive multiwell plate assay; the PEGylated aptmer NOX-A competes with the binding of recombinant HMGAIb to the AT-hook motif of the dsDNA with an IC50 of 15nM; the inverse control aptmer of NOX-A exhibits a nonspecific interaction with HMGAIb at high aptmer concentrations;
  • Fig. 8 is a Western blot; Detection of immobilized HMGAIb by biotinylated aptmer; recombinant HMGAIb migrates in the electrophoretic field like a 2OkDa protein and can be detected at low concentrations (3nM) by the biotinylated aptmer (here by the example of NOX-A); an inverse control aptmer could not detect HGMGAIb;
  • Figure 9 shows the activity of free and PEGylated aptamer NOX-A in the competitive multiwell plate assay
  • FIG. 10 an examination of the packaging of PEGylated aptmer in micelles in the "RiboGreen exclusion assay";
  • FIG. 11 shows the stability of PEI aptmer micelles in the "RiboGreen exclusion assay"
  • FIG. 14 shows a proliferation assay with a "naked” aptmer
  • FIG. 15 shows the proliferation of non-small cell lung cancer (H1299) cells after treatment with PEI-packed NOX-A-2kDa PEG; Inhibition of proliferation of H-1299 cells with 1 ⁇ M aptmer administered as PEI aptmer micelles (N / P 2.5); NOX-A showed a slight inhibition of proliferation compared to the control aptmer;
  • FIG. 16 shows the inhibition of HMGA1a / b-induced cdc25a gene expression as detected by quantitative RT-PCR; Determination of specific inhibition of cdc25a mRNA expression in H-1299 cells by l ⁇ M NOX-A Spiegelmer micelles (N / P 2.5) by means of RT-PCR;
  • NOX-A Quantification of the dose-dependent inhibition of cdc25a mRNA expression in HI 299 cells by RT-PCR; NOX-A Spiegelmer micelles (N / P 2.5) showed a specific inhibition of cdc25a mRNA expression after 25OnM; at a concentration> 4 ⁇ M, an unspecific effect of the control aptmer and toxic effects of polyethylenimine (PEI) at> 10 ⁇ M were shown (data not shown);
  • PEI polyethylenimine
  • FIG. 18 shows the inhibition of tumor growth in the xenograft model in nude mice by the aptamer NOX-A; Inhibition of tumor growth after subcutaneous injection of PSN-I cells by 2 mg / kg aptmer micelles (N / P 2.5). Spiegelmer NOX-A showed a significant reduction of tumor growth; FIG. 19 shows the statistical analysis of the data from the xenograft experiment; FIG. Inhibition of the
  • FIG. 20 the tissue distribution of aptmer NOX-A in the xenograft experiment; FIG. quantitative analysis of the distribution of aptmer NOX-A in plasma and tissues; In the tumor tissue, a high concentration of aptmer NOX-A was detectable compared to the other tissues and plasma.
  • Fig. 21 Tissue distribution of micellar packaged and unpacked aptamer
  • Fig. 22 Distribution of micropacked and unpacked aptmer in
  • the HMGAI a / b-binding RNA tikmers were generated by in vitro selection against D-21 AS-HMGAl a / b and subsequent truncation steps.
  • the generated aptameres that bind the 21 AS-HMGA la / b domain are shown in FIG. 1A.
  • the different clones were prepared as aptamers (D-RNA) by standard phosphoramidite synthesis and radioactively labeled at the 5 'end by kinasing (see below). The clones were then analyzed for their affinity and activity at two concentrations of D-bio-21aa HMGA1 a / b by equilibrium binding assay.
  • the reaction was carried out for one hour at 37 0 C and was then stopped by heating (10 min at 65 ° C).
  • the separation of radioactive nucleotides from labeled oligonucleotides was carried out by analytical polyacrylamide gel electrophoresis (PAGE) (see below). Then a crush-and-soak gel elution with ammonium acetate and an ethanol precipitation (see below) .
  • the amount of purified RNA was estimated by the radioactivity of the pellet (after precipitation) relative to the radioactivity of the excised band.
  • oligonucleotides from PAA gels 500 ⁇ l ammonium acetate (2 M) was added after chopping the excised PAA gel bands with a pipette tip or spatula.
  • the "crush-and-soak" elution was 2 x 1.5 h at 68 0 C in a thermal shaker (1000 U / min) is performed.
  • the supernatants were "Ultrafree-MC-small columns (Millipore / Amicon, Schwalbach , Germany) in a tabletop centrifuge (16,100 xg) of gel residues. The thus eluted RNA was then desalted by means of an ethanol precipitation.
  • oligonucleotides were 30 min at -80 0 C and precipitated for 30 min at 16,100 xg, 4 ° C by centrifugation. The pellet was washed Ix with 70% ethanol and 5 min at 16,100 xg, 4 ° C centrifuged.
  • each of the 5 'radiolabeled aptamers were prepared in Biotinyl-D-HMGAla / b-21mer (EPSEVPTPKRPRGRPKGSKNK [SEQ ID: 17], see Figure 2), prepared by Bachern (Weil am Rhein, Germany). Solutions in the concentration range of 1 - 3000 nM (or for two-point measurement with 30O nM and 30 nM or 10O nM and 10 nM peptide) for one hour at 37 ° C in selection buffer (10 mM Tris HCl pH 7.4, 5 mM KCl, 0.8mM MgC12, 0.1% Tween).
  • the background control was a solution without biotinylated D-HMGA1 a / b-21mer. Peptide and complexes were then immobilized with 10 ⁇ l Streptavidin Ultra-Link gel within 30 min at 37 ° C. The radioactivity of the suspension was decided. The supernatant was removed. Then the matrix was washed once with 100 ⁇ l of selection buffer and then filled up with selection buffer. By measuring the radioactivity, the aptamer content present in the complex with biotinyl-D-HMGAla / b-21mer was determined for each peptide concentration. Graphical application and Fit (Gra-Fit, version 4.0.10, Erithacus Software) were used to determine the dissociation constant of the active species and the proportion of active molecules.
  • FIG. 3 shows by way of example on the candidate NOX-f (132-B3) the shortening of the aptamer based on the stabilizing Stem structure which is shown in an extended form in the candidates 132-C3, 132-B3, 132-C4, 132-E2, 132-A2, 132-H1, 132-F1, 122-G2, 122-E2 (see FIG. 1A). Shortening to a 32-nucleotide aptamer variant of NOX-f with a 6-nucleotide star (NOX-f 32nt) did not result in loss of binding properties to the 21aa HMGAla / b fragment ( Figures 3 and 4).
  • sequences 132-G2, 122-A1, 122-C1, 122-B2 and 122-B4 have a markedly shorter stem at the 5'-end and 3'-end of the repetitive sequence motif (GGGCG and GGGAG, respectively) Structure on. Shortening them led to a loss of binding. A possible shortening of the longer for these sequences, central region between the repetitive sequence motif (GGGCG or GGGUG or GGGAG) was not made.
  • the SEQ IDs of the aptamer sequences of the HMGA-binding nucleic acids disclosed herein are as follows:
  • the L-nucleotide enantiomer of an aptamer ie, a D-nucleic acid generated against a D-peptide
  • This L-nucleic acid is also referred to herein as a spiegelmer and otherwise has basically the same binding properties as the aptamer.
  • Characteristic of all Spiegelmers that bind to HMGA la / b is a repetitive sequence element of the sequence GGGCG or GGGUG or GGGAG. This sequence element appears twice in HMGA1 a / b-binding Spiegelmers ( Figures IA and IB).
  • the sequence element closer to the 5 'end of the aptmer is referred to herein as Box Al.
  • the sequence element closer to the 3 'end of the aptmer is referred to herein as box A2.
  • Box Al and Box A2 and their arrangement to each other probably represent the decisive feature of HMGAl a / b-binding Spiegelmers.
  • box A1 and box A2 are either a sequence section of six to seven nucleotides in length or 12 to 22 nucleotides in length ( Figures IA and IB). Since these sequence sections differ not only in their length, they are dealt with separately.
  • sequence section lying between box A1 and box A2 has a length of six nucleotides, then the sequence section has the sequence UGGUUG, UGGCUG, CGGUUG, AGGUUG or GUGUAA. Insertion of one nucleotide (uracil) into the sequence CGGUUG, resulting in the sequence CGGUUUG, has neither a negative nor a positive influence on the binding properties of the Spiegelmers.
  • the sequence section lying between box Al and box A2 has a length of 12 to 22
  • Nucleotides this sequence section has two sequence regions of equal length, the optionally hybridize with each other (Helix C). The Hybidleiter is accomplished thereby in each case three to six nucleotides. Between the nucleotides forming the helix C are three to five unpaired nucleotides. Between the 3 'end of Box Al and the 5' end of Helix C, one to three nucleotides are unpaired. Between the 3 'end of Helix C and the 5' end of Box A2, one to five nucleotides can be unpaired.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Oncology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Communicable Diseases (AREA)
  • Epidemiology (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Cardiology (AREA)
  • Vascular Medicine (AREA)
  • Urology & Nephrology (AREA)
  • Immunology (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Rheumatology (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Hematology (AREA)
  • Virology (AREA)

Abstract

The invention relates to the use of an L-nucleic acid as an intracellularly active substance.

Description

Neue Verwendung von Spiegelmeren New use of spiegelmers
Die vorliegende Erfindung betrifft in einem Aspekt eine neue Verwendung von Spiegelmeren. In einem anderen Aspekt betrifft die vorliegende Erfindung HMG-Proteine bindende Spiegelmere.The present invention relates in one aspect to a new use of spiegelmers. In another aspect, the present invention relates to HMG protein binding spiegelmers.
Mit den Fortschritten in der molekularen Medizin ist es möglich geworden, an einer Erkrankung oder einem Krankheitszustand beteiligte Zielmoleküle zu identifizieren und auf diese spezifisch einzuwirken, um dadurch die Erkrankung oder den Krankheitszustand zu behandeln, zu verhindern oder zumindest die damit verbundenen Symptome zu lindern. Die Zielmoleküle können grundsätzlich in zwei Gruppen eingeteilt werden. Die erste Gruppe umfasst Zielmoleküle, die extrazellulär vorhanden sind und somit grundsätzlich durch Gabe eines Wirkstoffes in eine Körperflüssigkeit oder eine Körperkavität, die das Zielmolekül enthält, mit diesem in Kontakt gebracht werden. Die erste Gruppe von Zielmolekülen werden hierin auch als extrazelluläre Zielmoleküle bezeichnet. Die zweite Gruppe von Zielmolekülen umfasst Zielmoleküle, die in Zellen vorhanden sind, wobei die Zellen mit der zu behandelnden Erkrankung oder der Disposition für die Erkrankung im Zusammenhang stehen. Es ist dabei nicht erforderlich, dass das Zielmolekül unmittelbar für den Krankheitszustand verantwortlich ist oder unmittelbar mit der Disposition für die Erkrankung im Zusammenhang steht. Vielmehr ist es ausreichend, dass das jeweilige Zielmolekül an einer Wirkkaskade beteiligt ist, die in ihrem Ablauf durch den Wirkstoff beeinflusst wird, mit der Folge, dass der Wirkstoff für die Behandlung oder Prävention der Erkrankung geeignet ist. Die zweite Gruppe von Zielmolekülen wird hierin auch als intrazelluläre Zielmoleküle bezeichnet.With advances in molecular medicine, it has become possible to identify and specifically target target molecules involved in a disease or disease state, thereby treating, preventing or at least alleviating the associated symptoms of the disease or condition. The target molecules can basically be divided into two groups. The first group comprises target molecules which are present extracellularly and thus in principle be brought into contact with it by administering an active substance into a body fluid or a body cavity containing the target molecule. The first group of target molecules are also referred to herein as extracellular target molecules. The second group of target molecules includes target molecules that are present in cells, which cells are related to the disease to be treated or the disposition for the disease. It is not necessary that the target molecule is directly responsible for the disease state or is directly related to the disposition for the disease. Rather, it is sufficient that the respective target molecule is involved in an active cascade, which is influenced in its course by the drug, with the result that the drug is suitable for the treatment or prevention of the disease. The second group of target molecules are also referred to herein as intracellular target molecules.
Die Art des Zielmoleküls, d. h. extrazelluläres oder intrazelluläres Zielmolekül, bestimmt grundsätzlich die Verbindungsklasse, mit der versucht werden kann, die für die therapeutische oder präventive Wirkung erforderliche Wechselwirkung zwischen dem Wirkstoff, typischerweise dem pharmazeutischen Wirkstoff, und dem Zielmolekül bereitzustellen. Nahezu ubiquitär lassen sich sog. small molecules einsetzen, d. h. chemische Verbindungen mit einem Molekulargewicht von typischerweise 1000 oder weniger Dalton. Diese Moleküle können direkt mit extrazellulären, aber auch mit intrazellulären Zielmolekülen in erwünschter Weise wechselwirken. Vor diesem Hintergrund wurden von der biotechnologischen Industrie neue Wirkstoffklassen entwickelt, wie beispielsweise Antikörper, insbesondere monoklonale Antikörper, Antisense- Moleküle, siRNA-Moleküle, Aptamere und Spiegelmere. Obgleich einige dieser Molekülklassen noch am Beginn von klinischen Untersuchungen stehen, existieren zumindest im Falle von Antikörpern und Antisense-Molekülen bereits in der Klinik eingesetzte Produkte. Gleichwohl bestehen auch mit diesen neuen Substanzklassen erhebliche Probleme, wenn es gilt, intrazelluläre Zielmoleküle zu adressieren. So ist beispielsweise die intrazelluläre Verwendung von Antikörpern derzeit immer noch nicht möglich, zumindest nicht in einem Umfang oder in einer Art und Weise, die eine routinemäßige Anwendung von gegen intrazelluläre Zielmoleküle gerichteten Antikörpern am Patienten zur Therapie und/oder Prophylaxe erlaubt. Auch die anderen neuen Wirkstoffklassen, insbesondere Antisense-Moleküle und siRNA-Moleküle, müssen infolge ihres Wirkmechanismus' in die jeweilige, das Zielmolekül oder das dafür codierende Gen enthaltende Zelle eingebracht werden. Die zielgerichtete Abgabe des Wirkstoffes, auch als Delivery bezeichnet, ist auch für diese Substanzklassen der derzeit limitierende Faktor für eine klinische Anwendung.The nature of the target molecule, ie, extracellular or intracellular target molecule, basically determines the class of compounds that can be used to provide the therapeutic or preventive effect necessary interaction between the drug, typically the pharmaceutical agent, and the target molecule. So-called small molecules can be used almost ubiquitously, ie chemical compounds with a molecular weight of typically 1000 or less daltons. These molecules can interact directly with extracellular but also with intracellular target molecules as desired. Against this background, new classes of drugs have been developed by the biotechnology industry, such as antibodies, in particular monoclonal antibodies, antisense molecules, siRNA molecules, aptamers and spiegelmers. Although some of these classes of molecules are still at the beginning of clinical investigations, at least in the case of antibodies and antisense molecules, products already used in the clinic exist. Nevertheless, there are also significant problems with these new classes of substances when it comes to addressing intracellular target molecules. For example, the intracellular use of antibodies is currently still not possible, at least not to the extent or in a manner that allows for routine use of antibodies directed against intracellular target molecules on the patient for therapy and / or prophylaxis. The other new classes of drugs, in particular antisense molecules and siRNA molecules, must be introduced as a result of their mechanism of action into the respective cell containing the target molecule or the gene coding therefor. The targeted delivery of the active substance, also referred to as delivery, is also the currently limiting factor for clinical use for these substance classes.
Gleiches gilt auch für Aptamere und Spiegelmere, d. h. funktionale Nukleinsäuren mit einer definierten dreidimensionalen Struktur, die die spezifische Wechselwirkung mit den jeweiligen Zielmolekülen ermöglicht. Die Anwendung von Aptameren, um intrazellulär vorliegende Zielmoleküle zu adressieren, bedient sich dabei Methoden der Gentechnologie, genauer der Gentherapie. Die gegen ein intrazelluläres Zielmolekül gerichteten, auch als Intramere bezeichneten Aptamere, werden vermittels gentechnologischer Verfahren in die jeweilige Zielzelle eingeschleust. Ein derartiger Ansatz ist jedoch ebenfalls mit erheblichen Beschränkungen verbunden, nicht zuletzt wegen der fehlenden Akzeptanz von Behandlungsansätzen auf der Grundlage der Gentherapie. Speziell der bei Intrameren beschrittene Weg der intrazellulären Expression einer für das jeweilige Aptamer intrazellulär codierenden Nukleinsäure ist den Spiegelmeren grundsätzlich verschlossen, da kein biologisches System existiert, welches Spiegelmere, d. h. aus L- Nukleotiden bestehende Aptamere, aufzubauen in der Lage wäre.The same applies to aptamers and spiegelmers, d. H. functional nucleic acids with a defined three-dimensional structure, which allows the specific interaction with the respective target molecules. The use of aptamers to target intracellular target molecules uses genetic engineering methods, more specifically, gene therapy. The aptamers directed against an intracellular target molecule, also called intramers, are introduced into the respective target cells by means of genetic engineering methods. However, such an approach is also associated with significant limitations, not least because of the lack of acceptance of treatment approaches based on gene therapy. In particular, the intracellular expression of intracellular expression of an intracellular nucleic acid coding for the respective aptamer is in principle closed to the Spiegelmers since no biological system exists, which Spiegelmers, d. H. L-nucleotide aptamers would be able to build up.
Aufgabe der vorliegenden Erfindung ist somit, eine Substanzklasse bereitzustellen, die in der Lage ist, spezifisch mit intrazellulären Zielmolekülen, d. h. Zielmolekülen, die in einer Zelle vorhanden sind, zu wechselwirken. Erfindungsgemäß wird diese Aufgabe gelöst durch den Gegenstand der beigefügten unabhängigen Ansprüche. Bevorzugte Ausführungsformen ergeben sich aus den Unteransprüchen.It is therefore an object of the present invention to provide a class of substances capable of interacting specifically with intracellular target molecules, ie target molecules present in a cell. According to the invention, this object is achieved by the subject matter of the appended independent claims. Preferred embodiments will be apparent from the dependent claims.
Gemäß der vorliegenden Erfindung wird die zugrundeliegende Aufgabe durch den Gegenstand der unabhängigen Ansprüche gelöst. Bevorzugte Ausführungsformen ergeben sich aus den Unteransprüchen.According to the present invention, the underlying object is solved by the subject matter of the independent claims. Preferred embodiments will be apparent from the dependent claims.
Erfindungsgemäß wird die Aufgabe gelöst in einem ersten Aspekt durch die Verwendung einer L-Nukleinsäure als intrazelluläres aktives Agens.According to the invention, the object is achieved in a first aspect by the use of an L-nucleic acid as intracellular active agent.
In einer ersten Ausführungsform des ersten Aspektes ist die L-Nukleinsäure ein Spiegeimer.In a first embodiment of the first aspect, the L-nucleic acid is a spiegelmer.
In einer zweiten Ausführungsform des ersten Aspektes, die auch eine Ausfuhrungsform der ersten Ausführungsform ist, tritt die L-Nukleinsäure in Wechselwirkung mit einem intrazellulären Rezeptor.In a second embodiment of the first aspect, which is also an embodiment of the first embodiment, the L-nucleic acid interacts with an intracellular receptor.
In einer dritten Ausführungsform des ersten Aspektes, die auch eine Ausfuhrungsform der zweiten Ausfuhrungsform ist, ist der intrazelluläre Rezeptor ausgewählt aus der Gruppe umfassend molekulare Rezeptoren, Enzyme, Chaperon-Moleküle, Signalpeptide, intrazelluläre Strukturen und Stoffwechselintermediate.In a third embodiment of the first aspect, which is also an embodiment of the second embodiment, the intracellular receptor is selected from the group comprising molecular receptors, enzymes, chaperone molecules, signal peptides, intracellular structures and metabolic intermediates.
In einer vierten Ausführungsform des ersten Aspektes, die auch eine Ausfuhrungsform der zweiten Ausführungsform ist, ist der intrazelluläre Rezeptor ausgewählt aus der Gruppe umfassend Polypeptide, Kohlenhydrate, Nukleinsäuren, Lipide und Kombinationen davon.In a fourth embodiment of the first aspect, which is also an embodiment of the second embodiment, the intracellular receptor is selected from the group comprising polypeptides, carbohydrates, nucleic acids, lipids and combinations thereof.
In einer fünften Ausführungsform des ersten Aspektes, die auch eine Ausfuhrungsform der zweiten, dritten und vierten Ausfuhrungsform ist, tritt die L-Nukleinsäure mit einem intrazellulären Rezeptor innerhalb einer Zelle in Wechselwirkung.In a fifth embodiment of the first aspect, which is also an embodiment of the second, third and fourth embodiments, the L-nucleic acid interacts with an intracellular receptor within a cell.
In einer sechsten Ausführungsform des ersten Aspektes, die auch eine Ausführungsform der zweiten, dritten, vierten und fünften Ausfuhrungsform ist, ist der intrazelluläre Rezeptor ausgewählt aus der Gruppe umfassend Transkriptionsfaktoren und einen AT-Haken bindende DNA- bindende Proteine. In einer siebten Ausführungsform des ersten Aspektes, die auch eine Ausführungsform der sechsten Ausfuhrungsform ist, ist der intrazelluläre Rezeptor ausgewählt aus der Gruppe umfassend die HMG-Proteine, bevorzugterweise aus der Gruppe umfassend HMGAl, HMGAIa, HMGAIb, und HMGA2.In a sixth embodiment of the first aspect, which is also an embodiment of the second, third, fourth and fifth embodiments, the intracellular receptor is selected from the group comprising transcription factors and an AT hook-binding DNA-binding protein. In a seventh embodiment of the first aspect, which is also an embodiment of the sixth embodiment, the intracellular receptor is selected from the group comprising the HMG proteins, preferably from the group comprising HMGA1, HMGA1a, HMGA1b, and HMGA2.
Erfindungsgemäß wird die Aufgabe gelöst in einem zweiten Aspekt durch ein Verfahren zum Binden eines intrazellulären Rezeptors umfassend:According to the invention, the object is achieved in a second aspect by a method for binding an intracellular receptor comprising:
Bereitstellen einer Zelle enthaltend mindestens den einen intrazellulären Rezeptor,Providing a cell containing at least the one intracellular receptor,
Bereitstellen einer L-Nukleinsäure, undProviding an L-nucleic acid, and
Inkubieren der Zelle mit der L-Nukleinsäure.Incubate the cell with the L-nucleic acid.
In einer ersten Ausfuhrungsform des zweiten Aspekts erfolgt das Inkubieren unter Bedingungen, so dass die L-Nukleinsäure an den intrazellulären Rezeptor in der Zelle bindet.In a first embodiment of the second aspect, the incubation is carried out under conditions such that the L-nucleic acid binds to the intracellular receptor in the cell.
In einer zweiten Ausfuhrungsform des zweiten Aspekts, die auch eine Ausführungsform der ersten Ausfuhrungsform ist, ist die L-Nukleinsäure ein Spiegeimer.In a second embodiment of the second aspect, which is also an embodiment of the first embodiment, the L-nucleic acid is a spiegelmer.
In einer dritten Ausfuhrungsform des zweiten Aspekts, die auch eine Ausfuhrungsform der ersten und zweiten Ausfuhrungsform ist, wird nach der Inkubation der Zelle mit der L-Nukleinsäure bestimmt, ob eine Bindung, insbesondere eine intrazelluläre Bindung, der L-Nukleinsäure an dem intrazellulären Rezeptor erfolgt ist.In a third embodiment of the second aspect, which is also an embodiment of the first and second embodiments, it is determined after incubation of the cell with the L-nucleic acid, whether a binding, in particular an intracellular binding, of the L-nucleic acid takes place at the intracellular receptor is.
In einer vierten Ausfuhrungsform des zweiten Aspekts, die auch eine Ausfuhrungsform der ersten, zweiten und dritten Ausfuhrungsform ist, ist der intrazelluläre Rezeptor ausgewählt aus der Gruppe umfassend molekulare Rezeptoren, Stoffwechselintermediate und Enzyme.In a fourth embodiment of the second aspect, which is also an embodiment of the first, second and third embodiments, the intracellular receptor is selected from the group comprising molecular receptors, metabolic intermediates and enzymes.
In einer fünften Ausfuhrungsform des zweiten Aspekts, die auch eine Ausführungsform der ersten, zweiten, dritten und vierten Ausfuhrungsform ist, ist der intrazelluläre Rezeptor ausgewählt aus der Gruppe umfassend Polypeptide, Kohlenhydrate, Nukleinsäure, Lipide und Kombinationen davon. In einer sechsten Ausführungsform des zweiten Aspekts, die auch eine Ausführungsform der ersten, zweiten, dritten, vierten und fünften Ausführungsform ist, ist der intrazelluläre Rezeptor ausgewählt aus der Gruppe umfassend Transkriptionsfaktoren und einen AT-Haken bindende DNA-bindende Proteine.In a fifth embodiment of the second aspect, which is also an embodiment of the first, second, third and fourth embodiments, the intracellular receptor is selected from the group comprising polypeptides, carbohydrates, nucleic acid, lipids and combinations thereof. In a sixth embodiment of the second aspect, which is also an embodiment of the first, second, third, fourth and fifth embodiments, the intracellular receptor is selected from the group comprising transcription factors and an AT hook-binding DNA-binding protein.
hi einer siebten Ausführungsform des zweiten Aspekts, die auch eine Ausfuhrungsform der sechsten Ausführungsform ist, ist der intrazelluläre Rezeptor ausgewählt aus der Gruppe umfassend HMG-Proteine, bevorzugterweise ausgewählt aus der Gruppe umfassend HMGAl, HMGAIa, HMGAIb und HMGA2.In a seventh embodiment of the second aspect, which is also an embodiment of the sixth embodiment, the intracellular receptor is selected from the group comprising HMG proteins, preferably selected from the group comprising HMGA1, HMGA1a, HMGA1b and HMGA2.
Erfindungsgemäß wird die Aufgabe gelöst in einem dritten Aspekt durch die Verwendung einer L-Nukleinsäure zur Herstellung eines Medikamentes zur Behandlung und/oder Prävention einer Erkrankung, wobei das Zielmolekül des Medikamentes ein intrazelluläres Zielmolekül ist.According to the invention, the object is achieved in a third aspect by the use of an L-nucleic acid for the production of a medicament for the treatment and / or prevention of a disease, wherein the target molecule of the medicament is an intracellular target molecule.
In einer ersten Ausführungsform des dritten Aspekts ist der intrazelluläre Rezeptor ausgewählt aus der Gruppe umfassend molekulare Rezeptoren, Enzyme, Chaperon-Moleküle, Signalpeptide, intrazelluläre Strukturen und Stoffwechselintermediate.In a first embodiment of the third aspect, the intracellular receptor is selected from the group comprising molecular receptors, enzymes, chaperone molecules, signal peptides, intracellular structures and metabolic intermediates.
In einer zweiten Ausführungsform des dritten Aspekts, die auch eine Ausführungsform der ersten Ausführungsform ist, ist der intrazelluläre Rezeptor ausgewählt aus der Gruppe umfassend Polypeptide, Kohlenhydrate, Nukleinsäuren, Lipide und Kombinationen davon.In a second embodiment of the third aspect, which is also an embodiment of the first embodiment, the intracellular receptor is selected from the group comprising polypeptides, carbohydrates, nucleic acids, lipids, and combinations thereof.
hi einer dritten Ausführungsform des dritten Aspekts, die auch eine Ausführungsform der ersten und zweiten Ausführungsform ist, ist das Zielmolekül ausgewählt aus der Gruppe, die Transkriptionsfaktoren und einen AT-Haken bindende DNA-bindende Proteine umfasst.In a third embodiment of the third aspect, which is also an embodiment of the first and second embodiments, the target molecule is selected from the group comprising transcription factors and an AT hook-binding DNA-binding protein.
hi einer vierten Ausführungsform des dritten Aspekts, die auch eine Ausführungsform der dritten Ausführungsform ist, ist das Zielmolekül ausgewählt aus der Gruppe umfassend HMG-Proteine, bevorzugterweise ausgewählt aus der Gruppe umfassend HMGAl, HMGAIa, HMGAIb und HMGA2.In a fourth embodiment of the third aspect, which is also an embodiment of the third embodiment, the target molecule is selected from the group comprising HMG proteins, preferably selected from the group comprising HMGA1, HMGA1a, HMGA1b and HMGA2.
In einer fünften Ausführungsform des dritten Aspekts, die auch eine Ausführungsform der dritten und vierten Ausführungsform ist, ist die Erkrankung ausgewählt aus der Gruppe umfassend Tumorerkrankungen, Virusinfektionen und Arteriosklerose. In einer sechsten Ausführungsform des dritten Aspekts, die auch eine Ausführungsform der fünften Ausführungsform ist, ist die Tumorerkrankung ausgewählt aus der Gruppe umfassend mesenchymale Tumoren, epitheliale Tumoren, benigne Tumoren, maligne Tumoren und metastasie- rende Tumoren.In a fifth embodiment of the third aspect, which is also an embodiment of the third and fourth embodiments, the disease is selected from the group comprising tumor diseases, viral infections and arteriosclerosis. In a sixth embodiment of the third aspect, which is also an embodiment of the fifth embodiment, the tumor disease is selected from the group comprising mesenchymal tumors, epithelial tumors, benign tumors, malignant tumors and metastatic tumors.
In einer siebten Ausfuhrungsform des dritten Aspekts, die auch eine Ausführungsform der dritten, vierten, fünften und sechsten Ausführungsform ist, sind das Zielmolekül HMGA und die Erkrankung ausgewählt aus der Gruppe umfassend Karzinome von Prostata, Pankreas, Schilddrüse, Cervix, Magen, Brust, Colon/Rektum, Ovarien; Neuroblastome; Lymphome, Uterusleio- myome; Lipome; Endometriumpolypen; chondroide Hamartome der Lunge; pleomorphe Adenome der Kopfspeicheldrüsen; Hämangiopericytome; chondromatöse Tumore; aggressive Angi- omyxome; diffuse Astrocytome; Osteoklastome; Hautkrebs; Burkitts Lymphom; Lewis- Lungenkrebs; Leukämie; nicht-kleinzelliges Lungenkarzinom; sowie jeweils Metastasen und/oder metastasierende Formen davon.In a seventh embodiment of the third aspect, which is also an embodiment of the third, fourth, fifth and sixth embodiments, the target molecule HMGA and the disease are selected from the group comprising carcinomas of the prostate, pancreas, thyroid, cervix, stomach, breast, colon / Rectum, ovaries; neuroblastomas; Lymphomas, uterine leiomyomas; lipomas; endometrial polyps; chondroid hamartomas of the lung; pleomorphic adenomas of the salivary glands; Hämangiopericytome; chondromatous tumors; aggressive angiomyomas; diffuse astrocytomas; osteoclastomas; Skin cancer; Burkitts lymphoma; Lewis lung cancer; Leukemia; non-small cell lung carcinoma; and in each case metastases and / or metastatic forms thereof.
In einer achten Ausführungsform des dritten Aspekts, die auch eine Ausführungsform der fünften Ausführungsform ist, ist die Arteriosklerose durch HMGAl, HMGAIa, HMGIb und/oder HMGA2 vermittelte Bildung von artierosklerotischen Plaques ausgelöst oder bedingt.In an eighth embodiment of the third aspect, which is also an embodiment of the fifth embodiment, arteriosclerosis is triggered or caused by HMGA1, HMGA1a, HMGIb and / or HMGA2 mediated formation of atherosclerotic plaques.
In einer neunten Ausführungsform des dritten Aspekts, die auch eine Ausführungsform der ersten, zweiten, dritten, vierten, fünften, sechsten, siebten und achten Ausführungsform ist, liegt das intrazelluläre Zielmolekül intrazellulär vor.In a ninth embodiment of the third aspect, which is also an embodiment of the first, second, third, fourth, fifth, sixth, seventh and eighth embodiments, the intracellular target molecule is intracellular.
Erfindungsgemäß wird die Aufgabe gelöst in einem vierten Aspekt durch die Verwendung einer L-Nukleinsäure zur Herstellung eines diagnostischen Mittels zur Diagnose, wobei das Zielmolekül des diagnostischen Mittels ein intrazelluläres Zielmolekül ist.According to the invention, the object is achieved in a fourth aspect by the use of an L-nucleic acid for the production of a diagnostic agent for diagnosis, wherein the target molecule of the diagnostic agent is an intracellular target molecule.
In einer ersten Ausführungsform des vierten Aspekts ist der intrazelluläre Rezeptor ausgewählt aus der Gruppe umfassend molekulare Rezeptoren, Enzyme, Chaperon-Moleküle, Signalpeptide, intrazelluläre Strukturen und Stoffwechselintermediate. In einer zweiten Ausfϊihrungsform des vierten Aspekts, die auch eine Ausführungsform der ersten Ausfuhrungsform ist, ist der intrazelluläre Rezeptor ausgewählt aus der Gruppe umfassend Polypeptide, Kohlenhydrate, Nukleinsäuren, Lipide und Kombinationen davon.In a first embodiment of the fourth aspect, the intracellular receptor is selected from the group comprising molecular receptors, enzymes, chaperone molecules, signal peptides, intracellular structures and metabolic intermediates. In a second embodiment of the fourth aspect, which is also an embodiment of the first embodiment, the intracellular receptor is selected from the group comprising polypeptides, carbohydrates, nucleic acids, lipids and combinations thereof.
hi einer dritten Ausfuhrungsform des vierten Aspekts, die auch eine Ausführungsform der ersten und zweiten Ausfuhrungsform ist, ist das Zielmolekül ausgewählt aus der Gruppe, die Transkriptionsfaktoren und einen AT-Haken bindende DNA-bindende Proteine umfasst.In a third embodiment of the fourth aspect, which is also an embodiment of the first and second embodiments, the target molecule is selected from the group comprising transcription factors and AT hook-binding DNA-binding proteins.
In einer vierten Ausführungsform des vierten Aspekts, die auch eine Ausführungsform der dritten Ausführungsform ist, ist das Zielmolekül ausgewählt aus der Gruppe umfassend HMG- Proteine, bevorzugterweise ausgewählt aus der Gruppe umfassend HMGA, HMGAIa, HMGAIb und HMGA2.In a fourth embodiment of the fourth aspect, which is also an embodiment of the third embodiment, the target molecule is selected from the group comprising HMG proteins, preferably selected from the group comprising HMGA, HMGAIa, HMGAIb and HMGA2.
In einer fünften Ausfuhrungsform des vierten Aspekts, die auch eine Ausführungsform der dritten und vierten Ausführungsform ist, ist die Erkrankung ausgewählt aus der Gruppe umfassend Tumorerkrankungen, Virusinfektionen und Arteriosklerose.In a fifth embodiment of the fourth aspect, which is also an embodiment of the third and fourth embodiments, the disease is selected from the group comprising tumor diseases, viral infections and arteriosclerosis.
In einer sechsten Ausführungsform des vierten Aspekts, die auch eine Ausführungsform der fünften Ausführungsform ist, ist die Tumorerkrankung ausgewählt aus der Gruppe umfassend mesenchymale Tumoren, epitheliale Tumoren, benigne Tumoren, maligne Tumoren und me- tastatisierende Tumoren.In a sixth embodiment of the fourth aspect, which is also an embodiment of the fifth embodiment, the tumor disease is selected from the group comprising mesenchymal tumors, epithelial tumors, benign tumors, malignant tumors, and metastatic tumors.
In einer siebten Ausführungsform des vierten Aspekts, die auch eine Ausführungsform der dritten, vierten, fünften und sechsten Ausfuhrungsform ist, ist das Zielmolekül HMGA und die Erkrankung ist ausgewählt aus der Gruppe umfassend Karzinome von Prostata, Pankreas, Schilddrüse, Cervix, Magen, Brust, Colon/Rektum, Ovarien; Neuroblastome; Lymphome, Uterusleio- myome; Lipome; Endometriumpolypen; chondroide Hamartome der Lunge; pleomorphe Adenome der Kopfspeicheldrüsen; Hämangiopericytome; chondromatöse Tumore; aggressive Angi- omyxome; diffuse Astrocytome; Osteoklastome; Hautkrebs; Burkitts Lymphom; Lewis- Lungenkrebs; Leukämie; nicht-kleinzelliges Lungenkarzinom; sowie jeweils Metastasen und/oder metastasierende Formen davon. In einer achten Ausfuhrungsform des vierten Aspekts, die auch eine Ausführungsform der fünften Ausführungsform ist, wird die Arteriosklerose durch HMGAl, HMGAIa, HMGIb und/oder HMGA2 vermittelte Bildung von artierosklerotischen Plaques ausgelöst.In a seventh embodiment of the fourth aspect, which is also an embodiment of the third, fourth, fifth and sixth embodiments, the target molecule is HMGA and the disease is selected from the group comprising carcinomas of the prostate, pancreas, thyroid, cervix, stomach, breast, Colon / rectum, ovaries; neuroblastomas; Lymphomas, uterine leiomyomas; lipomas; endometrial polyps; chondroid hamartomas of the lung; pleomorphic adenomas of the salivary glands; Hämangiopericytome; chondromatous tumors; aggressive angiomyomas; diffuse astrocytomas; osteoclastomas; Skin cancer; Burkitts lymphoma; Lewis lung cancer; Leukemia; non-small cell lung carcinoma; and in each case metastases and / or metastatic forms thereof. In an eighth embodiment of the fourth aspect, which is also an embodiment of the fifth embodiment, arteriosclerosis is triggered by HMGA1, HMGA1a, HMGIb and / or HMGA2 mediated formation of atherosclerotic plaques.
In einer neunten Ausführungsform des vierten Aspekts, die auch eine Ausführungsform der ersten, zweiten, dritten, vierten, fünften, sechsten und siebten Ausführungsform ist, liegt das intrazelluläre Zielmolekül intrazellulär vor.In a ninth embodiment of the fourth aspect, which is also an embodiment of the first, second, third, fourth, fifth, sixth and seventh embodiments, the intracellular target molecule is intracellular.
Erfindungsgemäß wird die Aufgabe gelöst in einem fünften Aspekt durch eine Zusammensetzung umfassend eine an ein intrazelluläres Zielmolekül bindende L-Nukleinsäure und ein Abgabevehikel.According to the invention, the object is achieved in a fifth aspect by a composition comprising an L-nucleic acid binding to an intracellular target molecule and a delivery vehicle.
In einer ersten Ausfuhrungsform des fünften Aspekts ist das Abgabevehikel ein für die intrazelluläre Abgabe der L-Nukleinsäure geeignetes Abgabevehikel.In a first embodiment of the fifth aspect, the delivery vehicle is a delivery vehicle suitable for intracellular delivery of the L-nucleic acid.
In einer zweiten Ausfuhrungsform des fünften Aspekts, die auch eine Ausführungsform der ersten Ausfuhrungsform ist, ist das Abgabevehikel ausgewählt aus der Gruppe umfassend Vehikel, Konjugate und physikalische Maßnahmen.In a second embodiment of the fifth aspect, which is also an embodiment of the first embodiment, the delivery vehicle is selected from the group comprising vehicles, conjugates and physical measures.
In einer dritten Ausführungsform des fünften Aspekts, die auch eine Ausführungsform der zweiten Ausführungsform ist, ist das Abgabevehikel ein Vehikel, wobei das Vehikel ausgewählt ist aus der Gruppe umfassend Liposome, Nanopartikel, Mikropartikel, Cyclodextrine oder Dendri- mere, oder ein Vesikel, das aus Polypeptiden, Polyethylenimin und/oder amphipathischen Molekülen besteht.In a third embodiment of the fifth aspect, which is also an embodiment of the second embodiment, the delivery vehicle is a vehicle, wherein the vehicle is selected from the group comprising liposomes, nanoparticles, microparticles, cyclodextrins or dendrimers, or a vesicle consisting of Polypeptides, polyethylenimine and / or amphipathic molecules.
In einer vierten Ausfuhrungsform des fünften Aspekts, die auch eine Ausführungsform der zweiten Ausführungsform ist, ist das Abgabevehikel ein Konjugat, wobei das Konjugat ein Konjugat für die Rezeptor-vermittelte Endozytose, ein Konjugat mit einem fusogenen Peptid, ein Konjugat mit einem Signalpeptid, ein Konjugat mit einer Nukleinsäure, bevorzugterweise ein Konjugat mit einem Spiegeimer oder ein lipophiles Konjugat ist.In a fourth embodiment of the fifth aspect, which is also an embodiment of the second embodiment, the delivery vehicle is a conjugate, wherein the conjugate is a receptor-mediated endocytosis conjugate, a fusogenic peptide conjugate, a signal peptide conjugate, a conjugate with a nucleic acid, preferably a conjugate with a spiegelmer or a lipophilic conjugate.
In einer fünften Ausführungsform des fünften Aspekts, die auch eine Ausfuhrungsform der zweiten Ausführungsform ist, ist das Abgabevehikel eine physikalische Maßnahme, wobei die Maß- nähme bevorzugterweise ausgewählt ist aus der Gruppe umfassend Elektroporation, Iontophore- se, Druck, Ultraschall und Schockwellen.In a fifth embodiment of the fifth aspect, which is also an embodiment of the second embodiment, the delivery vehicle is a physical measure, wherein the dimensional preferably is selected from the group comprising electroporation, iontophoresis, pressure, ultrasound and shock waves.
In einer sechsten Ausführungsform des fünften Aspekts, die auch eine Ausfuhrungsform der dritten Ausfuhrungsform ist, umfasst das Abgabevehikel Polyethylenimin.In a sixth embodiment of the fifth aspect, which is also an embodiment of the third embodiment, the delivery vehicle comprises polyethyleneimine.
In einer siebten Ausführungsform des fünften Aspekts, die auch eine Ausführungsform der sechsten Ausführungsform ist, ist das Polyethylenimin ein verzweigtes Polyethylenimin mit einem Molekulargewicht von etwa 25 kDa.In a seventh embodiment of the fifth aspect, which is also an embodiment of the sixth embodiment, the polyethyleneimine is a branched polyethyleneimine having a molecular weight of about 25 kDa.
In einer achten Ausführungsform des fünften Aspekts, die auch eine Ausführungsform der sechsten und siebten Ausführungsform ist, bildet das Polyethylenimin eine Mizelle oder eine mizellenartige Struktur aus.In an eighth embodiment of the fifth aspect, which is also an embodiment of the sixth and seventh embodiments, the polyethyleneimine forms a micelle or a micelle-like structure.
In einer neunten Ausführungsform des fünften Aspekts, die auch eine Ausführungsform der ersten, zweiten, dritten, vierten, fünften, sechsten, siebten und achten Ausführungsform ist, ist die L-Nukleinsäure ein Spiegeimer.In a ninth embodiment of the fifth aspect, which is also an embodiment of the first, second, third, fourth, fifth, sixth, seventh and eighth embodiments, the L-nucleic acid is a spiegelmer.
In einer zehnten Ausführungsform des fünften Aspekts, die auch eine Ausführungsform der neunten Ausführungsform ist, trägt das Spiegeimer eine Modifikation, wobei die Modifikation ausgewählt ist aus der Gruppe umfassend PEG-Reste.In a tenth embodiment of the fifth aspect, which is also an embodiment of the ninth embodiment, the spiegelmer carries a modification, wherein the modification is selected from the group comprising PEG residues.
In einer elften Ausführungsform des fünften Aspekts, die auch eine Ausführungsform der zehnten Ausführungsform ist, weist der PEG-Rest ein Molekulargewicht von etwa 1.000 bis 10.000 Da auf, bevorzugterweise ein Molekulargewicht von etwa 1.500 bis 2.500 Da und am bevorzugtesten ein Molekulargewicht von etwa 2.000 Da.In an eleventh embodiment of the fifth aspect, which is also an embodiment of the tenth embodiment, the PEG moiety has a molecular weight of about 1,000 to 10,000 Da, preferably a molecular weight of about 1,500 to 2,500 Da, and most preferably a molecular weight of about 2,000 Da ,
In einer zwölften Ausführungsform des fünften Aspekts, die auch eine Ausführungsform der zehnten und elften Ausführungsform ist, ist die Modifikation am 5 '-Terminus oder am 3'- Terminus der L-Nukleinsäure gebunden.In a twelfth embodiment of the fifth aspect, which is also an embodiment of the tenth and eleventh embodiments, the modification is bound to the 5 'terminus or the 3' terminus of the L-nucleic acid.
In einer dreizehnten Ausführungsform des fünften Aspekts, die auch eine Ausführungsform der neunten, zehnten, elften und zwölften Ausführungsform ist, beträgt in der Zusammensetzung das Verhältnis aus Gesamtanzahl der Stickstoffgruppen des Polyethylenimins und Gesamtanzahl der Phosphatgruppen der in der Zusammensetzung enthaltenen Nukleinsäure etwa 1 bis 20, bevor- zugterweise etwa 1,5 bis 10, bevorzugtererweise etwa 2 bis 5 und am bevorzugtesten etwa 2 bis 3.In a thirteenth embodiment of the fifth aspect, which is also an embodiment of the ninth, tenth, eleventh and twelfth embodiments, in the composition, the ratio of the total number of the nitrogen groups of the polyethyleneimine and the total number of the phosphate groups of the nucleic acid contained in the composition is about 1 to 20, before- usually about 1.5 to 10, more preferably about 2 to 5, and most preferably about 2 to 3.
In einer vierzehnten Ausführungsform des fünften Aspekts, die auch eine Ausfuhrungsform der ersten, zweiten, dritten, vierten, fünften, sechsten, siebten achten, neunten, zehnten, elften, zwölften und dreizehnten Ausführungsform ist, stellt die Zusammensetzung die L-Nukleinsäure intrazellulär bereit.In a fourteenth embodiment of the fifth aspect, which is also an embodiment of the first, second, third, fourth, fifth, sixth, seventh eighth, ninth, tenth, eleventh, twelfth, and thirteenth embodiments, the composition provides the L-nucleic acid intracellularly.
Erfindungsgemäß wird die Aufgabe gelöst in einem sechsten Aspekt durch die pharmazeutische Zusammensetzung umfassend eine Zusammensetzung nach dem fünften Aspekt, und einen pharmazeutisch akzeptablen Träger.According to the invention, the object is achieved in a sixth aspect by the pharmaceutical composition comprising a composition according to the fifth aspect, and a pharmaceutically acceptable carrier.
In einer Ausführungsform der Verwendung nach dem ersten Aspekt ist die L-Nukleinsäure eine Zusammensetzung nach dem fünften Aspekt.In one embodiment of the use according to the first aspect, the L-nucleic acid is a composition according to the fifth aspect.
In einer Ausführungsform des Verfahrens nach dem zweiten Aspekt ist die L-Nukleinsäure eine Zusammensetzung nach dem fünften Aspekt.In one embodiment of the method according to the second aspect, the L-nucleic acid is a composition according to the fifth aspect.
In einer Ausführungsform der Verwendung nach dem dritten Aspekt ist die L-Nukleinsäure eine Zusammensetzung nach dem fünften Aspekt.In one embodiment of the use according to the third aspect, the L-nucleic acid is a composition according to the fifth aspect.
In einer Ausführungsform der Verwendung nach dem vierten Aspekt ist die L-Nukleinsäure eine Zusammensetzung nach dem fünften Aspekt.In one embodiment of the use according to the fourth aspect, the L-nucleic acid is a composition according to the fifth aspect.
Erfindungsgemäß wird die Aufgabe gelöst in einem siebten Aspekt durch eine HMGA bindende Nukleinsäure, dadurch gekennzeichnet, dass die Nukleinsäure einen Abschnitt Box Al und einen Abschnitt Box A2 umfasst, wobei der Abschnitt Box Al und der Abschnitt Box A2 durch einen Zwischenabschnitt miteinander verbunden sind und wobei Box Al und Box A2 einzeln und unabhängig voneinander aus der Gruppe ausgewählt sind, die GGGCG, GGGUG und GGGAG umfasst.According to the invention, the object is achieved in a seventh aspect by an HMGA-binding nucleic acid, characterized in that the nucleic acid comprises a section box Al and a section box A2, wherein the section box Al and the section box A2 are interconnected by an intermediate section and wherein Box Al and Box A2 are individually and independently selected from the group comprising GGGCG, GGGUG and GGGAG.
In einer ersten Ausführungsform des siebten Aspekts besteht der Zwischenabschnitt entweder aus einem Zwischenabschnitt Zl umfassend sechs oder sieben Nukleotide oder aus einem Zwi- schenabschnitt Z2 umfassend 12 bis 25 Nukleotide. In einer zweiten Ausfuhrungsform des siebten Aspekts, die auch eine Ausführungsform der ersten Ausführungsform ist, weist die Nukleinsäure am 5 '-Ende des Abschnittes Box Al einen ersten Abschnitt und am 3 '-Ende des Abschnittes Box A2 einen zweiten Abschnitt auf, wobei bevorzugterweise beide Abschnitte unabhängig voneinander je vier bis acht Nukleotide umfassen.In a first embodiment of the seventh aspect, the intermediate section consists either of an intermediate section Z1 comprising six or seven nucleotides or of an intermediate section Z2 comprising 12 to 25 nucleotides. In a second embodiment of the seventh aspect, which is also an embodiment of the first embodiment, the nucleic acid at the 5 'end of the section Box Al has a first portion and at the 3' end of the portion Box A2 a second portion, preferably both Sections independently comprise four to eight nucleotides each.
In einer dritten Ausfuhrungsform des siebten Aspekts, die auch eine Ausführungsform der zweiten Ausfuhrungsform ist, sind die beiden Abschnitte wenigstens teilweise oder vollständig miteinander hybridisiert, wobei sich die Hybridisierung über vier bis acht Nukleotidpaare erstreckt.In a third embodiment of the seventh aspect, which is also an embodiment of the second embodiment, the two sections are at least partially or completely hybridized with each other, wherein the hybridization extends over four to eight nucleotide pairs.
In einer vierten Ausführungsform des siebten Aspekts, die auch eine Ausführungsform der zweiten und dritten Ausführungsform ist, weist die Nukleinsäure am 5'-Ende des Abschnittes Box Al einen Abschnitt Helix Al und am 3 '-Ende des Abschnittes Box A2 einen Abschnitt Helix A2 auf, wobei bevorzugterweise der Abschnitt Helix Al vier bis acht Nukleotide umfasst und bevorzugterweise der Abschnitt Helix A2 vier bis acht Nukleotide umfasst, und wobei bevorzugterweise der Abschnitt Helix Al den ersten Abschnitt am 5'-Ende des Abschnittes Box Al oder einen Teil davon darstellt, und wobei bevorzugterweise der Abschnitt Helix A2 den zweiten Abschnitt am 3 '-Ende des Abschnittes Box A2 oder einen Teil davon darstellt, wobei die Länge des Abschnittes Helix Al unabhängig von der Länge des Abschnittes Helix A2 ist.In a fourth embodiment of the seventh aspect, which is also an embodiment of the second and third embodiments, the nucleic acid has a section Helix A1 at the 5 'end of the section Box Al and a section Helix A2 at the 3' end of the section Box A2 , wherein preferably the portion Helix Al comprises four to eight nucleotides, and preferably the portion Helix A2 comprises four to eight nucleotides, and wherein preferably the portion helix Al represents the first portion at the 5 'end of the portion box Al or a part thereof, and wherein preferably the section Helix A2 represents the second section at the 3 'end of the section Box A2 or a part thereof, wherein the length of the section Helix Al is independent of the length of the section Helix A2.
In einer fünften Ausführungsform des siebten Aspekts, die auch eine Ausführungsform der vierten Ausführungsform ist, sind die Abschnitte Helix Al und Helix A2 wenigstens teilweise oder vollständig miteinander hybridisiert, wobei sich die Hybridisierung über vier bis acht Nukleotidpaare erstreckt.In a fifth embodiment of the seventh aspect, which is also an embodiment of the fourth embodiment, the sections Helix Al and Helix A2 are at least partially or completely hybridized with each other, the hybridization extending over four to eight nucleotide pairs.
In einer sechsten Ausführungsform des siebten Aspekts, die auch eine Ausführungsform der vierten und fünften Ausführungsform ist, ist zwischen dem 3 '-Ende des Abschnittes Helix Al und dem 5'-Ende des Abschnittes Box Al ein Abschnitt Helix Bl und zwischen dem 3'-Ende des Abschnittes Box A2 und dem 5 '-Ende des Abschnittes Helix A2 ein Abschnitt Helix B2 angeordnet, wobei bevorzugterweise die Länge des Abschnittes Helix Bl und Helix B2 jeweils einzeln und unabhängig eine Länge von vier bis acht Nukleotiden umfasst.In a sixth embodiment of the seventh aspect, which is also an embodiment of the fourth and fifth embodiments, between the 3 'end of the section Helix Al and the 5' end of the section Box Al is a section Helix Bl and between the 3 ' At the end of the section Box A2 and the 5 'end of the section Helix A2, a section Helix B2 is arranged, wherein preferably the length of the section Helix Bl and Helix B2 individually and independently comprises a length of four to eight nucleotides.
In einer siebten Ausführungsform des siebten Aspekts, die auch eine Ausführungsform der sechsten Ausführungsform ist, sind die Abschnitte Helix Bl und Helix B2 wenigstens teilweise oder vollständig miteinander hybridisiert, wobei sich die Hybridisierung über vier bis acht Nukleotidpaare erstreckt.In a seventh embodiment of the seventh aspect, which is also an embodiment of the sixth embodiment, the sections Helix Bl and Helix B2 are at least partially or hybridized completely to each other, wherein the hybridization extends over four to eight nucleotide pairs.
In einer achten Ausfuhrungsform des siebten Aspekts, die auch eine Ausfuhrungsform der sechsten und siebten Ausführungsform ist, sind zwischen dem 3 '-Ende des Abschnittes Helix Al und dem 5'-Ende des Abschnittes Helix Bl null bis fünf Nukleotide angeordnet.In an eighth embodiment of the seventh aspect, which is also an embodiment of the sixth and seventh embodiments, zero to five nucleotides are arranged between the 3 'end of the section Helix Al and the 5' end of the section Helix Bl.
In einer neunten Ausführungsform des siebten Aspekts, die auch eine Ausführungsform der achten Ausführungsform ist, sind zwischen dem 3 '-Ende des Abschnittes Helix Al und dem 5'- Ende des Abschnittes Helix Bl zwei Nukleotide angeordnet.In a ninth embodiment of the seventh aspect, which is also an embodiment of the eighth embodiment, two nucleotides are located between the 3 'end of the Helix Al section and the 5' end of the Helix Bl section.
In einer zehnten Ausführungsform des siebten Aspekts, die auch eine Ausfuhrungsform der sechsten, siebten, achten und neunten Ausfuhrungsform ist, sind zwischen dem 3 '-Ende des Abschnittes Helix B2 und dem 5 '-Ende des Abschnittes Helix A2 null bis sechs Nukleotide angeordnet.In a tenth embodiment of the seventh aspect, which is also an embodiment of the sixth, seventh, eighth and ninth embodiments, zero to six nucleotides are arranged between the 3 'end of the section Helix B2 and the 5' end of the section Helix A2.
In einer elften Ausführungsform des siebten Aspekts, die auch eine Ausführungsform der zehnten Ausführungsform ist, bevorzugterweise insoweit diese eine Ausführungsform der neunten Ausführungsform ist, ist zwischen dem 3 '-Ende des Abschnittes Helix B2 und dem 5 '-Ende des Abschnittes Helix A2 ein Nukleotid angeordnet.In an eleventh embodiment of the seventh aspect, which is also an embodiment of the tenth embodiment, preferably insofar as it is an embodiment of the ninth embodiment, a nucleotide is between the 3 'end of the helix B2 portion and the 5' end of the helix A2 portion arranged.
In einer zwölften Ausführungsform des siebten Aspekts, die auch eine Ausführungsform der sechsten, siebten, achten, neunten, zehnten und elften Ausfuhrungsform ist, beträgt die Summe der Nukleotide von Abschnitt Helix Al und von Abschnitt Helix Bl 10 bis 12 Nukleotide und die Summe der Nukleotide von Abschnitt Helix A2 und von Abschnitt Helix B2 10 bis 12 Nukleotide.In a twelfth embodiment of the seventh aspect, which is also an embodiment of the sixth, seventh, eighth, ninth, tenth and eleventh embodiments, the sum of nucleotides of section Helix A1 and section Helix Bl is 10 to 12 nucleotides and the sum of nucleotides from section Helix A2 and from section Helix B2 10 to 12 nucleotides.
In einer dreizehnten Ausfuhrungsform des siebten Aspekts, die auch eine Ausfuhrungsform der zwölften Ausfuhrungsform ist, beträgt die Summe der hybridisierten Nukleotide aus der Hybridisierung von Abschnitt Helix Al mit Abschnitt Helix A2 und von Abschnitt Helix Bl mit Abschnitt Helix B2 10 bis 12 Nukleotidpaare.In a thirteenth embodiment of the seventh aspect, which is also an embodiment of the twelfth embodiment, the sum of the hybridized nucleotides resulting from the hybridization of section Helix A1 with section Helix A2 and section Helix Bl with section Helix B2 is 10 to 12 nucleotide pairs.
In einer vierzehnten Ausführungsform des siebten Aspekts, die auch eine Ausführungsform der sechsten, siebten, achten, neunten, zehnten, elften, zwölften und dreizehnten Ausführungsform ist, bevorzugterweise der sechsten oder siebten, umfasst die Nukleinsäure keinen Abschnitt Helix Al und Helix A2, wodurch am 5'-Ende der Nukleinsäure der Abschnitt Helix Bl und am 3'- Ende die Helix B2 angeordnet ist, wobei bevorzugterweise die Länge des Abschnittes Helix Bl und Helix B2 jeweils einzeln und unabhängig eine Länge von vier bis acht Nukleotiden umfasst.In a fourteenth embodiment of the seventh aspect, which is also an embodiment of the sixth, seventh, eighth, ninth, tenth, eleventh, twelfth, and thirteenth embodiments is, preferably the sixth or seventh, the nucleic acid does not comprise a section Helix Al and Helix A2, which at the 5 'end of the nucleic acid portion Helix Bl and at the 3' end the helix B2 is arranged, wherein preferably the length of the section Helix Bl and Helix B2 each individually and independently comprises a length of four to eight nucleotides.
In einer fünfzehnten Ausführungsform des siebten Aspekts, die auch eine Ausführungsform der vierzehnten Ausführungsform ist, sind die Abschnitte Helix Bl und Helix B2 wenigstens teilweise oder vollständig miteinander hybridisiert, wobei sich die Hybridisierung über vier bis acht Nukleotidpaare erstreckt.In a fifteenth embodiment of the seventh aspect, which is also an embodiment of the fourteenth embodiment, the sections Helix Bl and Helix B2 are at least partially or completely hybridized with each other, wherein the hybridization extends over four to eight nucleotide pairs.
In einer sechzehnten Ausfuhrungsform des siebten Aspekts, die auch eine Ausführungsform der vierten und fünften Ausführungsform ist, sind zwischen dem 3 '-Ende des Abschnittes Helix Al und dem 5'-Ende des Abschnittes Box Al ein bis fünf Nukleotide und zwischen dem 3'-Ende des Abschnittes Box A2 und dem 5 '-Ende des Abschnittes Helix A2 ein bis drei Nukleotide angeordnet.In a sixteenth embodiment of the seventh aspect, which is also an embodiment of the fourth and fifth embodiments, between the 3 'end of the section Helix Al and the 5' end of the section Box Al are one to five nucleotides and between the 3 ' End of the section box A2 and the 5 'end of the section Helix A2 one to three nucleotides arranged.
In einer siebzehnten Ausführungsform des siebten Aspekts, die auch eine Ausführungsform der sechsten, siebten, achten, neunten, zehnten, elften, zwölften, dreizehnten, vierzehnten und fünfzehnten Ausführungsform ist, sind zwischen dem 3 '-Ende des Abschnittes Helix Bl und dem 5'- Ende des Abschnittes Box Al zwei Nukleotide und zwischen dem 3 '-Ende des Abschnittes Box A2 und dem 5 '-Ende des Abschnittes Helix B2 eins bis sieben Nukleotide angeordnet.In a seventeenth embodiment of the seventh aspect, which is also an embodiment of the sixth, seventh, eighth, ninth, tenth, eleventh, twelfth, thirteenth, fourteenth and fifteenth embodiment, are between the 3 'end of the section Helix Bl and the 5' - End of the section box Al two nucleotides and arranged between the 3 'end of the section box A2 and the 5' end of the section helix B2 one to seven nucleotides.
In einer achtzehnten Ausführungsform des siebten Aspekts, die auch eine Ausführungsform der ersten, zweiten, dritten, vierten, fünften, sechsten, siebten, achten und zehnten Ausführungsform ist, soweit diese eine Ausführungsform der sechsten, siebten und achten Ausführungsform ist, der zwölften und dreizehnten Ausführungsform, soweit diese Ausführungsformen der sechsten, siebten, achten und zehnten Ausführungsform sind, der vierzehnten und fünfzehnten Ausführungsform, soweit diese Ausfuhrungsformen der sechsten, siebten, achten, zehnten, zwölften und dreizehnten Ausführungsform sind, oder der siebzehnten Ausführungsform, soweit diese Ausführungsformen der sechsten, achten, zehnten, zwölften, dreizehnten und fünfzehnten Ausführungsform sind, jeweils in dem hierin eingeschränkten Umfang, umfasst der Zwischenabschnitt Zl sechs oder sieben Nukleotide. In einer neunzehnten Ausführungsform des siebten Aspekts, die auch eine Ausfuhrungsform der achtzehnten Ausführungsform ist, weist der Zwischenabschnitt Zl die Sequenz NiN2GNgN3N4Ns auf, wobeiIn an eighteenth embodiment of the seventh aspect, which is also an embodiment of the first, second, third, fourth, fifth, sixth, seventh, eighth and tenth embodiments insofar as it is an embodiment of the sixth, seventh and eighth embodiments, the twelfth and thirteenth embodiments Embodiment, as far as these embodiments of the sixth, seventh, eighth and tenth embodiments, the fourteenth and fifteenth embodiment, as far as these embodiments of the sixth, seventh, eighth, tenth, twelfth and thirteenth embodiment, or the seventeenth embodiment, as far as these embodiments of the sixth , eighth, tenth, twelfth, thirteenth and fifteenth embodiments, each within the scope limited herein, includes the intermediate section Zl six or seven nucleotides. In a nineteenth embodiment of the seventh aspect, which is also an embodiment of the eighteenth embodiment, the intermediate portion Zl has the sequence NiN 2 GNgN 3 N 4 Ns, wherein
N, = U, C, A oder G ist; N2 = G oder U ist; N3 = U oder C ist; N4 = U oder A ist; N5 = G oder A ist; und N8 = U ist oder fehlt.N, = U, C, A or G; N 2 = G or U; N 3 = U or C; N 4 = U or A; N 5 = G or A; and N 8 = U is or is missing.
In einer zwanzigsten Ausführungsform des siebten Aspekts, die auch eine Ausführungsform der neunzehnten Ausführungsform ist, umfasst die Nukleinsäure einen Abschnitt Box Al und einen Abschnitt Box A2, wobei das 3'-Ende des Abschnittes Box Al direkt mit dem 5'-Ende des Zwischenabschnittes Zl verbunden ist, und das 3 '-Ende des Zwischenabschnittes Zl direkt mit dem 5 '-Ende des Abschnittes Box A2 verbunden ist.In a twentieth embodiment of the seventh aspect, which is also an embodiment of the nineteenth embodiment, the nucleic acid comprises a section Box Al and a section Box A2, with the 3 'end of the section Box Al directly connected to the 5' end of the intermediate section Zl is connected, and the 3 'end of the intermediate portion Zl is connected directly to the 5' end of the section box A2.
In einer einundzwanzigsten Ausführungsform des siebten Aspekts, die auch eine Ausführungsform der achtzehnten, neunzehnten und zwanzigsten Ausführungsform ist, insbesondere der zwanzigsten, umfasst die Nukleinsäure einen Abschnitt Helix Bl und einen Abschnitt Helix B2.In a twenty-first embodiment of the seventh aspect, which is also an embodiment of the eighteenth, nineteenth and twentieth embodiments, particularly the twentieth, the nucleic acid comprises a section Helix Bl and a section Helix B2.
In einer zweiundzwanzigsten Ausführungsform des siebten Aspekts, die auch eine Ausführungsform der einundzwanzigsten Ausfuhrungsform ist, umfassen die Abschnitte Helix Bl und Helix B2 jeweils einzeln und unabhängig voneinander vier bis acht Nukleotide, die bevorzugterweise vollständig oder teilweise miteinander hybridisiert sind.In a twenty-second embodiment of the seventh aspect, which is also an embodiment of the twenty-first embodiment, the sections Helix Bl and Helix B2 each individually and independently of each other comprise four to eight nucleotides, which are preferably fully or partially hybridized with each other.
In einer dreiundzwanzigsten Ausführungsform des siebten Aspekts, die auch eine Ausführungsform der einundzwanzigsten und zweiundzwanzigsten Ausführungsform ist, sind zwischen dem 3'-Ende des Abschnittes Helix Bl und dem 5'-Ende des Abschnittes Box Al in 5 '-3 '-Richtung zwei Nukleotide N6, N7 angeordnet, wobei N6 G, A oder U ist, und N7 = G oder U ist.In a twenty-third embodiment of the seventh aspect, which is also an embodiment of the twenty-first and twenty-second embodiments, there are two nucleotides between the 3 'end of the portion Helix Bl and the 5' end of the portion Box Al in the 5 '-3' direction N 6 , N 7 where N 6 is G, A or U, and N 7 = G or U.
In einer vierundzwanzigsten Ausführungsform des siebten Aspekts, die auch eine Ausfuhrungsform der einundzwanzigsten, zweiundzwanzigsten und dreiundzwanzigsten Ausführungsform ist, ist zwischen dem 3'-Ende des Abschnittes Box A2 und dem 5'-Ende des Abschnittes Helix B2 kein Nukleotid, oder in 5'-3 '-Richtung die Nukleotidsequenz GNy angeordnet, wobei Ny null bis sechs Nukleotide umfasst, bevorzugterweise 0 oder 6 Nukleotide.In a twenty-fourth embodiment of the seventh aspect, which is also an embodiment of the twenty-first, twenty-second and twenty-third embodiments, helix is provided between the 3 'end of the section box A2 and the 5' end of the section B2 no nucleotide, or arranged in the 5'-3 'direction, the nucleotide sequence GN y , wherein N y comprises zero to six nucleotides, preferably 0 or 6 nucleotides.
In einer fünfundzwanzigsten Ausfuhrungsform des siebten Aspekts, die auch eine Ausfuhrungsform der achtzehnten, neunzehnten, zwanzigsten, einundzwanzigsten, zweiundzwanzigsten, dreiundzwanzigsten und vierundzwanzigsten Ausführungsform ist, umfasst die Nukleinsäure einen Abschnitt Helix Al und Helix A2.In a twenty-fifth embodiment of the seventh aspect, which is also an embodiment of the eighteenth, nineteenth, twentieth, twenty-first, twenty-second, twenty-third, and twenty-fourth embodiments, the nucleic acid comprises a section Helix A1 and Helix A2.
In einer sechsundzwanzigsten Ausführungsform des siebten Aspekts, die auch eine Ausführungsform der fünfundzwanzigsten Ausführungsform ist, umfassen die Abschnitte Helix Al und Helix A2 jeweils und unabhängig voneinander vier bis acht Nukleotide, wobei bevorzugterweise die Abschnitte Helix Al und Helix A2 vollständig oder teilweise miteinander hybridisiert sind.In a twenty-sixth embodiment of the seventh aspect, which is also an embodiment of the twenty-fifth embodiment, the sections Helix A1 and Helix A2 each independently and independently of each other comprise four to eight nucleotides, and preferably the sections Helix A1 and Helix A2 are completely or partially hybridized with each other.
In einer siebenundzwanzigsten Ausführungsform des siebten Aspekts, die auch eine Ausführungsform der fünfundzwanzigsten und sechsundzwanzigsten Ausführungsform ist, umfasst zwischen dem 3'-Ende des Abschnittes Helix Al und dem 5'-Ende des Abschnittes Helix Bl eine Nukleotidsequenz Nx angeordnet ist, wobei Nx null bis fünf Nukleotide.In a twenty-seventh embodiment of the seventh aspect, which is also an embodiment of the twenty-fifth and twenty-sixth embodiments, a nucleotide sequence N x is disposed between the 3 'end of the section Helix Al and the 5' end of the section Helix Bl, where N x zero to five nucleotides.
In einer achtundzwanzigsten Ausführungsform des siebten Aspekts, die auch eine Ausführungsform der fünfundzwanzigsten, sechsundzwanzigsten und siebenundzwanzigsten Ausführungsform ist, umfasst zwischen dem 3 '-Ende des Abschnittes Helix B2 und dem 5 '-Ende des Abschnittes Helix A2 eine Nukleotidsequenz Nz angeordnet ist, wobei N2 null bis sechs Nukleotide.In a twenty-eighth embodiment of the seventh aspect, which is also an embodiment of the twenty-fifth, twenty-sixth, and twenty-seventh embodiments, a nucleotide sequence N z is disposed between the 3 'end of the helix B2 portion and the 5' end of the helix A2 portion N 2 zero to six nucleotides.
In einer neunundzwanzigsten Ausführungsform des siebten Aspekts, die auch eine Ausführungsform der einundzwanzigsten, zweiundzwanzigsten, dreiundzwanzigsten, vierundzwanzigsten, fünfundzwanzigsten, sechsundzwanzigsten, siebenundzwanzigsten und achtundzwanzigsten Ausführungsform ist, beträgt die Summe der hybridisierten Nukleotide aus der Hybridisierung von Abschnitt Helix Al mit Abschnitt Helix A2 und von Abschnitt Helix Bl mit Abschnitt Helix B2 10 bis 12 Nukleotidpaare.In a twenty-ninth embodiment of the seventh aspect, which is also an embodiment of the twenty-first, twenty-second, twenty-third, twenty-fourth, twenty-fifth, twenty-sixth, twenty-seventh and twenty-eighth embodiments, the sum of the hybridized nucleotides from the hybridization of section Helix A1 with section Helix A2 and of Section Helix Bl with section Helix B2 10 to 12 nucleotide pairs.
In einer dreißigsten Ausführungsform des siebten Aspekts, die auch eine Ausführungsform der vierundzwanzigsten, fünfundzwanzigsten, sechsundzwanzigsten, siebenundzwanzigsten, achtundzwanzigsten und neunundzwanzigsten Ausführungsform ist, ist zwischen dem 3 '-Ende des Abschnittes Box A2 und dem 5'-Ende des Abschnittes Helix B2 in 5 '-3 '-Richtung die Nukleo- tidsequenz GNy angeordnet, wobei Ny null bis sechs Nukleotide umfasst, bevorzugterweise 0 oder 6 Nukleotide.In a thirtieth embodiment of the seventh aspect, which is also an embodiment of the twenty-fourth, twenty-fifth, twenty-sixth, twenty-seventh, twenty-eighth and twenty-ninth embodiments, between the 3 'end of the section Box A2 and the 5' end of the section helix B2 in FIG '-3' direction the nucleus nucleotide GN y , where N y comprises zero to six nucleotides, preferably 0 or 6 nucleotides.
In einer einunddreißigsten Ausführungsform des siebten Aspekts, die auch eine Ausführungs- form der dreißigsten Ausführungsform ist, umfasst die HMGA bindende Nukleinsäure die folgende StrukturIn a thirty-first embodiment of the seventh aspect, which is also an embodiment of the thirtieth embodiment, the HMGA-binding nucleic acid has the following structure
Helix Al-Nv-Helix B1-N6N7JBOXÄT|NIN2GN8N3N4N5[BOX A2|G-Nγ-Helix B2-N7-Helix A2Helix Al-Nv-Helix B1-N 6 N 7 JBOXET | N I N 2 GN 8 N 3 N 4 N 5 [BOX A2 | GN γ -helix B2-N 7 -helix A2
wobeiin which
N1 = U, C, A oder G ist;N 1 = U, C, A or G;
N2 = G oder U ist;N 2 = G or U;
N3 = U oder C ist;N 3 = U or C;
N4 = U oder A ist;N 4 = U or A;
N5 = G oder A ist;N 5 = G or A;
N6 = G, A oder U ist;N 6 = G, A or U;
N7 = G oder U ist;N 7 = G or U;
N8 = U oder kein Nukleotid ist;N 8 = U or no nucleotide;
Nx = null bis fünf Nukleotide ist;N x = zero to five nucleotides;
Ny = null oder sechs Nukleotide ist; undNy = zero or six nucleotides; and
N2 = null bis sechs Nukleotide ist;N 2 = zero to six nucleotides;
der Abschnitt Box Al und Abschnitt Box A2 jeweils einzeln und unabhängig voneinander ausgewählt sind aus der Gruppe von Nukleotidsequenzen umfassend GGGCG, GGGUG und GGGAG;the section Box Al and section box A2 are each individually and independently selected from the group of nucleotide sequences comprising GGGCG, GGGUG and GGGAG;
der Abschnitt Helix Al und der Abschnitt Helix A2 jeweils einzeln und unabhängig voneinander vier bis acht Nukleotide umfassen, wobei bevorzugterweise die Abschnitte Helix Al und Helix A2 vollständig oder teilweise miteinander hybridisiert sind, undthe section Helix A1 and the section Helix A2 each individually and independently comprise four to eight nucleotides, wherein preferably the sections Helix Al and Helix A2 are completely or partially hybridized with each other, and
die Abschnitte Helix Bl und Helix B2 jeweils einzeln und unabhängig voneinander vier bis acht Nukleotide umfassen, wobei bevorzugterweise die Abschnitte Helix Bl und Helix B2 vollständig oder teilweise miteinander hybridisiert sind und der hybridisierende Bereich vier bis acht Nukleotide umfasst, und wobei die Summe der hybridisierten Nukleotide aus der Hybridisierung von Abschnitt Helix Al mit Abschnitt Helix A2 und von Abschnitt Helix Bl mit Abschnitt Helix B2 10 bis 12 Nukleotidpaare beträgt.the sections Helix Bl and Helix B2 each individually and independently comprise four to eight nucleotides, wherein preferably the sections Helix Bl and Helix B2 are completely or partially hybridized with each other and the hybridizing region four to eight Nucleotides, and wherein the sum of the hybridized nucleotides from the hybridization of section Helix Al with section Helix A2 and of section Helix Bl with section Helix B2 is 10 to 12 nucleotide pairs.
In einer zweiunddreißigsten Ausführungsform des siebten Aspekts, die auch eine Ausführungs- form der dreißigsten und einunddreißigsten Ausfuhrungsform ist, umfasst die HMGA bindende Nukleinsäure eine Sequenz ausgewählt aus der Gruppe umfassend SEQ. ID. No. 1, SEQ. ID. No. 2, SEQ. ID. No. 3, SEQ. ID. No. 5, SEQ. ID. No. 6, SEQ. ID. No. 7 und SEQ. ID. No. 13.In a thirty-second embodiment of the seventh aspect, which is also an embodiment of the thirtieth and thirty-first embodiment, the HMGA-binding nucleic acid comprises a sequence selected from the group comprising SEQ. ID. No. 1, SEQ. ID. No. 2, SEQ. ID. No. 3, SEQ. ID. No. 5, SEQ. ID. No. 6, SEQ. ID. No. 7 and SEQ. ID. No. 13th
In einer dreiunddreißigsten Ausführungsform des siebten Aspekts, die auch eine Ausführungsform der vierundzwanzigsten, fünfundzwanzigsten, sechsundzwanzigsten, siebenundzwanzigsten, achtundzwanzigsten und neunundzwanzigsten Ausführungsform ist, schließt sich das 3'- Ende des Abschnittes Box A2 unmittelbar an das 5 '-Ende des Abschnittes Helix B2 an.In a thirty-third embodiment of the seventh aspect, which is also an embodiment of the twenty-fourth, twenty-fifth, twenty-sixth, twenty-seventh, twenty-eighth and twenty-ninth embodiments, the 3 'end of the section Box A2 immediately adjoins the 5' end of the section Helix B2 ,
In einer vierunddreißigsten Ausfuhrungsform des siebten Aspekts, die auch eine Ausführungsform der dreiunddreißigsten Ausfuhrungsform ist, umfasst die HMGA bindende Nukleinsäure die folgende StrukturIn a thirty-fourth embodiment of the seventh aspect, which is also an embodiment of the thirty-third embodiment, the HMGA-binding nucleic acid has the following structure
Helix Al-Nv-Helix BI-N6N7POXATJNIN2GN8N3N4N5IBOX Ä^Helix B2-N7-Helix A2Helix Al-Nv-Helix BI-N 6 N 7 POXATJN I N 2 GN 8 N 3 N 4 N 5 IBOX Ä ^ Helix B2-N 7 -helix A2
wobeiin which
Ni = U, C, A oder G ist;Ni = U, C, A or G;
N2 = G oder U ist;N 2 = G or U;
N3 = U oder C ist;N 3 = U or C;
N4 = U oder A ist;N 4 = U or A;
N5 = G oder A ist;N 5 = G or A;
N6 = G, A oder U ist;N 6 = G, A or U;
N7 = G oder U ist;N 7 = G or U;
Ng = U oder kein Nukleotid ist;Ng = U or no nucleotide;
Nx = null bis fünf Nukleotide ist; undN x = zero to five nucleotides; and
Nz = null bis sechs Nukleotide ist; der Abschnitt Box Al und Abschnitt Box A2 jeweils einzeln und unabhängig voneinander ausgewählt sind aus der Gruppe von Nukleotidsequenzen umfassend GGGCG, GGGUG und GGGAG;N z = zero to six nucleotides; the section Box Al and section box A2 are each individually and independently selected from the group of nucleotide sequences comprising GGGCG, GGGUG and GGGAG;
der Abschnitt Helix Al und der Abschnitt Helix A2 jeweils einzeln und unabhängig voneinander vier bis acht Nukleotide umfassen, wobei bevorzugterweise die Abschnitte Helix Al und Helix A2 vollständig oder teilweise miteinander hybridisiert sind, undthe section Helix A1 and the section Helix A2 each individually and independently comprise four to eight nucleotides, wherein preferably the sections Helix Al and Helix A2 are completely or partially hybridized with each other, and
die Abschnitte Helix Bl und Helix B2 jeweils einzeln und unabhängig voneinander vier bis acht Nukleotide umfassen, wobei bevorzugterweise die Abschnitte Helix Bl und Helix B2 vollständig oder teilweise miteinander hybridisiert sind und der hybridisierende Bereich vier bis acht Nukleotide umfasst, und wobei die Summe der hybridisierten Nukleotide aus der Hybridisierung von Abschnitt Helix Al mit Abschnitt Helix A2 und von Abschnitt Helix Bl mit Abschnitt Helix B2 10 bis 12 Nukleotidpaare beträgt.the sections Helix Bl and Helix B2 each individually and independently comprise four to eight nucleotides, wherein preferably the sections Helix Bl and Helix B2 are fully or partially hybridized with each other and the hybridizing region comprises four to eight nucleotides, and wherein the sum of the hybridized nucleotides from the hybridization of section Helix Al with section Helix A2 and section Helix Bl with section Helix B2 is 10 to 12 nucleotide pairs.
In einer fünfunddreißigsten Ausführungsform des siebten Aspekts, die auch eine Ausführungsform der dreiunddreißigsten und vierunddreißigsten Ausführungsform ist, umfasst die HMGA bindende Nukleinsäure eine Sequenz umfassend SEQ. ID. No. 3.In a thirty-fifth embodiment of the seventh aspect, which is also an embodiment of the thirty-third and thirty-fourth embodiments, the HMGA-binding nucleic acid comprises a sequence comprising SEQ. ID. No. Third
In einer sechsunddreißigsten Ausführungsform des siebten Aspekts, die auch eine Ausführungsform der einunddreißigsten Ausführungsform ist, umfasst die HMGA bindende Nukleinsäure die folgende StrukturIn a thirty-sixth embodiment of the seventh aspect, which is also an embodiment of the thirty-first embodiment, the HMGA-binding nucleic acid has the following structure
Helix Bl-N6N7|Box A1|NIN2GN8N3N4N5|BOX A2JG-Nγ-Helix B2Helix Bl-N 6 N 7 | Box A1 | N I N 2 GN 8 N 3 N 4 N 5 | BOX A2JG-N γ -helix B2
In einer siebenunddreißigsten Ausführungsform des siebten Aspekts, die auch eine Ausfuhrungsform der vierunddreißigsten Ausfuhrungsform ist, umfasst die HMGA bindende Nukleinsäure die folgende StrukturIn a thirty-seventh embodiment of the seventh aspect, which is also an embodiment of the thirty-fourth embodiment, the HMGA-binding nucleic acid has the following structure
Helix BI-N6N7IBOX AIININ2GN8N3N4N5IBOX Ä2jHelix B2Helix BI-N 6 N 7 IBOX AIIN I N 2 GN 8 N 3 N 4 N 5 IBOX A 2jHelix B2
In einer achtunddreißigsten Ausführungsform des siebten Aspekts, die auch eine Ausfuhrungsform der sechsunddreißigsten Ausfuhrungsform ist, umfasst die HMGA bindende Nukleinsäure eine Sequenz, die ausgewählt ist aus der Gruppe umfassend SEQ. ID. No. 15 und SEQ. ID. No. 16.In a thirty-eighth embodiment of the seventh aspect, which is also an embodiment of the thirty-sixth embodiment, the HMGA comprises binding nucleic acid a sequence selected from the group comprising SEQ. ID. No. 15 and SEQ. ID. No. 16th
In einer neununddreißigsten Ausführungsform des siebten Aspekts, die auch eine Ausfuhrungsform der ersten, zweiten, dritten, vierten, fünften, sechsten, siebten, achten, neunten, zehnten, elften, zwölften, dreizehnten und sechzehnten oder siebzehnten Ausführungsform des siebten Aspekts ist, umfasst die HGMA bindende Nukleinsäure einen Zwischenabschnitt Z2 der 12 bis 25 Nukleotide umfasst.In a thirty-ninth embodiment of the seventh aspect, which is also an embodiment of the first, second, third, fourth, fifth, sixth, seventh, eighth, ninth, tenth, eleventh, twelfth, thirteenth and sixteenth or seventeenth embodiment of the seventh aspect, the HGMA-binding nucleic acid comprises an intermediate section Z 2 of 12 to 25 nucleotides.
In einer vierzigsten Ausführungsform des siebten Aspekts, die auch eine Ausführungsform der neununddreißigsten Ausführungsform ist, umfassend die HGMA bindende Nukleinsäure einen Zwischenabschnitt Z2 einen Abschnitt Helix Cl und einen Abschnitt Helix C2.In a fortieth embodiment of the seventh aspect, which is also an embodiment of the thirty-ninth embodiment, the HGMA binding nucleic acid comprises an intermediate portion Z2, a portion Helix C1, and a portion Helix C2.
In einer einundvierzigsten Ausführungsform des siebten Aspekts, die auch eine Ausführungsform der vierzigsten Ausführungsform ist, ist zwischen dem Abschnitt Helix Cl und dem Abschnitt Helix C2 der HMGA bindenden Nukleinsäure ein zentraler Abschnitt Nc angeordnet.In a forty-first embodiment of the seventh aspect, which is also an embodiment of the fortieth embodiment, a central portion N c is disposed between the helix Cl portion and the helix C2 portion of the HMGA-binding nucleic acid.
In einer zweiundvierzigsten Ausführungsform des siebten Aspekts, die auch eine Ausführungsform der vierzigsten oder einundvierzigsten Ausführungsform ist, ist die Länge des Abschnittes Helix Cl und Helix C2 der HGMA bindenden Nukleinsäure gleich lang.In a forty-second embodiment of the seventh aspect, which is also an embodiment of the fortieth or forty-first embodiment, the length of the helix C1 and helix C2 portion of the HGMA-binding nucleic acid is the same length.
In einer dreiundvierzigsten Ausführungsform des siebten Aspekts, die auch eine Ausführungsform der vierzigsten, einundvierzigsten und zweiundvierzigsten Ausführungsform ist, ist die Länge des Abschnittes Helix Cl und Helix C2 der HGMA bindenden Nukleinsäure einzeln und unabhängig drei bis sechs Nukleotide.In a forty-third embodiment of the seventh aspect, which is also an embodiment of the fortieth, forty-first, and forty-second embodiments, the length of the helix Cl and helix C2 portion of the HGMA-binding nucleic acid is individually and independently three to six nucleotides.
In einer vierundvierzigsten Ausführungsform des siebten Aspekts, die auch eine Ausführungsform der vierzigsten, einundvierzigsten, zweiundvierzigsten und dreiundvierzigsten Ausführungsform ist, sind die Abschnitte Helix Cl und Helix C2 der HMGA bindenden Nukleinsäure vollständig oder teilweise miteinander hybridisiert.In a forty-fourth embodiment of the seventh aspect, which is also an embodiment of the fortieth, forty-first, forty-second, and forty-third embodiments, the helix Cl and helix C2 portions of the HMGA-binding nucleic acid are fully or partially hybridized with each other.
In einer fünfundvierzigsten Ausführungsform des siebten Aspekts, die auch eine Ausführungsform der neununddreißigsten, vierzigsten, einundvierzigsten, zweiundvierzigsten, dreiundvier- zigsten und vierundvierzigsten Ausfuhrungsform ist, umfasst der zentrale Abschnitt Nc der HMGA bindenden Nukleinsäure drei bis fünf Nukleotide.In a forty-fifth embodiment of the seventh aspect, which is also an embodiment of the thirty-ninth, fortieth, forty-first, forty-second, third and fourth eighth and forty-fourth embodiment, the central portion N c of the HMGA-binding nucleic acid comprises three to five nucleotides.
In einer sechsundvierzigsten Ausführungsform des siebten Aspekts, die auch eine Ausführungsform der neununddreißigsten, vierzigsten, einundvierzigsten, zweiundvierzigsten, dreiundvierzigsten, vierundvierzigsten und fünfundvierzigsten Ausfuhrungsform ist, umfasst die HMGA bindende Nukleinsäure einen Abschnitt Box Al und einen Abschnitt Box A2, wobei zwischen dem 3 '-Ende des Abschnittes Box Al und dem 5 '-Ende des Abschnittes Helix Cl eine Nukleo- tidsequenz Nb angeordnet ist und drei Nukleotide umfasst.In a forty-sixth embodiment of the seventh aspect, which is also an embodiment of the thirty-ninth, fortieth, forty-fourth, forty-second, forty-third, forty-fourth and forty-fifth embodiment, the HMGA-binding nucleic acid comprises a section Box Al and a section box A2, wherein between the 3 ' End of the section Box Al and the 5 'end of the section Helix Cl is a nucleotide sequence N b is arranged and comprises three nucleotides.
In einer siebenundvierzigsten Ausführungsform des siebten Aspekts, die auch eine Ausfuhrungs- form der neununddreißigsten, vierzigsten, einundvierzigsten, zweiundvierzigsten, dreiundvierzigsten, vierundvierzigsten, funfundvierzigsten und sechsundvierzigsten Ausfuhrungsform ist, umfasst die HMGA bindende Nukleinsäure einen Abschnitt Box Al und einen Abschnitt Box A2, wobei zwischen dem 3 '-Ende des Abschnittes Helix C2 und dem 5 '-Ende des Abschnittes Box A2 eine Nukleotidsequenz Nd angeordnet ist und zwei bis fünf Nukleotide umfasst.In a forty-seventh embodiment of the seventh aspect, which is also an embodiment of the thirty-ninth, fortieth, forty-fourth, forty-second, forty-third, forty-fourth, forty-fifth and forty-sixth embodiment, the HMGA-binding nucleic acid comprises a section Box Al and a section box A2, wherein between the 3'-end of the section Helix C2 and the 5 'end of the section Box A2 a nucleotide sequence N d is arranged and comprises two to five nucleotides.
In einer achtundvierzigsten Ausführungsform des siebten Aspekts, die auch eine Ausführungs- form der neununddreißigsten, vierzigsten, einundvierzigsten, zweiundvierzigsten, dreiundvierzigsten, vierundvierzigsten, fünfundvierzigsten, sechsundvierzigsten und siebenundvierzigsten Ausführungsform ist, umfasst die HMGA bindende Nukleinsäure einen Abschnitt Helix Al und einen Abschnitt Helix A2.In a forty-eighth embodiment of the seventh aspect, which is also an embodiment of the thirty-ninth, fortieth, forty-fourth, forty-second, forty-third, forty-fourth, forty-fifth, forty-sixth, and forty-seventh embodiment, the HMGA-binding nucleic acid comprises a section Helix A1 and a section Helix A2.
In einer neunundvierzigsten Ausführungsform des siebten Aspekts, die auch eine Ausführungsform der achtundvierzigsten Ausführungsform ist, umfassen die Abschnitte Helix Al und Helix A2 der HMGA bindenden Nukleinsäure jeweils einzeln und unabhängig voneinander fünf bis sechs Nukleotide, wobei bevorzugterweise der Abschnitt Helix Al und der Abschnitt Helix A2 vollständig oder teilweise miteinander hybridisiert sind.In a forty-ninth embodiment of the seventh aspect, which is also an embodiment of the forty-eighth embodiment, the sections Helix A1 and Helix A2 of the HMGA-binding nucleic acid each individually and independently of each other comprise five to six nucleotides, preferably the section Helix A1 and the section Helix A2 completely or partially hybridized with each other.
In einer fünfzigsten Ausführungsform des siebten Aspekts, die auch eine Ausführungsform der achtundvierzigsten und neunundvierzigsten Ausführungsform ist, ist zwischen dem 3 '-Ende des Abschnittes Helix Al und dem 5'-Ende des Abschnittes Box Al der HMGA bindenden Nukleinsäure eine Nukleotidsequenz Na angeordnet, wobei N3 ein bis fünf Nukleotide umfasst. In einer einundfünfzigsten Ausfuhrungsform des siebten Aspekts, die auch eine Ausführungs- form der achtundvierzigsten, neunundvierzigsten und fünfzigsten Ausführungsform ist, ist zwischen dem 3 '-Ende des Abschnittes Box A2 und dem 5 '-Ende des Abschnittes Helix A2 der HMGA bindenden Nukleinsäure in 5 '-3 '-Richtung eine Nukleotidsequenz GNe angeordnet, wobei Ne eins bis zwei Nukleotide, bevorzugterweise A oder UU umfasst.In a fiftieth embodiment of the seventh aspect, which is also an embodiment of the forty-eighth and forty-ninth embodiments, a nucleotide sequence N a is arranged between the 3 'end of the section Helix Al and the 5' end of the section Box Al of the HMGA-binding nucleic acid, wherein N 3 comprises one to five nucleotides. In a fifty-first embodiment of the seventh aspect, which is also an embodiment of the forty-eighth, forty-ninth and fiftieth embodiments, between the 3 'end of the box A2 section and the 5' end of the helix A2 section of the HMGA binding nucleic acid in FIG '-3' direction a nucleotide sequence GN e , where N e comprises one to two nucleotides, preferably A or UU.
In einer zweiundfünfzigsten Ausfuhrungsform des siebten Aspekts, die auch eine Ausführungsform der achtundvierzigsten, neunundvierzigsten, fünfzigsten und einundfünfzigsten Ausführungsform ist, weisen der Abschnitt Helix Cl und der Abschnitt Helix C2 der HMGA bindenden Nukleinsäure jeweils einzeln und unabhängig voneinander eine Länge von fünf oder sechs Nukleotiden auf, wobei bevorzugterweise die Abschnitte Helix Cl und Helix C2 vollständig oder teilweise miteinander hybridisiert sind.In a fifty-second embodiment of the seventh aspect, which is also an embodiment of the forty-eighth, forty-ninth, fiftieth and fifty-first embodiments, the helix Cl and helix C2 portions of the HMGA-binding nucleic acid are each independently and independently of one another five or six nucleotides in length , wherein preferably the sections Helix Cl and Helix C2 are completely or partially hybridized with each other.
In einer dreiundfünfzigsten Ausführungsform des siebten Aspekts, die auch eine Ausführungsform der zweiundfünfzigsten Ausführungsform ist, umfasst die HMGA bindende Nukleinsäure die folgende Struktur:In a fifty-third embodiment of the seventh aspect, which is also an embodiment of the fifty-second embodiment, the HMGA-binding nucleic acid has the following structure:
Helix_Al-Na-|Box AlJ-Nb-1HeIiX CH-N6-1HeIiX C2'-Nd-JBox Ä2|-G-Ne-Helix A2 (III)Helix_Al-N a - | Box AlJ-N b - 1 HeIiX CH-N 6 - 1 HeIiX C2'-N d -JBox A2 | -GN e -Helix A2 (III)
wobeiin which
N3 = ein bis fünf Nukleotide ist;N 3 = one to five nucleotides;
Nb = drei Nukleotide ist;N b = three nucleotides;
Nc = drei bis fünf Nukleotide ist;N c = three to five nucleotides;
Nd = zwei bis fünf Nukleotide ist; undN d = two to five nucleotides; and
Ne = eins bis zwei Nukleotide, bevorzugterweise A oder UU ist;N e = one to two nucleotides, preferably A or UU;
der Abschnitt Box Al und der Abschnitt Box A2 jeweils einzeln und unabhängig voneinander ausgewählt sind aus der Gruppe, die GGGCG, GGGUG und GGGAG umfasst,the section Box Al and the section box A2 are each individually and independently selected from the group comprising GGGCG, GGGUG and GGGAG,
die Abschnitte Helix Al und Helix A2 jeweils einzeln und unabhängig voneinander fünf oder sechs Nukleotide umfassen, und ^the sections Helix A1 and Helix A2 each individually and independently comprise five or six nucleotides, and ^
die Abschnitte Helix Cl und Helix C2 jeweils fünf oder sechs Nukleotide umfasst, die bevorzugterweise vollständig oder teilweise miteinander hybridisiert sind.the sections helix Cl and helix C2 each comprise five or six nucleotides, which are preferably fully or partially hybridized with each other.
In einer vierundfünfzigsten Ausführungsform des siebten Aspekts, die auch eine Ausfύhrungs- form der dreiundfünfzigsten Ausführungsform ist, umfasst die HMGA bindende Nukleinsäure eine Sequenz, die ausgewählt ist aus der Gruppe umfassend SEQ. ID. No. 8, SEQ. ID. No. 9, SEQ. ID. No. 10, SEQ. ID. No. 11, SEQ. ID. No. 14, SEQ. ED. No. 22 und SEQ. ID. No. 24.In a fifty-fourth embodiment of the seventh aspect, which is also an embodiment of the fifty-third embodiment, the HMGA-binding nucleic acid comprises a sequence selected from the group comprising SEQ. ID. No. 8, SEQ. ID. No. 9, SEQ. ID. No. 10, SEQ. ID. No. 11, SEQ. ID. No. 14, SEQ. ED. No. 22 and SEQ. ID. No. 24th
In einer fünfundfünfzigsten Ausführungsform des siebten Aspekts, die auch eine Ausführungsform der neununddreißigsten, vierzigsten, einundvierzigsten, zweiundvierzigsten, dreiundvierzigsten und vierundvierzigsten Ausführungsform ist, umfasst die Nukleinsäure einen Abschnitt Box Al und einen Abschnitt Helix Cl der HMGA bindenden Nukleinsäure, wobei zwischen dem 3'-Ende des Abschnittes Box Al und dem 5 '-Ende des Abschnittes Helix Cl ein Nukleotid A angeordnet ist.In a fifty-fifth embodiment of the seventh aspect, which is also an embodiment of the thirty-ninth, fortieth, forty-first, forty-second, forty-third, and forty-fourth embodiments, the nucleic acid comprises a portion of box Al and a portion of helix Cl of the HMGA-binding nucleic acid, wherein between the 3 ' End of the section box Al and the 5 'end of the section Helix Cl is a nucleotide A.
In einer sechsundfünfzigsten Ausführungsform des siebten Aspekts, die auch eine Ausführungsform der fünfundfünfzigsten Ausführungsforrn ist, umfasst die HMGA bindende Nukleinsäure einen Abschnitt Helix C2 und einen Abschnitt Box A2, wobei zwischen dem 3 '-Ende des Abschnittes Helix C2 und dem 5 '-Ende des Abschnittes Box A2 ein Nukleotid G angeordnet ist.In a fifty-sixth embodiment of the seventh aspect, which is also an embodiment of the fifty-fifth embodiment, the HMGA-binding nucleic acid comprises a section helix C2 and a section box A2, wherein between the 3 'end of the section helix C2 and the 5' end of the Section box A2 a nucleotide G is arranged.
In einer siebenundfünfzigsten Ausführungsform des siebten Aspekts, die auch eine Ausführungsform der fünfundfünfzigsten oder sechsundfünfzigsten Ausführungsform ist, umfasst der zentrale Abschnitt Nc der HMGA bindenden Nukleinsäure vier Nukleotide, wobei Nc bevorzugterweise GAUG ist.In a fifty-seventh embodiment of the seventh aspect, which is also an embodiment of the fifty-fifth or fifty-sixth embodiment, the central portion N c of the HMGA-binding nucleic acid comprises four nucleotides, wherein N c is preferably GAUG.
In einer achtundfünfzigsten Ausführungsform des siebten Aspekts, die auch eine Ausführungsform der fünfundfünfzigsten, sechsundfünfzigsten und siebenundfünfzigsten Ausführungsform ist, umfasst die HMGA bindende Nukleinsäure einen Abschnitt Helix Bl und einen Abschnitt Helix B2.In a fifty-eighth embodiment of the seventh aspect, which is also an embodiment of the fifty-fifth, fifty-sixth, and fifty-seventh embodiment, the HMGA-binding nucleic acid comprises a section Helix Bl and a section Helix B2.
In einer neunundfünfzigsten Ausführungsform des siebten Aspekts, die auch eine Ausführungsform der achtundfünfzigsten Ausführungsform ist, umfassen die Abschnitte Helix Bl und Helix B2 der HMGA bindenden Nukleinsäure einzeln und unabhängig voneinander jeweils fünf Nukleotide, wobei bevorzugterweise der Abschnitt Helix Bl mit dem Abschnitt Helix B2 hybridisiert ist.In a fifty-ninth embodiment of the seventh aspect, which is also an embodiment of the fifty-eighth embodiment, the sections Helix Bl and Helix B2 of the HMGA-binding nucleic acid individually and independently each five Nucleotides, wherein preferably the section Helix Bl is hybridized with the section Helix B2.
In einer sechzigsten Ausfuhrungsform des siebten Aspekts, die auch eine Ausfuhrungsform der achtundfunfzigsten oder neunundfünfzigsten Ausfuhrungsform ist, sind zwischen dem 3 '-Ende des Abschnittes Helix Bl und dem 5 '-Ende des Abschnittes Box Al der HMGA bindenden Nukleinsäure eine Nukleotidsequenz umfassend zwei Nukleotide Nj angeordnet, wobei Nj bevorzugterweise AG ist.In a sixtieth embodiment of the seventh aspect, which is also an embodiment of the fifty-eighth or fifty-ninth embodiment, between the 3 'end of section Helix Bl and the 5' end of section Box Al of the HMGA-binding nucleic acid is a nucleotide sequence comprising two nucleotides N j , where N j is preferably AG.
In einer einundsechzigsten Ausfuhrungsform des siebten Aspekts, die auch eine Ausführungsform der achtundfünfzigsten, neunundfünfzigsten und sechzigsten Ausführungsform ist, ist zwischen dem 3 '-Ende des Abschnittes Box A2 und dem 5 '-Ende von Helix B2 der HMGA bindenden Nukleinsäure ein Nukleotid G angeordnet.In a sixty-first embodiment of the seventh aspect, which is also an embodiment of the fifty-eighth, fifty-ninth and sixtieth embodiment, a nucleotide G is located between the 3 'end of the box A2 section and the 5' end of helix B2 of the HMGA binding nucleic acid.
In einer zweiundsechzigsten Ausfuhrungsform des siebten Aspekts, die auch eine Ausfuhrungsform der fünfundfünfzigsten, sechsundfünfzigsten, siebenundfünfzigsten, achtundfunfzigsten, neunundfünfzigsten, sechzigsten und einundsechzigsten Ausfuhrungsform ist, umfasst die HGMA bindende Nukleinsäure einen Abschnitt Helix Al und einen Abschnitt Helix A2.In a sixty-second embodiment of the seventh aspect, which is also an embodiment of the fifty-fifth, fifty-sixth, fifty-seventh, fiftieth, fifty-ninth, sixty and sixty-first embodiment, the HGMA-binding nucleic acid comprises a section Helix A1 and a section Helix A2.
In einer dreiundsechzigsten Ausführungsform des siebten Aspekts, die auch eine Ausführungsform der zweiundsechzigsten Ausfuhrungsform ist, umfassen die Abschnitte Helix Al und Helix A2 der HMGA bindenden Nukleinsäure einzeln und unabhängig voneinander jeweils sechs Nukleotide und sind bevorzugterweise der Abschnitt Helix Al und der Abschnitt Helix A2 miteinander hybridisiert.In a sixty-third embodiment of the seventh aspect, which is also an embodiment of the sixty-second embodiment, the sections Helix A1 and Helix A2 of the HMGA-binding nucleic acid individually and independently each six nucleotides and are preferably the section Helix Al and the section Helix A2 hybridized with each other ,
In einer vierundsechzigsten Ausfuhrungsform des siebten Aspekts, die auch eine Ausfuhrungsform der zweiundsechzigsten und dreiundsechzigsten Ausfuhrungsform ist, ist zwischen dem 3'- Ende des Abschnittes Helix Al und dem 5'-Ende des Abschnittes Helix Bl eine Nukleotidsequenz umfassend zwei Nukleotide Nj angeordnet, wobei Nj bevorzugterweise CA ist.In a sixty-fourth embodiment of the seventh aspect, which is also an embodiment of sixty-second and sixty-third embodiments, a nucleotide sequence comprising two nucleotides Nj is located between the 3 'end of section Helix Al and the 5' end of section Helix Bl, where Nj preferably CA is.
In einer fünfundsechzigsten Ausfuhrungsform des siebten Aspekts, die auch eine Ausführungsform der zweiundsechzigsten, dreiundsechzigsten und vierundsechzigsten Ausfuhrungsform ist, ist zwischen dem 3 '-Ende des Abschnittes Helix B2 und dem 5 '-Ende des Abschnittes Helix A2 ein Nukleotid A angeordnet. In einer sechsundsechzigsten Ausführungsform des siebten Aspekts, die auch eine Ausfuhrungsform der fünfundfünfzigsten bis fünfundsechzigsten Ausführungsform ist, umfassen die Abschnitte Helix Cl und Helix C2 jeweils drei Nukleotide, wobei bevorzugterweise die Abschnitte Helix Cl und Helix C2 miteinander hybridisiert sind.In a sixty-fifth embodiment of the seventh aspect, which is also an embodiment of the sixty-second, sixty-third and sixty-fourth embodiment, a nucleotide A is located between the 3 'end of the helix B2 section and the 5' end of the helix A2 section. In a sixty-sixth embodiment of the seventh aspect, which is also an embodiment of the fifty-fifth to sixty-fifth embodiments, the sections helix Cl and helix C2 each comprise three nucleotides, wherein preferably the sections helix Cl and helix C2 are hybridized with each other.
In einer siebenundsechzigsten Ausführungsform des siebten Aspekts, die auch eine Ausführungsform der sechsundsechzigsten Ausführungsform ist, umfasst die HMGA bindende Nukleinsäure die folgende Struktur:In a seventy-seventh embodiment of the seventh aspect, which is also an embodiment of the sixty-sixth embodiment, the HMGA-binding nucleic acid has the following structure:
He!ix_Ai-NrHelix Hey! Ix_Ai-NrHelix
wobeiin which
Nj = zwei Nukleotide umfasst, bevorzugterweise CA ist; Nj = zwei Nukleotide umfasst, bevorzugterweise AG ist; Nc = vier Nukleotide umfasst, bevorzugterweise GAUG ist;Nj = two nucleotides, preferably CA; Nj = two nucleotides, preferably AG; N c = four nucleotides, preferably GAUG;
die Abschnitte Box Al und Box A2 jeweils einzeln und unabhängig voneinander ausgewählt sind aus der Gruppe umfassend die Sequenzen GGGCG, GGGUG und GGGAG;the sections Box Al and Box A2 are each individually and independently selected from the group comprising the sequences GGGCG, GGGUG and GGGAG;
die Abschnitte Helix Al und Helix A2 jeweils einzeln und unabhängig sechs Nukleotide umfassen, die bevorzugterweise miteinander hybridisiert sind;the sections Helix A1 and Helix A2 each individually and independently comprise six nucleotides, which are preferably hybridized with each other;
die Abschnitte Helix Bl und Helix B2 jeweils einzeln und unabhängig fünf Nukleotide umfassen, wobei bevorzugterweise der Abschnitt Helix Bl und der Abschnitt Helix B2 miteinander hybridisiert ist; undthe sections Helix Bl and Helix B2 individually and independently comprise five nucleotides, whereby preferably the section Helix Bl and the section Helix B2 are hybridized with each other; and
die Abschnitte Helix Cl und Helix C2 jeweils einzeln und unabhängig drei Nukleotide umfassen, wobei bevorzugterweise die Abschnitte Helix Cl und Helix C2 miteinander hybridisiert sind. In einer achtundsechzigsten Ausfϊihrungsform des siebten Aspekts, die auch eine Ausführungs- form der siebenundsechzigsten Ausfuhrungsform ist, umfasst die HMGA bindende Nukleinsäure eine Sequenz, die ausgewählt ist aus der Gruppe umfassend SEQ. ID. No. 12.the sections helix Cl and helix C2 each individually and independently comprise three nucleotides, wherein preferably the sections helix Cl and helix C2 are hybridized with each other. In a sixty-eighth embodiment of the seventh aspect, which is also an embodiment of the sixty-seventh embodiment, the HMGA-binding nucleic acid comprises a sequence selected from the group comprising SEQ. ID. No. 12th
In einer neunundsechzigsten Ausführungsform des siebten Aspekts, die auch eine Ausführungsform der zweiten bis siebenundsechzigsten Ausführungsform ist, ist die Nukleinsäure eine solche, die an Transkriptionsfaktoren bindet, insbesondere Transkriptionsfaktoren, die einen AT- Haken aufweisen.In a sixty-ninth embodiment of the seventh aspect, which is also an embodiment of the second to sixty-seventh embodiments, the nucleic acid is one which binds to transcription factors, particularly transcription factors having an AT-hook.
Erfindungsgemäß wird die Aufgabe gelöst in einem achten Aspekt durch eine Nukleinsäure , die an einen Transkriptionsfaktor umfassend einen AT-Haken bindet, wobei die Nukleinsäure einen Aufbau gemäß dem siebten Aspekt umfasst.According to the invention, the object is achieved in an eighth aspect by a nucleic acid which binds to a transcription factor comprising an AT hook, wherein the nucleic acid comprises a construction according to the seventh aspect.
In einer Ausführungsform der Zusammensetzung nach dem sechsten Aspekt ist die L- Nukleinsäure eine Nukleinsäure nach dem siebten Aspekt.In one embodiment of the composition according to the sixth aspect, the L-nucleic acid is a nucleic acid according to the seventh aspect.
In einer Ausführungsform der Verwendung nach dem ersten Aspekt ist die L-Nukleinsäure eine Nukleinsäure nach dem siebten Aspekt.In one embodiment of the use according to the first aspect, the L-nucleic acid is a nucleic acid according to the seventh aspect.
In einer Ausführungsform des Verfahrens nach dem zweiten Aspekt ist die L-Nukleinsäure eine Nukleinsäure nach dem siebten Aspekt.In one embodiment of the method according to the second aspect, the L-nucleic acid is a nucleic acid according to the seventh aspect.
In einer Ausfühnmgsform der Verwendung nach dem dritten Aspekt ist die L-Nukleinsäure eine Nukleinsäure nach dem siebten Aspekt.In one embodiment of the use according to the third aspect, the L-nucleic acid is a nucleic acid according to the seventh aspect.
In einer Ausführungsform des Verfahrens nach dem vierten Aspekt ist die L-Nukleinsäure eine Nukleinsäure nach dem siebten Aspekt.In one embodiment of the method according to the fourth aspect, the L-nucleic acid is a nucleic acid according to the seventh aspect.
Erfindungsgemäß wird die Aufgabe gelöst in einem neunten Aspekt durch ein Verfahren zum Screenen eines HMGA- Antagonisten oder HMGA-Agonisten umfassend die folgenden Schritte:According to the invention, the object is achieved in a ninth aspect by a method for screening an HMGA antagonist or HMGA agonist comprising the following steps:
Bereitstellen eines Kandidaten-HMGA-Antagonisten und/oder eines Kandidaten- HMGA-Agonisten, Bereitstellen einer Nukleinsäure nach dem siebten Aspekt,Providing a candidate HMGA antagonist and / or a candidate HMGA agonist, Providing a nucleic acid according to the seventh aspect,
Bereitstellen eines Testsystems, welches ein Signal in Gegenwart eines HMGA- Antagonisten und/oder eines HMGA- Agonisten liefert, undProviding a test system which provides a signal in the presence of an HMGA antagonist and / or an HMGA agonist, and
Bestimmen, ob der Kandidaten-HMGA-Antagonist ein HMGA-Antagonist ist und/oder ob der Kandidaten-HMGA-Agonist ein HMGA- Agonist ist.Determining whether the candidate HMGA antagonist is an HMGA antagonist and / or whether the candidate HMGA agonist is an HMGA agonist.
Erfindungsgemäß wird die Aufgabe gelöst in einem zehnten Aspekt durch ein Verfahren zum Screenen eines HMGA-Agonisten und/oder eines HMGA-Antagonisten umfassend die folgenden Schritte:According to the invention, the object is achieved in a tenth aspect by a method for screening an HMGA agonist and / or an HMGA antagonist comprising the following steps:
Bereitstellen eines an einer Phase, bevorzugterweise einer Festphase, imobilisier- ten HMGA,Providing a HMGA immobilized on one phase, preferably a solid phase,
Bereitstellen einer Nukleinsäure gemäß dem siebten Aspekt, bevorzugterweise eine Nukleinsäure nach dem siebten Aspekt, die markiert ist,Providing a nucleic acid according to the seventh aspect, preferably a nucleic acid according to the seventh aspect, which is labeled
Zugeben eines Kandidaten-HMGA-Agonisten und/oder eines Kandidaten- HMGA- Antagonisten, undAdding a candidate HMGA agonist and / or a candidate HMGA antagonist, and
Bestimmen, ob der Kandidaten-HMGA-Agonist ein HMGA-Agonist ist und/oder ob der Kandidaten-HMGA-Antagonist ein HMGA-Antagonist ist.Determining whether the candidate HMGA agonist is an HMGA agonist and / or whether the candidate HMGA antagonist is an HMGA antagonist.
In einer Ausführungsform des zehnten Aspekts ist vorgesehen, dass die Bestimmung so durchgeführt wird, dass getestet wird, ob die Nukleinsäure durch den Kandidaten-HMGA-Agonisten oder durch den Kandidaten-HMGA- Antagonisten ersetzt wird.In one embodiment of the tenth aspect, it is contemplated that the determination is made to test whether the nucleic acid is being replaced by the candidate HMGA agonist or by the candidate HMGA antagonist.
Erfindungsgemäß wird die Aufgabe gelöst in einem elften Aspekt durch einen Kit für den Nachweis von HMGA, umfassend eine Nukleinsäure nach dem siebten Aspekt.According to the invention, the object is achieved in an eleventh aspect by a kit for the detection of HMGA comprising a nucleic acid according to the seventh aspect.
Erfindungsgemäß wird die Aufgabe gelöst in einem zwölften Aspekt durch einen HMGA- Antagonisten, der durch ein Verfahren nach dem zehnten Aspekt erhältlich ist. Erfindungsgemäß wird die Aufgabe gelöst in einem dreizehnten Aspekt durch einen HMGA- Agonisten, der durch ein Verfahren nach dem zehnten Aspekt erhältlich ist.According to the invention, the object is achieved in a twelfth aspect by an HMGA antagonist obtainable by a method according to the tenth aspect. According to the invention, the object is achieved in a thirteenth aspect by a HMGA agonist obtainable by a method according to the tenth aspect.
Erfmdungsgemäß wird die Aufgabe gelöst in einem vierzehnten Aspekt durch einen Komplex umfassend ein HMGA-Protein und eine Nukleinsäure nach dem siebten Aspekt.According to the invention, the object is achieved in a fourteenth aspect by a complex comprising an HMGA protein and a nucleic acid according to the seventh aspect.
Der vorliegenden Erfindung liegt die überraschende Erkenntnis zugrunde, dass es entgegen der Auffassung im Stand der Technik möglich ist, L-Nukleinsäuren und insbesondere Spiegelmere zu verwenden, um intrazelluläre Zielmoleküle zu adressieren. Bei den intrazellulären Zielmolekülen handelt es sich bevorzugterweise um Zielmoleküle, die in einer Zelle vorliegen. Die den funktionalen L-Nukleinsäuren durch ihren Aufbau aus L-Nukleotiden inhärenten Eigenschaften wie hohe Spezifität der Wechselwirkung mit ihren Zielmolekülen bei gleichzeitig hoher Stabilität und Fehlen von toxischen oder immunologisch aktiven Abbauprodukten bei Anwendung derselben in biologischen Systemen und insbesondere im tierischen und menschlichen Körper erlaubt es nicht, die zellulären Mechanismen zu nutzen, um, wie im Falle der Intramere, L- Nukleinsäuren von einem Plasmid oder allgemein einem Vektor codieren zu lassen und damit die eigentlich funktionale Nukleinsäure durch den intrazellulär ablaufenden Prozess der Transkription bereitzustellen.The present invention is based on the surprising finding that contrary to the prior art it is possible to use L-nucleic acids and in particular spiegelmers to address intracellular target molecules. The intracellular target molecules are preferably target molecules present in a cell. It allows the functional L-nucleic acids by their structure of L-nucleotides inherent properties such as high specificity of the interaction with their target molecules with high stability and lack of toxic or immunologically active degradation products when applied in biological systems and in particular in the animal and human body not to use the cellular mechanisms to encode, as in the case of intramers, L-nucleic acids from a plasmid or, more generally, a vector and thus to provide the actual functional nucleic acid through the intracellular process of transcription.
Dieses unentrinnbare Dilemma wird mit der vorliegenden Erfindung gelöst: Funktionale L- Nukleinsäuren und insbesondere Spiegelmere können unter Beibehaltung ihrer Spezifität was ihre Bindung an ihr Zielmolekül anbelangt, und ihrer Aktivität über eine Cytoplasmamembran transportiert werden. Diese Durchgängigkeit der funktionalen L-Nukleinsäuren ist den Spiegel- meren inhärent und kann durch die Verwendung von Abgabevehikeln oder Abgabetechniken noch verstärkt werden. Ohne im folgenden darauf festgelegt sein zu wollen, gehen die vorliegenden Erfinder davon aus, dass funktionale L-Nukleinsäuren an sich die Cytoplasmamembran ü- berwinden können, bzw. bei Beteiligung von endosomalen Transportmechanismen bei der Ü- berwindung der Cytoplasmamembran, diese aus den sich dabei ausbildenden Vesikelstrukturen unter Einnahme einer zwei- bzw. dreidimensionalen Struktur zu befreien in der Lage sind, die die spezifische Wechselwirkung der funktionalen Nukleinsäure mit ihrem Zielmolekül erlaubt. Mit der hierin gegebenen technischen Lehre wendet man sich bewusst von dem für Aptamere entwickelten Prinzip der Nutzung von intrazellulären Transkriptionsmechanismen zur Erzeugung von Aptameren in der Zelle ab und stellt erstmalig Mittel für die Anwendung von funktionalen L-Nukleinsäuren und insbesondere von Spiegelmeren in Zellen bereit. Wie hierin in einer bevorzugten Ausfuhrungsform verwendet, bezeichnet der Begriff der funktionalen Nukleinsäuren solche Nukleinsäuren, die verschieden sind von strukturellen, insbesondere natürlich vorkommenden strukturellen Nukleinsäuren wie rRNAs oder von codierenden Nukleinsäuren wie mRNAs. Insbesondere sind funktionale Nukleinsäuren Nukleinsäuren, die aufgrund ihrer zwei- und/oder dreidimensionalen Struktur in der Lage sind, an Zielmoleküle zu binden. In einer besonders bevorzugten Ausführungsform erfolgt die Bindung an das Zielmolekül nicht durch Hybridisierung oder Basenpaarung auf der Grundlage von Watson-Crick- Basenpaarungen oder einer Hoogsteen-Basenpaarung. Besonders bevorzugte funktionale Nukleinsäuren sind Aptamere und Spiegelmere.This inescapable dilemma is solved with the present invention: Functional L-nucleic acids and in particular spiegelmers can be transported while maintaining their specificity with respect to their binding to their target molecule and their activity via a cytoplasmic membrane. This patency of the functional L-nucleic acids is inherent in the Spiegelmers and may be exacerbated by the use of delivery vehicles or delivery techniques. Without wishing to be bound by it, the present inventors assume that functional L-nucleic acids per se can overcome the cytoplasmic membrane or, in the case of involvement of endosomal transport mechanisms in overcoming the cytoplasmic membrane, they can become involved forming vesicle structures capable of releasing a two- or three-dimensional structure that allows the specific interaction of the functional nucleic acid with its target molecule. The present teachings deliberately turn away from the aptamer-based principle of utilizing intracellular transcription mechanisms to produce aptamers in the cell and, for the first time, provide means for the application of functional L-nucleic acids, and in particular spiegelmers, to cells. As used herein in a preferred embodiment, the term functional nucleic acids refers to those nucleic acids other than structural, especially naturally occurring, structural nucleic acids such as rRNAs or coding nucleic acids such as mRNAs. In particular, functional nucleic acids are nucleic acids which, due to their two- and / or three-dimensional structure, are capable of binding to target molecules. In a particularly preferred embodiment, binding to the target molecule is not by hybridization or base pairing based on Watson-Crick base pairings or Hoogsteen base pairing. Particularly preferred functional nucleic acids are aptamers and spiegelmers.
Eine L-Nukleinsäure ist in einer bevorzugten Ausführungsform eine Nukleinsäure, die vollständig, im wesentlichen oder teilweise aus L-Nukleotiden aufgebaut ist. Besonders bevorzugt ist, wenn die L-Nukleinsäure vollständig aus L-Nukleotiden besteht. Der Begriff „im wesentlichen" bezeichnet dabei eine Ausführungsforrn, bei der derjenige Teil der L-Nukleinsäure, der für die Wechselwirkung mit dem Zielmolekül verantwortlich ist bzw. derjenige Teil, der die Bindung an das Zielmolekül vermittelt, aus L-Nukleotiden besteht oder aus diesen aufgebaut ist.In a preferred embodiment, an L-nucleic acid is a nucleic acid which is completely, substantially or partially constructed of L-nucleotides. It is particularly preferred if the L-nucleic acid consists entirely of L-nucleotides. The term "essentially" designates an embodiment in which that part of the L-nucleic acid which is responsible for the interaction with the target molecule or the part which mediates the binding to the target molecule consists of L-nucleotides or these is constructed.
Wie hierin verwendet ist eine funktionale L-Nukleinsäure eine funktionale Nukleinsäure, die vollständig, im wesentlichen oder teilweise aus L-Nukleotiden aufgebaut ist.As used herein, a functional L-nucleic acid is a functional nucleic acid that is wholly, substantially or partially constructed of L-nucleotides.
Die Synthese von L-Nukleinsäuren ist den Fachleuten auf dem Gebiet bekannt und beispielsweise beschrieben in Nolte et al., Nat. Biotech, 14, 1116-1119, 1996.; und Klussmann et al, Nat. Biotechnol, 14, 1112-1115, 1996.The synthesis of L-nucleic acids is known to those skilled in the art and described, for example, in Nolte et al., Nat. Biotech, 14, 1116-1119, 1996; and Klussmann et al, Nat. Biotechnol, 14, 1112-1115, 1996.
Das grundsätzliche Verfahren zur Erzeugung von Aptameren ist beispielsweise beschrieben in Tuerck et al. Science, 248, 505-510, 1990; oder Ellington et al. Nature, 346, 818-822, 1990, das grundsätzliche Verfahren zur Erzeugung von Spiegelmeren ist beispielsweise beschrieben in Nolte et al., Nat. Biotech, 14, 1116-1119, 1996.; oder Klussmann et al., Nat. Biotechnol, 14, 1112-1115, 1996 Spielgelmere sind somit Aptamere, die aus L-Nukleotiden statt aus D- Nukleotiden bestehen. Im Zusammenhang mit der Erzeugung von Aptameren bzw. Spiegelmeren bezeichnet der Begriff Zielmolekül dasjenige Molekül, das im Selektionsprozess zur Erzeugung der Aptamere bzw. Spiegelmere verwendet wird bzw. dasjenige Molekül, das letztlich durch das Aptamer bzw. das Spiegeimer gebunden wird. In einer bevorzugten Ausführungsform ist ein intrazellulär aktives Agens eine chemische Verbindung, die in einer Zelle an ein Molekül zu binden in der Lage ist. Dabei ist besonders bevorzugt, wenn die Zelle eine Zelle ist, die isoliert in einem Gewebe oder einem Organ vorliegt, aber bevorzugtererweise nicht in einem menschlichen oder tierischen Körper. Ist das intrazellulär aktive Agens ein Spiegeimer, so ist es bevorzugterweise dann ein intrazellulär aktives Agens, wenn es in der Lage ist, an ein intrazelluläres Zielmolekül zu binden. Alternativ ist das Spiegeimer dann ein intrazellulär aktives Agens, wenn es in der Lage ist, an sein Zielmolekül unter Bedingungen zu binden, wie sie in einer Zelle vorliegen. Tests, um diese Eigenschaften zu bestimmen, sind den Fachleuten auf dem Gebiet bekannt und umfassen z.B. Gleichgewichtsanbindung- sassays unter Pufferbedingungen, wie sie intrazellulär vorliegen (Ionenstärke und Solutzusam- mensetzung, pH, Temperatur) wie in Beispiel 1 offenbart.The basic method for producing aptamers is described, for example, in Tuerck et al. Science, 248, 505-510, 1990; or Ellington et al. Nature, 346, 818-822, 1990, the basic method for generating Spiegelmeren is described for example in Nolte et al., Nat. Biotech, 14, 1116-1119, 1996; or Klussmann et al., Nat. Biotechnol, 14, 1112-1115, 1996 Complex gels are aptamers consisting of L nucleotides rather than D nucleotides. In the context of the production of aptamers or spiegelmers, the term target molecule refers to that molecule which is used in the selection process for producing the aptamers or spiegelmers or the molecule which is ultimately bound by the aptamer or the spiegelmer. In a preferred embodiment, an intracellularly active agent is a chemical compound capable of binding to a molecule in a cell. It is particularly preferred if the cell is a cell isolated in a tissue or organ, but more preferably not in a human or animal body. If the intracellularly active agent is a spiegelmer, then it is preferably an intracellularly active agent if it is capable of binding to an intracellular target molecule. Alternatively, the spiegelmer is an intracellularly active agent if it is capable of binding to its target molecule under conditions such as are present in a cell. Assays to determine these properties are known to those of skill in the art and include, for example, equilibrium binding assays under buffer conditions as they are intracellular (ionic strength and parent compound, pH, temperature) as disclosed in Example 1.
In einer bevorzugten Ausführungsform ist das Zielmolekül der L-Nukleinsäure, insbesondere der funktionalen L-Nukleinsäure ein intrazellulärer Rezeptor. Ein intrazellulärer Rezeptor, wie hierin verwendet, ist bevorzugterweise eine chemische Verbindung oder eine chemische Struktur oder jeweils ein Teil davon, mit der/dem die funktionale L-Nukleinsäure in Wechselwirkung tritt und bevorzugterweise eine solche, an die die funktionale L-Nukleinsäure bindet, wobei der intrazelluläre Rezeptor, d.h. die chemische Verbindung oder die chemische Struktur oder jeweils ein Teil davon, intrazellulär, d. h. in einer Zelle vorliegt, wie sie bevorzugt in dem vorstehenden Absatz beschrieben ist, vorliegt. Dabei ist es im Rahmen der vorliegenden Erfindung, dass der intrazelluläre Rezeptor das Zielmolekül bei der Erzeugung der funktionalen Nukleinsäure, insbesondere der funktionalen L-Nukleinsäure, ist.In a preferred embodiment, the target molecule of the L-nucleic acid, in particular of the functional L-nucleic acid, is an intracellular receptor. An intracellular receptor as used herein is preferably a chemical compound or a chemical structure, or a portion thereof, with which the functional L-nucleic acid interacts, and preferably one to which the functional L-nucleic acid binds the intracellular receptor, ie the chemical compound or the chemical structure or a part thereof, intracellular, d. H. is present in a cell, as it is preferably described in the preceding paragraph, is present. It is within the scope of the present invention that the intracellular receptor is the target molecule in the production of the functional nucleic acid, in particular of the functional L-nucleic acid.
In einer Ausführungsform bezeichnet der Begriff des Rezeptors einen jeglichen Wechselwirkungspartner, bevorzugterweise einen spezifisch bindenden Wechselwirkungspartner der funktionalen Nukleinsäure, d.h. einen mit der funktionalen Nukleinsäure interagierenden Wechselwir- kungspartner, der eine bestimmte räumliche Struktur, Ladungsverteilung, Hydrophobizitätsver- teilung etc. aufweisen. In einer besonders bevorzugten Ausführungsform entspricht der Wechselwirkungspartner dem Zielmolekül der funktionalen Nukleinsäure, wie es bei der Erzeugung der funktionalen Nukleinsäure verwendet wurde. Dabei ist es im Rahmen der vorliegenden Erfindung, dass ein Rezeptor auch von dem bei der Erzeugung der funktionalen Nukleinsäure verwendeten Zielmolekül verschieden sein kann, jedoch die spezifische Wechselwirkung durch eine Kreuzreaktivität der funktionalen Nukleinsäure zwischen dem Wechselwirkungspartner und dem bei der Erzeugung der funktionalen Nukleinsäure verwendeten Zielmolekül bedingt wird.In one embodiment, the term receptor refers to any interaction partner, preferably a specifically binding interaction partner of the functional nucleic acid, ie an interaction partner interacting with the functional nucleic acid, which have a specific spatial structure, charge distribution, hydrophobicity distribution, etc. In a particularly preferred embodiment, the interaction partner corresponds to the target molecule of the functional nucleic acid as used in the production of the functional nucleic acid. It is within the scope of the present invention that a receptor can also be different from the target molecule used in the production of the functional nucleic acid, but the specific interaction by a Cross-reactivity of the functional nucleic acid between the interaction partner and the target molecule used in the production of the functional nucleic acid is caused.
In einer bevorzugten Ausfuhrungsform bezeichnet der Begriff „intrazellulärer Rezeptor" einen Rezeptor, der in einer Zelle vorliegt, oder einen Rezeptor, der in einer Zelle vorliegen kann, unter natürlichen Umständen in einer Zelle vorkommt oder unter solchen in einer Zelle vorhanden ist. Dabei ist besonders bevorzugt, wenn die Zelle eine Zelle ist, die isoliert in einem Gewebe oder einem Organ vorliegt, aber bevorzugtererweise nicht in einem menschlichen oder tierischen Körper. Wie hierin verwendet bezeichnet das Begriff „intrazellulärer Rezeptor" aber auch einen Rezeptor, der unter Bedingungen vorliegt, wie sie in einer Zelle vorliegen.In a preferred embodiment, the term "intracellular receptor" refers to a receptor that is present in a cell, or a receptor that may be present in a cell, naturally occurring in a cell, or present among such in a cell Preferably, when the cell is a cell isolated in a tissue or organ, but more preferably not in a human or animal body, as used herein, the term "intracellular receptor" also refers to a receptor that is in conditions such as they are in a cell.
In einer bevorzugten Ausführungsform bezeichnet der Begriff der Zelle eine Zelle, die ausgewählt ist aus der Gruppe, die prokaryotische und eukaryotische Zellen umfasst. Bevorzugterweise ist die eukaryotische Zelle ausgewählt aus der Gruppe, die Pilzzellen, pflanzliche Zellen, tierische Zellen und menschliche Zellen umfasst. In einer alternativen Ausfuhrungsform bezeichnet der Begriff der Zelle hierin allgemein ein durch eine Phospholipiddoppelmembran, die in einer bevorzugten Ausfuhrungsform einer Cytoplasmamembran entspricht, begrenztes Kompartiment, das durch die Membran von der Umgebung abgetrennt ist. Die Abtrennung von der Umgebung ist dabei nicht eine vollständige Abtrennung, sondern erlaubt einen Energieaustausch und einen Stoffaustausch zwischen der Zelle und der Umgebung. Bevorzugterweise ist der Stoffaustausch beschränkt. Die Beschränkung des Stoffaustausches wird im Falle der Abgrenzung der Zelle gegenüber der Umgebung durch eine Cytoplasmamembran oder durch eine einer Cytoplasmamembran ähnlichen Membran durch die Transporteigenschaften der Membran definiert. In einer Ausfuhrungsform umfasst der Begriff der Zelle hierin somit auch Vesikel und/oder Komparti- mente von einer prokaryotischen oder eukaryotischen Zellen wie hierin definiert, die sowohl wiederum innerhalb einer prokaryotischen oder eukaryotischen Zelle als auch ausserhalb einer derartigen prokaryotischen oder eukaryotischen Zelle vorliegen oder vorliegen können, beispielsweise als Vesikel oder von einer Cytoplasmamembran umgebene Teile einer prokaryotischen oder eukaryotischen Zelle, die in einer Ausführungsform in einer Körperflüssigkeit vorliegen kann. In einer bevorzugten Ausführungsform ist in einer Zelle gemäß der zweiten alternativen Ausfuhrungsform vorgesehen, dass die Bedingungen innerhalb einer solchen Zelle im wesentlichen jenen entsprechen, wie sie in einer prokaryotischen oder eukaryotischen Zelle vorliegen, insbesondere hinischtlich der Faktoren, die die Bindung der funktionalen Nukleinsäure an ihr Zielmolekül beeinflussen. In einer Bevorzugten Ausführungsform ist die Körperflüssigkeit aus der Gruppe ausgewählt, die Blut, Urin, Liquor, Lymphflüssigkeit, Serum, Plasma, Vaginalsekret, Speichel und Sperma um- fasst.In a preferred embodiment, the term cell refers to a cell selected from the group comprising prokaryotic and eukaryotic cells. Preferably, the eukaryotic cell is selected from the group comprising fungal cells, plant cells, animal cells and human cells. In an alternative embodiment, the term cell herein generally refers to a compartment bounded by a phospholipid double membrane, which in a preferred embodiment corresponds to a cytoplasmic membrane, which is separated from the environment by the membrane. The separation from the environment is not a complete separation, but allows an energy exchange and a mass transfer between the cell and the environment. Preferably, the mass transfer is limited. The restriction of mass transfer is defined in the case of delimitation of the cell from the environment by a cytoplasmic membrane or by a membrane similar to a cytoplasmic membrane by the transport properties of the membrane. In one embodiment, the term "cell" herein thus also encompasses vesicles and / or compartments of a prokaryotic or eukaryotic cell as defined herein, which in turn may be present or present within a prokaryotic or eukaryotic cell as well as outside such a prokaryotic or eukaryotic cell For example, as a vesicle or parts of a prokaryotic or eukaryotic cell surrounded by a cytoplasmic membrane, which in one embodiment may be in a body fluid. In a preferred embodiment, it is provided in a cell according to the second alternative embodiment that the conditions within such a cell substantially correspond to those which are present in a prokaryotic or eukaryotic cell, in particular the factors which affect the binding of the functional nucleic acid to it Influence the target molecule. In a preferred embodiment, the body fluid is selected from the group consisting of blood, urine, cerebrospinal fluid, lymphatic fluid, serum, plasma, vaginal secretions, saliva and semen.
In einer Ausführungsform ist der Rezeptor über seine Funktion in einer Zelle definiert. Entsprechend kann der Rezeptor aus der Gruppe ausgewählt sein, die molekulare Rezeptoren, Enzyme, Stoffwechselintermediate, Signalpeptide, Chaperon-Moleküle und intrazelluläre Strukturen wie beispielsweise Ribosomen, Mitochondrien, Elemente des Zytoskeletts wie z.B. Tubulin- und Aktinfilamente, endosomale Partikel, Lysosomen, sonstige intrazelluläre Strukturen wie Vesikel, insbesondere intrazelluläre Vesikel umfasst. Wie hierin verwendet bezeichnet der Begriff des molekularen Rezeptors in einer bevorzugten Ausführungsform ein Molekül, welches Informationen) aufnimmt und innerhalb einer Zelle, einem Gewebe, einem Organ oder einem Organismus weiterleitet. Die Information wird typischerweise durch ein Molekül vermittelt, das mit dem molekularen Rezeptor in Wechselwirkung tritt. Infolge der Wechselwirkung ist der molekulare Rezeptor in der Lage, ein Signal zu erzeugen. Ein derartiges Signal kann in der Änderung der Konformation und/oder der Aktivität des Rezeptors begründet sein oder sich darin manifestieren. Das Signal selbst ist in der Lage, die aufgenommene oder von ihm dargestellte Information in einer anderen Form weiterzuleiten. Infolge der Änderung der Konformation bzw. der Aktivität des molekularen Rezeptors kann das Signal bevorzugterweise ein chemisches, biochemisches oder ein elektrisches Signal sein. Bevorzugterweise ist der molekulare Rezeptor Teil einer Reaktionskaskade, noch bevorzugtererweise einer Signalkaskade. Die von einem molekularen Rezeptor übertragene Information kann eine quantitative und/oder eine qualitative Information sein, beispielsweise betreffend die Anwesenheit einer Verbindung und/oder deren Konzentration.In one embodiment, the receptor is defined by its function in a cell. Accordingly, the receptor may be selected from the group consisting of molecular receptors, enzymes, metabolic intermediates, signal peptides, chaperone molecules, and intracellular structures such as ribosomes, mitochondria, cytoskeletal elements such as cytoskeletal cells. Tubulin and actin filaments, endosomal particles, lysosomes, other intracellular structures such as vesicles, in particular intracellular vesicles comprises. As used herein, in a preferred embodiment, the term molecular receptor refers to a molecule that receives and propagates information within a cell, tissue, organ, or organism. The information is typically mediated by a molecule that interacts with the molecular receptor. As a result of the interaction, the molecular receptor is able to produce a signal. Such a signal may be due to or manifest in the change in conformation and / or activity of the receptor. The signal itself is able to relay the recorded or represented information in a different form. Due to the change in the conformation or activity of the molecular receptor, the signal may preferably be a chemical, biochemical or electrical signal. Preferably, the molecular receptor is part of a reaction cascade, more preferably a signal cascade. The information transmitted by a molecular receptor may be quantitative and / or qualitative information, for example regarding the presence of a compound and / or its concentration.
In einer bevorzugten Ausführungsform bezeichnet der Begriff der Stoffwechselintermediate all jene Verbindungen, die durch metabolische Aktivitäten in einer Zelle als Bestandteile des Kata- bolismus ebenso wie des Anabolismus auftreten.In a preferred embodiment, the term metabolite intermediates refers to all those compounds which occur as a component of catabolism as well as anabolism through metabolic activities in a cell.
In einer weiteren Ausführungsform ist der Rezeptor über seine chemische Natur definiert. Bevorzugterweise ist der Rezeptor aus der Gruppe ausgewählt, die Polypeptide, Kohlenhydrate, Nukleinsäure, Lipide und Kombinationen davon umfasst. Wie hierin verwendet bezeichnet der Begriff Polypeptid bevorzugterweise ein jegliches Polymer aus zwei oder mehr Aminosäuren. Bevorzugterweise handelt es sich bei den Aminosäuren um L-Aminosäuren, wobei jedoch auch D-Aminosäuren im Rahmen der Ausführungsform verwendet werden können. Wie hierin verwendet bezeichnet der Begriff Nukleinsäuren bevorzugterweise ein Polymer aus zwei oder mehreren Nukleotiden oder Nukleotidanaloga, die den Fachleuten auf dem Gebiet bekannt sind, wobei es sich um entweder D-Nukleotide oder um L-Nukleotide oder Mischungen davon handelt. Bevorzugte Kombinationen umfassen glykosilierte Polypeptide und glykosilierte LipideIn another embodiment, the receptor is defined by its chemical nature. Preferably, the receptor is selected from the group comprising polypeptides, carbohydrates, nucleic acid, lipids, and combinations thereof. As used herein, the term polypeptide preferably refers to any polymer of two or more amino acids. Preferably, the amino acids are L-amino acids, but also D-amino acids can be used in the context of the embodiment. As used herein, the term nucleic acids preferably refers to a polymer of two or more nucleotides or nucleotide analogs known to those skilled in the art, which are either D nucleotides or L nucleotides or mixtures thereof. Preferred combinations include glycosylated polypeptides and glycosylated lipids
Eine besondere Gruppe von intrazellulären Rezeptoren sind Transkriptionsfaktoren und DNA- bindende Proteine, die an einen AT-Haken binden. Beispielhafte Transkriptionsfaktoren sind in der folgenden Tabelle 1 angebeben:A particular group of intracellular receptors are transcription factors and DNA-binding proteins that bind to an AT hook. Exemplary transcription factors are given in the following Table 1:
Tabelle 1 : TranskriptionsfaktorenTable 1: Transcription factors
gamma )OBP ALF AP-2alphaAgamma) OBP ALF AP-2alphaA
(STAT5A)4 ALL-1 AP-2alphaB(STAT5A) 4 ALL-1 AP-2alphaB
120-kDa CRE- alpha-CBF AP-2beta120 kDa CRE-alpha-CBF AP-2beta
Bindungsprotein alpha-CP2b AP-2gammaBinding protein alpha-CP2b AP-2gamma
14-3-3 epsilon alphaHO AP-2rep14-3-3 epsilon alphaHO AP-2rep
14-3-3 zeta alphaH2-alphaH3 AP-3 (1 )14-3-3 zeta alphaH2-alphaH3 AP-3 (1)
50-55K Protein ALX3 AP-3 (2)50-55K protein ALX3 AP-3 (2)
53BP1 Alx-4 AP-453BP1 Alx-4 AP-4
70-75K Protein aMEF-2 AP-570-75K protein aMEF-2 AP-5
80-90K Protein AML1 APC80-90K protein AML1 APC
AAF AMLIa ARAAF AMLIA AR
ABF-1 AMLI b AmtABF-1 AMLI b Office
AD A2 AMLIc Amt (774 AA Form)AD A2 AMLIc Office (774 AA Form)
ADA3 AMLI DeltaN ARNT2ADA3 AMLI DeltaN ARNT2
ADA-N F 1 AML2 ASC-2ADA-N F 1 AML2 ASC-2
AFP1 AML3 ASPP1AFP1 AML3 ASPP1
AhR AML3a ASPP2AhR AML3a ASPP2
AhR:Arnt AML3b ATBF 1 -AAhR: Arnt AML3b ATBF 1 -A
AIIN3 AMY-1L ATBF 1 -BAIIN3 AMY-1L ATBF 1 -B
Aiolos A-Myb ATFAiolos A-Myb ATF
AIRE ANF ATF-1AIRE ANF ATF-1
AKNA AP-1 ATF2 ATF-2 BRCA1 cdk2AKNA AP-1 ATF2 ATF-2 BRCA1 cdk2
ATF-2:c-Jun BRCA2 cdk9ATF-2: c-Jun BRCA2 cdk9
ATF3 BRG1 Cdx- 1ATF3 BRG1 Cdx-1
ATF3 deltaZIP BRIP1 CDX2ATF3 deltaZIP BRIP1 CDX2
ATF4 Brm Cdx-4ATF4 Brm Cdx-4
ATF5 BTEB 1 c-Ets- 1ATF5 BTEB 1 c-Ets-1
ATF6 BTEB2 c-Ets-2ATF6 BTEB2 c-Ets-2
ATF-a BTEB3 CFFATF-a BTEB3 CFF
ATF-adelta BTEB4 c-FosATF-adelta BTEB4 c-Fos
ATOH 1 B-TFIID ChChATOH 1 B-TFID CHCh
ATPF 1 C/EBPalpha CHOP-10ATPF 1C / EBPalpha CHOP-10
Bachi C/EBPbeta Chx10Bachi C / EBPbeta Chx10
BacMt C/EBPdelta CIITABacMt C / EBPdelta CIITA
Bach2 C/EBPepsilon c-J u nBach2 C / EBPepsilon c-J u n
B AF 155 C/EBPgamma c-Jun:JunDB AF 155 C / EBP gamma c-Jun: JunD
BAF47 CA150 CLIM1BAF47 CA150 CLIM1
BAF53a c-abl CLIM2BAF53a c-abl CLIM2
BAF60A CACCC-Bindungsfaktor CLOCKBAF60A CACCC binding factor CLOCK
BarhM CAR c-MybBarhM CAR c-Myb
Barhl2 CAR:RXR-alpha c-MycBarhl2 CAR: RXR-alpha c-Myc
Band Cart-1 C-Myc 1Tape Cart-1 C-Myc 1
Barx2 CBAF c-Myc:MaxBarx2 CBAF c-Myc: Max
Bcl-3 CBF (4) CNBPBcl-3 CBF (4) CNBP
BCL-6 CBF (5) CoS beta-catenin CBP COUP-TF1BCL-6 CBF (5) CoS beta-catenin CBP COUP-TF1
Bin1 CCAAT- COUP-TF2Bin1 CCAAT-COUP-TF2
BMAL2 Bindungsfaktor CP1ABMAL2 binding factor CP1A
B-Myb CCF CP1CB-Myb CCF CP1C
BNC CCG1 CP2BNC CCG1 CP2
BP1 CCK-Ia CPBPBP1 CCK-Ia CPBP
BP2 CCK-I b CPE BindungsproteinBP2 CCK-I b CPE binding protein
BR140 CD28RC CREBBR140 CD28RC CREB
Brachyury Cdc5 CRE-BPa c-Rel DBP DPBF c-Rel:RelA DbpA DRIL1Brachyury Cdc5 CRE-BPa c-Rel DBP DPBF c-Rel: RelA DbpA DRIL1
CREMalpha DbpAv DSIFCREMalpha DbpAv DSIF
CREST DbpB DSIF-p14CREST DbpB DSIF-p14
CRF DCoHm DSIF-p160CRF DCoHm DSIF-p160
Crx DDB DTFCrx DDB DTF
CSA DDB-1 DUX1CSA DDB-1 DUX1
CSB DDB-2 DUX2CSB DDB-2 DUX2
CSBP-1 DEC1 DUX3CSBP-1 DEC1 DUX3
CSEN DEC2 DUX4 c-S ki DEF ECSEN DEC2 DUX4 c-S ki DEF E
CtBPI deltaCREB E12CtBPI deltaCREB E12
CtBP2 deltaFosB E2FCtBP2 deltaFosB E2F
CTCF deltaMax E2F+E4CTCF deltaMax E2F + E4
CTF DeltaN p63beta E2F+p107CTF DeltaN p63beta E2F + p107
CTF-1 DeltaN p73alpha E2F-1CTF-1 DeltaN p73alpha E2F-1
CTF-2 DeltaN p73beta E2F-1 :DP-1CTF-2 DeltaN p73beta E2F-1: DP-1
CTF-3 DeltaN p73gamma E2F-1 :DP-2CTF-3 DeltaN p73gamma E2F-1: DP-2
CTF-5 DeltaNp63alpha E2F-2CTF-5 DeltaNp63alpha E2F-2
CTF-7 DeltaNp63gamma E2F-3aCTF-7 DeltaNp63gamma E2F-3a
CUP Dermo-1 E2F-4CUP Dermo-1 E2F-4
CUTL1 DF-1 E2F-4:DP-1CUTL1 DF-1 E2F-4: DP-1
CUTL2 DF-2 E2F-4:DP-2CUTL2 DF-2 E2F-4: DP-2
Cx DF-3 E2F-5 cyclin A Dlx-1 E2F-6 cyclin T1 Dlx-2 E2F-7 cyclin T2 Dlx-3 E47 cyclin T2a Dlx-4 (lange Isoform) E4BP4 cyclin T2b Dlx-4 (kurze Isoform) E4FCx DF-3 E2F-5 cyclin A Dlx-1 E2F-6 cyclin T1 Dlx-2 E2F-7 cyclin T2 Dlx-3 E47 cyclin T2a Dlx-4 (long isoform) E4BP4 cyclin T2b Dlx-4 (short isoform) E4F
DAP Dlx-5 E4F1DAP Dlx-5 E4F1
DAX1 Dlx-6 E4TF2DAX1 Dlx-6 E4TF2
DB 1 DP-1 E7; HPV-16, PapillomaDB 1 DP-1 E7; HPV-16, papilloma
DBF4 DP-2 Virus Typ 16 EAR2 ER-beta2 FAC 1DBF4 DP-2 virus type 16 EAR2 ER-beta2 FAC1
EBF ER-beta3 factor 2EBF ER-beta3 factor 2
EBP-80 ER-beta4 FBPEBP-80 ER-beta4 FBP
EC2 ER-beta5 f-EBPEC2 ER-beta5 f-EBP
EF1 ERF FEVEF1 ERF FEV
EgM Erg-1 Fgf3EgM Erg-1 Fgf3
Egr-2 Erg-2 FKBP59Egr-2 Erg-2 FKBP59
Egr-3 ERM FKHL18Egr-3 ERM FKHL18
Egr-4 ERR1 FKHRL1P2Egr-4 ERR1 FKHRL1P2
EIIaE-A ERR2 FKLFEIIaE-A ERR2 FKLF
EIIaE-B ERR3 FIMEIIaE-B ERR3 FIM
EllaE-Calpha ERR3-1 FosBEllaE-Calpha ERR3-1 FosB
EllaE-Cbeta ERR3-2 FOXB1EllaE-Cbeta ERR3-2 FOXB1
EivF ERR3-3 FOXC1EivF ERR3-3 FOXC1
EKLF ERRalphal FOXC2EKLF ERRalphal FOXC2
ELF-1 ESE-1 FOXD1ELF-1 ESE-1 FOXD1
ELFR ESE-Ia FOXD2 elios ESE-I b FOXD3ELFR ESE-Ia FOXD2 elios ESE-I b FOXD3
Elk-1 ESE-2 FOXD4Elk-1 ESE-2 FOXD4
Emx-1 ESE-2a FOXE1Emx-1 ESE-2a FOXE1
Emx-2 ESE-2b FOXE3Emx-2 ESE-2b FOXE3
En-1 ESE-3 FOXF1En-1 ESE-3 FOXF1
En-2 ESE-3a FOXF2En-2 ESE-3a FOXF2
ENH-Bindungsprotein ESE-3b FOXGIaENH binding protein ESE-3b FOXGIa
ENKTF-1 ESXR1 FOXGI bENKTF-1 ESXR1 FOXGI b
EP400 ETF FOXG 1cEP400 ETF FOXG 1c
EPAS1 Ets-1 deltaVIl FOXH 1EPAS1 Ets-1 deltaVIl FOXH 1
Epicardin EvM FOXH epsilonFI EVX1 FOXJIaEpicardium EvM FOXH epsilonFI EVX1 FOXJIa
ER-alpha EZF-2 FOXJIbER-alpha EZF-2 FOXJIb
ER-alpha:ER-beta EZH 1 FOXJ2 (lange Isoform)ER-alpha: ER-beta EZH 1 FOXJ2 (long isoform)
ER-beta EZH2 FOXJ2 (kurze Isoform)ER-beta EZH2 FOXJ2 (short isoform)
ER-beta1 F2F FOXJ3 F0XK1 GAAP-1 GRF-1ER-beta1 F2F FOXJ3 F0XK1 GAAP-1 GRF-1
F0XK2a GABP G scF0XK2a GABP G sc
F0XK2b GABP-alpha GsclF0XK2b GABP-alpha Gscl
F0XK2c GABPB GT-ICF0XK2c GABPB GT-IC
F0XL1 GABP-beta1 GT-IIAF0XL1 GABP-beta1 GT-IIA
F0XL2 GABP-beta2 GT-IIBalphaF0XL2 GABP-beta2 GT-II Balpha
FOXMIa GAF GT-IIBbetaFOXMIa GAF GT-IIBbeta
FOXMIb gammaCAAT H1TF1FOXMIb gammaCAAT H1TF1
FOXM 1c gammaCACI H1TF2FOXM 1c gammaCACI H1TF2
FOXN 1 gammaCAC2 H1TF2AFOXN 1 gammaCAC2 H1TF2A
FOXN2 GATA-1 H4TF-1FOXN2 GATA-1 H4TF-1
FOXN3 GATA-2 H4TF-2FOXN3 GATA-2 H4TF-2
FOXOIa GATA-3 HAFFOXOIa GATA-3 HAF
FOXOIb GATA-4 HAND1FOXOIb GATA-4 HAND1
FOXO2 GATA-5 HAND2FOXO2 GATA-5 HAND2
FOXO3a GATA-6 HB9FOXO3a GATA-6 HB9
FOXO3b Gbx1 HDAC1FOXO3b Gbx1 HDAC1
FOXO4 Gbx2 HDAC2FOXO4 Gbx2 HDAC2
FOXP1 GCF HDAC3FOXP1 GCF HDAC3
FOXP2 GCMa HDAC4FOXP2 GCMa HDAC4
FOXP3 GCN5 HDAC5FOXP3 GCN5 HDAC5
FOXP4 GCNF-1 hDaxxFOXP4 GCNF-1 hDaxx
Fra-1 GCNF-2 HDBP1Fra-1 GCNF-2 HDBP1
Fra-2 GF1 HDBP2Fra-2 GF1 HDBP2
FTF GKLF Hitze-induzierter FaktorFTF GKLF heat-induced factor
FTS - ~ "~ ^ GLM HEBFTS - ~ " ~ ^ GLM HEB
FXR GLI2 HEB1-p67FXR GLI2 HEB1-p67
FXR:RXR-alpha GLI3 HEB1-p94FXR: RXR-alpha GLI3 HEB1-p94
FXR-alpha GLIS2 HEF-1BFXR-alpha GLIS2 HEF-1B
FXR-beta1 GMEB-1 HEF-1TFXR-beta1 GMEB-1 HEF-1T
FXR-beta2 GR HEF-4CFXR-beta2 GR HEF-4C
G factor GR-alpha HEN1G factor GR-alpha HEN1
G6 factor GR-beta HEN2 HES-1 HNF-1alpha-A H0XA9BG6 factor GR-beta HEN2 HES-1 HNF-1alpha-A H0XA9B
HES-2 HNF-1alpha-B H0XB1HES-2 HNF-1alpha-B H0XB1
Hesxi HNF-1alpha-C H0XB13Hesxi HNF-1alpha-C H0XB13
Hex HNF-1beta-A H0XB2Hex HNF-1beta-A H0XB2
Hey1 HNF-1 beta-B H0XB3Hey1 HNF-1 beta-B H0XB3
Hey2 HNF-1 beta-C H0XB4Hey2 HNF-1 beta-C H0XB4
HeyL HNF-3 H0XB5HeyL HNF-3 H0XB5
HFH-1 HNF-3alpha H0XB6HFH-1 HNF-3alpha H0XB6
HIC-1 HNF-3beta H0XB7HIC-1 HNF-3beta H0XB7
Hic-5 HNF-3gamma H0XB8Hic-5 HNF-3gamma H0XB8
HIF-1 HNF-4 H0XB9HIF-1 HNF-4 H0XB9
HIF-1 alpha HNF-4alpha HOXC10HIF-1 alpha HNF-4alpha HOXC10
HiNF-A HNF-4alpha1 H0XC11HiNF-A HNF-4alpha1 H0XC11
HiNF-B HNF-4alpha2 H0XC12HiNF-B HNF-4alpha2 H0XC12
HiNF-C HNF-4alpha3 H0XC13HiNF-C HNF-4alpha3 H0XC13
HiNF-D HNF-4alpha4 H0XC4HiNF-D HNF-4alpha4 H0XC4
HiNF-D3 HNF-4alpha7 H0XC5HiNF-D3 HNF-4alpha7 H0XC5
HiNF-E HNF-4gamma H0XC6HiNF-E HNF-4gamma H0XC6
HiNF-P HNF-6alpha H0XC8HiNF-P HNF-6alpha H0XC8
HIP1 hnRNP K H0XC9HIP1 hnRNP K H0XC9
HIV-EP2 H0X11 HOXD10HIV-EP2 H0X11 HOXD10
HIf H0XA1 H0XD11HIf H0XA1 H0XD11
HLTF HOXA10 H0XD12HLTF HOXA10 H0XD12
HLTF (Met123) HOXA10 PL2 H0XD13HLTF (Met123) HOXA10 PL2 H0XD13
HLX H0XA11 H0XD3HLX H0XA11 H0XD3
HMBP H0XA13 H0XD4HMBP H0XA13 H0XD4
HMG I H0XA2 H0XD8HMG I H0XA2 H0XD8
HMG I(Y) H0XA3 H0XD9HMG I (Y) H0XA3 H0XD9
HMG Y H0XA4 Hp55HMG Y H0XA4 Hp55
HMGB1 HOXA5 Hp65HMGB1 HOXA5 Hp65
HMGB2 H0XA6 HPX42BHMGB2 H0XA6 HPX42B
HMGI-C H0XA7 HrpFHMGI-C H0XA7 HrpF
HMX1 HOXA9A HSBP1 HSF IL-6 RE-BP JunBHMX1 HOXA9A HSBP1 HSF IL-6 RE-BP JunB
HSF1 (lang) II-6 RF JunB:Fra-1HSF1 (long) II-6 RF JunB: Fra-1
HSF1 (kurz) ING1 JunB:Fra-2HSF1 (short) ING1 JunB: Fra-2
HSF2 INGI b JunDHSF2 INGI b JunD
HSF4a INSAF JunD:Fra-2HSF4a INSAF JunD: Fra-2
HSF4b IPCS-BF kappaY FaKtorHSF4b IPCS-BF kappaY FaKtor
HSF4c IPF1 KBP-1 hsp56 IPF1 :Pbx KER1HSF4c IPF1 KBP-1 hsp56 IPF1: Pbx KER1
Hsp90 IRF-1 KER-1Hsp90 IRF-1 KER-1
IA-1 IRF-1 :C/EBPbeta KLF 15 iASPP IRF-2 KLF7 iASPP-RAI IRF-3 Kox1IA-1 IRF-1: C / EBPbeta KLF15 iASPP IRF-2 KLF7 iASPP-RAI IRF-3 Kox1
IB1 IRF-4 KR3IB1 IRF-4 KR3
IBP-1 IRF-5 KRF-1IBP-1 IRF-5 KRF-1
ICER-II IRF-6 KRNICER-II IRF-6 KRN
ICER-Ilgamma IRF-7A KSR-1ICER-Ilgamma IRF-7A KSR-1
Id1 IRF-7B Ku AutoantigenId1 IRF-7B Ku autoantigen
IdI H IRF-7H Ku70IdI H IRF-7H Ku70
Id2 IRF-8 Ku80Id2 IRF-8 Ku80
Id3 IRF-9 KUPId3 IRF-9 KUP
Id3 / Heir-1 irIB LAF-4Id3 / Heir-1 irib LAF-4
IF1 IRX-1 LANA; KSHV, Kaposi'sIF1 IRX-1 LANA; KSHV, Kaposi's
IFI-16 IRX2a sarcoma-associated lgPE-1 lrx-3 herpesvirus ( herpesvi- lgPE-2 lrx-4 rus δ) lgPE-3 ISGF-1 LBP-1 lk-1 ISGF-3 LBP-IaIFI-16 IRX2a sarcoma-associated lgPE-1 lrx-3 herpesvirus (herpesvig-lgPE-2 lrx-4 rus δ) lgPE-3 ISGF-1 LBP-1 lk-1 ISGF-3 LBP-Ia
IkappaB ISGF-3alpha LBP-IdIkappaB ISGF-3alpha LBP-Id
IkappaB-alpha lsl-1 alpha LBP-32IkappaB-alpha lsl-1 alpha LBP-32
IkappaB-beta ITF LBP-9IkappaB-beta ITF LBP-9
IkappaBR ITF-1 LBX1IkappaBR ITF-1 LBX1
11-1 RF ITF-2 LCR-F 111-1 RF ITF-2 LCR-F 1
IL-10E1 JRF LEF-1 LEF-1B MafG:MafG Meis-2cIL-10E1 JRF LEF-1 LEF-1B MafG: MafG Meis-2c
LF-A1 MafK Meis-2dLF-A1 MafK Meis-2d
LHX1 MAML1 Meis-2eLHX1 MAML1 Meis-2e
LHX2 MASH-1 Meis-3LHX2 MASH-1 Meis-3
LHX3a Max Mel-18LHX3a Max Mel-18
LHX3b Maxi MeoxiLHX3b Maxi Meoxi
LHX5 Max2 MeoxiaLHX5 Max2 Meoxia
LHX6.1a MAZ Meox2LHX6.1a MAZ Meox2
LHX6.1b MAZi MHox (K-2)LHX6.1b MAZi MHox (K-2)
LIT-1 MAZR MIF-1LIT-1 MAZR MIF-1
LITAF MBF1 MITFLITAF MBF1 MITF
LKLF MBF2 MIXL1LKLF MBF2 MIXL1
Lmo1 MBF3 Miz-1Lmo1 MBF3 Miz-1
Lmo2 MBP-1 (1) MLXLmo2 MBP-1 (1) MLX
LM03 MBP-1 (2) MM-1LM03 MBP-1 (2) MM-1
LMX1A MBP-2 MondoALMX1A MBP-2 MondoA
LMX1 B MDBP MOP3LMX1 B MDBP MOP3
L-Myc-1 (lange Form) MECP-2 MRL-Myc-1 (long form) MECP-2 MR
L-Myc-1 (kurze Form) MEF-2A MRF-2L-Myc-1 (short form) MEF-2A MRF-2
L-Myc-2 MEF-2B1 Msx-1L-Myc-2 MEF-2B1 Msx-1
LUN-1 MEF-2C Msx-2LUN-1 MEF-2C Msx-2
LUN-2 MEF-2C/delta32 MTA1-L1LUN-2 MEF-2C / delta32 MTA1-L1
LXR-alpha MEF-2C/delta8 MTB-ZfLXR-alpha MEF-2C / delta8 MTB-Zf
LXR-alpha:RXR-alpha MEF-2C/delta8,32 MTF-1LXR-alpha: RXR-alpha MEF-2C / delta8.32 MTF-1
LXR-beta MEF-2D00 mtTFALXR-beta MEF-2D00 mtTFA
LXR-beta:RXR-alpha MEF-2D0B Mxi1LXR-beta: RXR-alpha MEF-2D0B Mxi1
Lyl-1 MEF-2DA0 Myf-3Lyl-1 MEF-2DA0 myf-3
M factor MEF-2DAO Myf-4M factor MEF-2DAO Myf-4
Mad1 MEF-2DAB Myf-5Mad1 MEF-2DAB Myf-5
Maf MEF-2DA'B Myf-6Maf MEF-2DA'B Myf-6
MafB Meis-1 Myocardin, Splice FormMafB Meis-1 Myocardin, Splice Form
MafF Meis-2a 1MafF Meis-2a 1
MafG Meis-2b MyoD MyoD:E12 NFbetaA NF-kappaE3MafG Meis-2b MyoD MyoD: E12 NFbetaA NF-kappaE3
MyT1 NF-CLEOa NF-MHCIIAMyT1 NF-CLEOa NF-MHCIIA
MZF-1 NF-CLEOb NF-MHCIIBMZF-1 NF-CLEOb NF-MHCIIB
NC1 NFdeltaE3A NF-muE1NC1 NFdeltaE3A NF-muE1
NC2 NFdeltaE3B NF-muE2NC2 NFdeltaE3B NF-muE2
NC0R1 NFdeltaE3C NF-muE3NC0R1 NFdeltaE3C NF-muE3
NC0R2 NFdeltaE4A NF-SNC0R2 NFdeltaE4A NF-S
NCX NFdeltaE4B NF-XNCX NFdeltaE4B NF-X
NELF NFdeltaE4C NF-X1NELF NFdeltaE4C NF-X1
NERF NFe NF-X2NERF NFe NF-X2
NERF-Ia NF-E NF-X3NERF-Ia NF-E NF-X3
NERF-Ib NF-E2 NF-XcNERF-Ib NF-E2 NF-Xc
NERF-2 NF-E2 p45 NF-YNERF-2 NF-E2 p45 NF-Y
Net NF-E3 NF-YANet NF-E3 NF-YA
NeuroDI NFE-6 NF-ZcNeuroDI NFE-6 NF-Zc
NEUROD-2 NF-GMa NF-ZzNEUROD-2 NF-GMa NF-Zz
NEUROD-3 NF-GMb NGN3NEUROD-3 NF-GMb NGN3
NF Ill-a NFI/CTF NHP-1NF Ill-a NFI / CTF NHP-1
NF Ill-c NFIA NHP-2NF Ill-c NFIA NHP-2
NF Ill-e NFIB NHP3NF Ill-e NFIB NHP3
NF-1 NF-IL-2A NHP4NF-1 NF-IL-2A NHP4
NF-4FA NF-IL-2B Nkx2-1NF-4FA NF-IL-2B Nkx2-1
NF-4FB NFIX Nkx2-2NF-4FB NFIX Nkx2-2
NF-4FC NF-jun Nkx2-3NF-4FC NF-jun Nkx2-3
NF-AB NF-kappaB Nkx2-5NF-AB NF-kappaB Nkx2-5
NF-AT1 NF-kappaB(-ähnlich) Nkx2-8NF-AT1 NF-kappaB (-like) Nkx2-8
NF-AT1 NF-kappaB1 Nkx3-1NF-AT1 NF-kappaB1 Nkx3-1
NF-AT2 NF-kappaB1 Vorläufer Nkx3-1 viNF-AT2 NF-kappaB1 Precursor Nkx3-1 vi
NF-AT2-alpha NF-kappaB2 Nkx3-1 v2NF-AT2-alpha NF-kappaB2 Nkx3-1 v2
NF-AT2-beta NF-kappaB2 (p49) Nkx3-1 v3NF-AT2-beta NF-kappaB2 (p49) Nkx3-1 v3
NF-AT3 NF-kappaB2 Vorläufer Nkx3-1 v4NF-AT3 NF-kappaB2 precursor Nkx3-1 v4
NF-AT4 NF-kappaE1 Nkx3-2NF-AT4 NF-kappaE1 Nkx3-2
NF-AT5 NF-kappaE2 Nkx6-1 Nkx6-2 OCA-B p65deltaNF-AT5 NF-kappaE2 Nkx6-1 Nkx6-2 OCA-B p65delta
Nmi Octa-factόr p73Nmi Octa-factόr p73
N-Myc Octamer- p73alphaN-myc octamer p73alpha
N-Oct-2alpha Bindungsfaktor p73betaN-Oct-2alpha binding factor p73beta
N-Oct-2beta Oct-B1 p73deltaN-Oct-2beta Oct-B1 p73delta
N-Oct-4 oct-B2 p73epsilonN-Oct-4 oct-B2 p73epsilone
N0R1 oct-B3 p73etaN0R1 oct-B3 p73eta
N0R1/MIN0R OLIG2 p73gammaN0R1 / MIN0R OLIG2 p73gamma
NPA3 Oligol p73kappaNPA3 oligol p73kappa
NPAS 1 Otx1 p73zetaNPAS 1 Otx1 p73zeta
NPAS2 Otx2 Pax-1NPAS2 Otx2 Pax-1
NP-TCII Otx3 Pax-2NP-TCII Otx3 Pax-2
NRF OZF Pax-3NRF OZF Pax-3
Nrf1 p107 Pax-3ANrf1 p107 Pax-3A
NRF-1 p130 Pax-3BNRF-1 p130 Pax-3B
Nrf1 :MafG p160MBP Pax-4aNrf1: MafG p160MBP Pax-4a
Nrf1 :MafK p28 Modulator Pax-5Nrf1: MafK p28 Modulator Pax-5
Nrf2 p300 Pax-6Nrf2 p300 Pax-6
Nrf2:MafG p38erg Pax-6 / Pd-5aNrf2: MafG p38erg Pax-6 / Pd-5a
Nrf2:MafK p40x; HTLV-I, T-ZeII Pax-7Nrf2: MafK p40x; HTLV-I, T-cell Pax-7
NRF-2beta1 Lymphotropischer Virus Pax-8NRF-2beta1 Lymphotropic virus Pax-8
NRF-2gamma1 Typ I Pax-8aNRF-2gamma1 type I Pax-8a
Nrf3 p45 Pax-8bNrf3 p45 Pax-8b
Nrf3:MafK p49erg Pax-8cNrf3: MafK p49erg Pax-8c
NRL p50:c-Rel Pax-8dNRL p50: c-Rel Pax-8d
NRSF p53 Pax-8eNRSF p53 Pax-8e
NRSF Form 1 p55 Pax-8fNRSF Form 1 p55 Pax 8f
NRSF Form 2 p55erg Pax-9NRSF Form 2 p55erg Pax-9
NTF p63 PbxNTF p63 Pbx
Nur77 p63alpha Pbx1Only 77 p63alpha Pbx1
NURR1 p63beta Pbx1:HoxB1NURR1 p63beta Pbx1: HoxB1
OAZ p63delta Pbx1:HoxB2OAZ p63delta Pbx1: HoxB2
OC-2 p63gamma Pbx1 :HoxB3 Pbx1 :HoxB4 PEA3 POU2F3, Isoform d1OC-2 p63gamma Pbx1: HoxB3 Pbx1: HoxB4 PEA3 POU2F3, isoform d1
Pbx1 :HoxB5 PEBP2alpha POU2F3, Isoform d2Pbx1: HoxB5 PEBP2alpha POU2F3, isoform d2
Pbx1 :HoxB6 PEBP2beta POU3F1Pbx1: HoxB6 PEBP2beta POU3F1
Pbx1 :HoxB8 PGC-1 POU3F2Pbx1: HoxB8 PGC-1 POU3F2
Pbx1 :PKN0X1 PITX1 POU3F2 (N-Oct-5a)Pbx1: PKN0X1 PITX1 POU3F2 (N-Oct-5a)
Pbx1 :Tcl3 PITX2 POU3F2 (N-Oct-5b)Pbx1: Tcl3 PITX2 POU3F2 (N-Oct-5b)
Pbxia PITX2A POU3F3Pbxia PITX2A POU3F3
Pbx1A:HoxA5 PITX2A: Nkx2.5 POU3F4Pbx1A: HoxA5 PITX2A: Nkx2.5 POU3F4
Pbx1 a:Hoxb7 PITX2B POU4F1(I)Pbx1 a: Hoxb7 PITX2B POU4F1 (I)
Pbx1a:Hoxb8 PITX2B:Nkx2.5 POU4F1(s)Pbx1a: Hoxb8 PITX2B: Nkx2.5 POU4F1 (s)
Pbx1 a:Hoxc6 PITX2C POU4F2Pbx1 a: Hoxc6 PITX2C POU4F2
Pbx1A:HoxC8 PITX2C:Nkx2.5 POU4F3Pbx1A: HoxC8 PITX2C: Nkx2.5 POU4F3
Pbx1A:HoxD4 PITX3 POU5F1Pbx1A: HoxD4 PITX3 POU5F1
Pbx1 a:IPF1 PKN0X1 POU5F1APbx1 a: IPF1 PKN0X1 POU5F1A
Pbxi b PKN0X2 POU5F1BPbxi b PKN0X2 POU5F1B
Pbx1 B:HoxA5 PLAGL1 POU5F1CPbx1 B: HoxA5 PLAGL1 POU5F1C
Pbx1 B:HoxB7 PLAGL2 POU6F1Pbx1 B: HoxB7 PLAGL2 POU6F1
Pbx1B:HoxB8 PLZF PPAR-alphaPbx1B: HoxB8 PLZF PPAR-alpha
Pbx1 B:HoxC8 PML PPAR-alpha:RXR-Pbx1B: HoxC8 PML PPAR-alpha: RXR-
Pbx1 B:HoxD4 PML-3 alphaPbx1 B: HoxD4 PML-3 alpha
Pbx1 b:PKN0X1 Pmx2a PPAR-betaPbx1b: PKN0X1 Pmx2a PPAR-beta
Pbx2 Pmx2b PPAR-gamma1Pbx2 Pmx2b PPAR-gamma1
Pbx2:HoxB8 PNR PPAR-gamma2Pbx2: HoxB8 PNR PPAR-gamma2
Pbx2:Hoxc6 PO-B PPAR-gamma3Pbx2: Hoxc6 PO-B PPAR-gamma3
Pbx2:PKN0X1 Pontin52 PPAR-gamma4Pbx2: PKN0X1 Pontin52 PPAR-gamma4
Pbx3a POU1F1 PPURPbx3a POU1F1 PPUR
Pbx3a:Hoxc6 POU2F1 PRPbx3a: Hoxc6 POU2F1 PR
Pbx3b POU2F2 PR APbx3b POU2F2 PR A
PC2 POU2F2 (Oct-2.1) PR BPC2 POU2F2 (Oct-2.1) PR B
PC4 POU2F2B pRbPC4 POU2F2B pRb
PC5 POU2F2C PRDI-BF1PC5 POU2F2C PRDI-BF1
PCAF POU2F3 PRDI-BFcPCAF POU2F3 PRDI-BFc
PDEF POU2F3, Isoform a Preb Prop-1 RAR-gamma RREB-1PDEF POU2F3, isoform a preb Prop-1 RAR-gamma RREB-1
PR0X1 RAR-gamma:RXR- RSRFC4PR0X1 RAR-gamma: RXR-RSRFC4
PSE1 alpha RSRFC9PSE1 alpha RSRFC9
P-TEFb RAR-gamma1 RVFP-TEFb RAR-gamma1 RVF
PTF Rb:E2F-1 :DP-1 RXPTF Rb: E2F-1: DP-1 RX
PTFalpha RBP60 RXR-alphaPTFalpha RBP60 RXR-alpha
PTFbeta RBP-Jkappa RXR-betaPTFbeta RBP-Jkappa RXR-beta
PTFdelta Ref-1 RXR-gammaPTFdelta Ref-1 RXR-gamma
PTFgamma ReIA SAP-IaPTFgamma ReIA SAP-Ia
Pu box Bindungsfaktor ReIB SAP-IbPu box binding factor ReIB SAP-Ib
Pu box Bindungsfaktor REVERB-alpha SF-1Pu box binding factor REVERB-alpha SF-1
(BJA-B) REVERB-beta SHOX2a(BJA-B) REVERB-beta SHOX2a
PU.1 RFX1 SHOX2bPU.1 RFX1 SHOX2b
PuF RFX1:RFX2 SHOXaPuF RFX1: RFX2 SHOXa
Pur factor RFX1.RFX3 SHOXb pX; HBV, Hepatitis B RFX2 SHPPur factor RFX1.RFX3 SHOXb pX; HBV, hepatitis B RFX2 SHP
Virus RFX3 SIII-P110Virus RFX3 SIII-P110
PXR-1 RFX4 Slll-p15PXR-1 RFX4 SIII-p15
PXR-1 :RXR-alpha RFX5 Slll-p18PXR-1: RXR-alpha RFX5 SIII-p18
PXR-1 :RXR-beta RFX5: RFXAP: RFXANK SIM1PXR-1: RXR-beta RFX5: RFXAP: RFXANK SIM1
PXR-2 RFXANK SIM2PXR-2 RFXANK SIM2
R1 RFXAP SIP1R1 RFXAP SIP1
R2 RFX-B-delta5 Six-1R2 RFX-B-delta5 Six-1
RAR-alpha RF-Y Six-2RAR-alpha RF-Y Six-2
RAR-alpha:RXR-alpha RORalphal Six-3RAR-alpha: RXR-alpha RORalphal Six-3
RAR-alpha: RXR-beta RORalpha2 Six-4RAR-alpha: RXR-beta RORalpha2 Six-4
RAR-alpha:RXR- RORalpha3 Six-5 gamma RORbeta Six-6RAR-alpha: RXR-RORalpha3 Six-5 gamma RORbeta Six-6
RAR-alpha1 RORgamma SKIPRAR-alpha1 RORgamma SKIP
RAR-alpha2 Rox SLUGRAR-alpha2 Rox SLUG
RAR-beta RP58 SmadiRAR-beta RP58 Smadi
RAR-beta:RXR-alpha RPF1 Smad2RAR-beta: RXR-alpha RPF1 Smad2
RAR-beta2 RPGalpha Smad2 (437 AmiSox8 STAT6 nosäuren) Sox9 SXRRAR-beta2 RPGalpha Smad2 (437 AmiSox8 STAT6 acids) Sox9 SXR
Smad3 Sp1 SXR:RXR-alphaSmad3 Sp1 SXR: RXR-alpha
Smad3:Smad4 Sp2 SYTSmad3: Smad4 Sp2 SYT
Smad4 Sp3 T3R-alphaSmad4 Sp3 T3R alpha
Smad4delta3 Sp4 T3R-alpha:RXR-alphaSmad4delta3 Sp4 T3R-alpha: RXR-alpha
Smad4delta4 Spi-B T3R-alpha1Smad4delta4 Spi-B T3R-alpha1
Smad4delta4-6 SPT16 T3R-alpha2Smad4delta4-6 SPT16 T3R-alpha2
Smad4delta4-7 SRC-1 T3R-beta1Smad4delta4-7 SRC-1 T3R-beta1
Smad4delta5-6 SRC-3 T3R-beta2Smad4delta5-6 SRC-3 T3R-beta2
Smad4delta6 SRCAP TAF(I)HOSmad4delta6 SRCAP TAF (I) HO
Smad5 SREBP-Ia TAF(I)48Smad5 SREBP-Ia TAF (I) 48
Smad6 SREBP-Ib TAF(I )63Smad6 SREBP-Ib TAF (I) 63
Smad7 SREBP-Ic TAF(II)IOOSmad7 SREBP-Ic TAF (II) IOO
Smadδ SREBP-2 TAF(II)125Smadδ SREBP-2 TAF (II) 125
SMIF SRE-ZBP TAF(II)135SMIF SRE-ZBP TAF (II) 135
Sna SRF TAF(11)170Sna SRF TAF (11) 170
SnoN SRF:SRF TAF(11)18SnoN SRF: SRF TAF (11) 18
Sox1 SRY TAF(I I )20Sox1 SRY TAF (I) 20
Sox10 SSRP1 TAF(ll)250Sox10 SSRP1 TAF (II) 250
Sox11 Staf-50 TAF(ll)250DeltaSox11 Staf-50 TAF (ll) 250Delta
Sox12 STAT1 TAF(II)28Sox12 STAT1 TAF (II) 28
Sox13 STAT1 :STAT1 TAF(I I )30Sox13 STAT1: STAT1 TAF (I I) 30
Sox14 STAT1 :STAT3 TAF(II)31Sox14 STAT1: STAT3 TAF (II) 31
Sox17 STAT1 alpha TAF(II)55Sox17 STAT1 alpha TAF (II) 55
Sox18 STATI beta TAF(ll)70-alphaSox18 STATI beta TAF (II) 70-alpha
Sox2 STAT2 TAF(ll)70-betaSox2 STAT2 TAF (II) 70-beta
Sox20 STAT3 TAF(ll)70-gammaSox20 STAT3 TAF (ll) 70 gamma
Sox21 STAT3:STAT3 TAF-ISox21 STAT3: STAT3 TAF-I
Sox3 STAT4 TAF-IISox3 STAT4 TAF-II
Sox4 STAT5A TAF-LSox4 STAT5A TAF-L
Sox5 STAT5B TaMSox5 STAT5B TaM
Sox7 STAT5B:STAT5B TaMbeta Tal-2 TCF-1D TFIIDSox7 STAT5B: STAT5B TaMbeta Tal-2 TCF-1D TFIID
TAR factor TCF-1 E TFIIE tat; HIV-1 , Immunode- TCF-1F TFIIE-alpha fizienz Virus Typ 1 TCF-1G TFIIE-betaTAR factor TCF-1 E TFIIE did; HIV-1, immunode- TCF-1F TFIIE-alpha efficiency virus type 1 TCF-1G TFIIE-beta
Tax; HTLV-I, T-ZeII TCF-2alpha TFIIFTax; HTLV-I, T-cell TCF-2alpha TFIIF
Lymphotropisches ViTCF-3 TFIIF-alpha rus Typ I TCF-4 TFIIF-betaLymphotropic ViTCF-3 TFIIF-alpha rus type I TCF-4 TFIIF-beta
T-bet TCF-4(K) TFIIHT-bet TCF-4 (K) TFIIH
TBP TCF-4B TFIIH*TBP TCF-4B TFIIH *
Tbr-1 TCF-4E TFIIH-CAKTbr-1 TCF-4E TFIIH-CAK
TBR2 TEF TFIIH-cyclin HTBR2 TEF TFIIH-cyclin H
TBX18 TEF-1 TFIIH-MAT1TBX18 TEF-1 TFIIH-MAT1
TBX19 TEF-2 TFIIH-MO15TBX19 TEF-2 TFIIH-MO15
TBX1A TEF-3 TFIIH-p34TBX1A TEF-3 TFIIH-p34
TBX1B TEF-5 TFIIH-p44TBX1B TEF-5 TFIIH-p44
TBX2 TEL1 TFIIH-p62TBX2 TEL1 TFIIH-p62
TBX20 Tel-2a TFIIH-pβOTBX20 Tel-2a TFIIH-pβO
Tbx22 Tel-2b TFIIH-p80:CAKTbx22 Tel-2b TFIIH-p80: CAK
TBX3 (722 AmiTel-2c TFIIH-p90 nosäuren) Tel-2d TFII-ITBX3 (722 AmiTel-2c TFIIH-p90 acids) Tel-2d TFII-I
TBX3 (742 AmiTel-2e TFIIIA nosäuren) Tel-2f Tf-LFITBX3 (742 AmiTel-2e TFIIIA acids) Tel-2f Tf-LFI
TBX4 TFE3 Tf-LF2TBX4 TFE3 Tf-LF2
TBX5 (lange Isoform) TFEB TFP-95TBX5 (long isoform) TFEB TFP-95
TBX5 (kurze Isoform) TFEB-A TGIFTBX5 (short isoform) TFEB-A TGIF
Tbx5:Nkx2.5 TFEC TGIF2Tbx5: Nkx2.5 TFEC TGIF2
TBX6 TFIIA TGT3TBX6 TFIIA TGT3
TCF TFI I A-alpha/beta VorTIEG-1TCF TFI I A-alpha / beta VorTIEG-1
TCF-1 läufer (Hauptform) TIFIaTCF-1 rotor (main form) TIFIa
TCF17 TFIIA-alpha/beta VorTIFIgTCF17 TFIIA-alpha / beta PRE-TIFI
TCF-1A läufer (Nebenform) Tl F2TCF-1A rotor (secondary) Tl F2
TCF-1B TFIIA-gamma TLE 1TCF-1B TFIIA-gamma TLE 1
TCF-1C TFIIB TLX TLX3 Vav ZER6 p52TCF-1C TFIIB TLX TLX3 Vav ZER6 p52
TMF Vax-2 ZER6 p71TMF Vax-2 ZER6 p71
TR2-11 VDR ZF1TR2-11 VDR ZF1
TR2-5 VITF; Vacciniavirus/, ZF2TR2-5 VITF; Vaccinia virus /, ZF2
TR2-9 Homo sapiens ZFP-37TR2-9 Homo sapiens ZFP-37
TR4 Vpr; HIV-1 , Immunode- ZFXTR4 Vpr; HIV-1, Immunode-ZFX
TRAP fizienz Virus Typ 1 ZFYTRAP efficiency virus type 1 ZFY
TREB-1 WBSCR14 ZHX1TREB-1 WBSCR14 ZHX1
TREB-2 WSTF ZIC2TREB-2 WSTF ZIC2
TREB-3 WT1 ZIDTREB-3 WT1 ZID
TREF1 WT1 I ZNF11aTREF1 WT1 I ZNF11a
TREF2 WT1 I -KTS ZNF124TREF2 WT1 I -KTS ZNF124
TRF (2) WT1 l-del2 ZNF133TRF (2) WT1 l-del2 ZNF133
TRRAP WT1 -KTS ZNF143TRRAP WT1 -KTS ZNF143
TWIST WT1-del2 ZNF174TWIST WT1-del2 ZNF174
TxRE BP XBP-1 ZNF-20TxRE BP XBP-1 ZNF-20
TxREF XW,V ZNF-24TxREF XW, V ZNF-24
UBF YAF2 ZNF33aUBF YAF2 ZNF33a
UBP-1 YB-1 ZNF35UBP-1 YB-1 ZNF35
UEF-1 YEBP ZNF43UEF-1 YEBP ZNF43
UEF-2 YL-1 ZNF44UEF-2 YL-1 ZNF44
UEF-3 YY1 ZNF45UEF-3 YY1 ZNF45
UEF-4 ZAC ZN F7UEF-4 ZAC ZN F7
USF1 ZBP89 ZNF76USF1 ZBP89 ZNF76
USF1 :USF2 ZBP99 ZNF83USF1: USF2 ZBP99 ZNF83
USF2 ZEB (1124 AA) ZNF85USF2 ZEB (1124 AA) ZNF85
USF2b ZEB (1154 AA)USF2b ZEB (1154 AA)
Eine weitere Gruppe von intrazellulären Rezeptoren sind die in der nachfolgenden Tabelle 2 dargestellten intrazellulären Zielmoleküle. Tabelle 2: Intrazelluläre ZielmoleküleAnother group of intracellular receptors are the intracellular target molecules shown in Table 2 below. Table 2: Intracellular target molecules
"long-chain"-Fettsäuren- Acetyl-CoA-Malat-Citrat- Amyloid- Vorläuferprotein"long chain" fatty acid acetyl CoA malate citrate amyloid precursor protein
CoA-Ligase Synthase AnkarinCoA ligase synthase ankarin
"major basic"-Protein Acetylglucosaminyl- Arginase"major basic" protein acetylglucosaminyl-arginase
"mixed function"- Transferase Argininosuccinate-"mixed function" - transferase argininosuccinate
Oxygenase Acetylspermin- SynthetaseOxygenase acetylspermine synthetase
11/3-Hydroxylase (EC Deacetylase Argininosuccinat-Lyase11/3 hydroxylase (EC deacetylase argininosuccinate lyase
1.14.15.4) Acetyltransacylase Aromatase1.14.15.4) acetyltransacylase aromatase
18-Hydroxylase Aconitase Arylsulfatase l-Acylglycerol-3- Actin Aspartat- phosphate Acyltransferase Adenosin-Deaminase Aminotransferase18-hydroxylase aconitase arylsulfatase l-acylglycerol-3-actin aspartate phosphate acyltransferase adenosine deaminase aminotransferase
2,3- Adenosylhomocysteine- Aspartat-2,3-adenosyl homocysteine aspartate
Oxidosqualenlanosterol- Hydrolase TranscarbamoylaseOxidosqualenlanosterol hydrolase transcarbamoylase
Cyclase Adenosylmethionine- ATPaseCyclase adenosylmethionine ATPase
21 -Steroid-Hydroxylase Decarboxylase ATP-Diphosphohydrolase21 -deroid hydroxylase decarboxylase ATP-diphosphohydrolase
(EC 1.14.99.10) Adenylatcyclase bcl-2 Onkogen-Protein(EC 1.14.99.10) Adenylate cyclase bcl-2 oncogene protein
24,28-Sterolreduktase Adenylatdeaminase Bindegewebeaktivieren¬24,28-Sterol Reductase Adenylate Deaminase Connective Tissue Activation
3-Hydroxybutyrat- Adenylatkinase des Peptid3-hydroxybutyrate adenylate kinase of the peptide
Dehydrogenase Adenylsuccinate-Lyase C5a-inaktivierender Fac-Dehydrogenase adenyl succinate lyase C5a inactivating facies
3-Ketothiolase Adenylsuccinate-Synthase tor3-ketothiolase adenyl succinate synthase tor
3 -ß-Hydroxy-steroid- Alanin- Aminotransferase Calcitonin3-β-hydroxy-steroid-alanine aminotransferase calcitonin
Dehydrogenase Aldolase CalmodulinDehydrogenase aldolase calmodulin
(EC5.3.3.1) Aldose-Reductase Calpain I(EC5.3.3.1) aldose reductase calpain I
5'-Nucleotidase Alkalische Phosphatase Calreticulin5'-Nucleotidase Alkaline Phosphatase Calreticulin
8-Oxoguanosin- Alkohol-Dehydrogenase Carbamoylphosphat-8-oxoguanosine alcohol dehydrogenase carbamoyl phosphate
Deglykosylase Amidophosphoribosyla- Synthetase abl Onkogen-Protein min-Transferase Carbonat- AnhydraseDeglycosylase amidophosphoribosylase synthetase abl oncogene protein min-transferase carbonate anhydrase
Acetolactat-Synthase AMP- Caseinkinase 1Acetolactate Synthase AMP Casein Kinase 1
Acetylcholinesterase Phosphodiestererase Caseinkinase 2Acetylcholinesterase phosphodiesterase casein kinase 2
Acetyl-CoA-Carboxylase Amyloid ß I A4-Protein Catalase Catechol- Dihydrouracil- Glycerinphosphat-Acetyl-CoA-carboxylase amyloid β I A4-protein catalase Catechol dihydrouracil glycerol phosphate
Methyltransferase Dehydrogenase AcyltransferaseMethyltransferase dehydrogenase acyltransferase
Cathepsin Dioxygenase Glycerinphosphat-Cathepsin Dioxygenase Glycerol Phosphate
Cathepsin B and L Dopaminmonooxygenase Dehydrogenase cdc 10 Dynenin Glycinamide- cdc 13 p60 Elastase Ribonucleotidtransformyl cdc 2 p34 Elastin ase cdc 25 p80 Elongation factor Tu GTP bindendes ProteinCathepsin B and L Dopamine monooxygenase Dehydrogenase cdc 10 Dynenin Glycinamide cdc 13 p60 Elastase Ribonucleotide transformyl cdc 2 p34 Elastinase cdc 25 p80 Elongation factor Tu GTP binding protein
Chaparonin Endo-Rhamosidase Hämoglobin AChaparonin Endo-Rhamosidase Hemoglobin A
Cholesterin-Esterase Enolase Hämoglobin AlCholesterol Esterase Enolase Hemoglobin Al
Cholesterin- Enoyl-ACP-Hydratase Hämoglobin BarcelonaCholesterol Enoyl-ACP Hydratase Hemoglobin Barcelona
Monooxygenase Enoyl-ACP-Reductase Hämoglobin BartsMonooxygenase enoyl-ACP reductase hemoglobin Barts
Citratsynthetase ets Onkogen-Protein Hämoglobin Beth IsrealCitrate synthetase ets oncogene protein hemoglobin Beth Isreal
Clathrin Ferritin Hämoglobin BunburyClathrin Ferritin Hemoglobin Bunbury
Collagenase Ferrodoxin Hämoglobin Cochin-PortCollagenase ferrodoxin hemoglobin cochin port
Cortison-Dehydrogenase Fettsäuresynthetase Royal crk Onkogen-Protein fgr Onkogen-Protein Hämoglobin CowtownCortisone Dehydrogenase Fatty Acid Synthetase Royal crk oncogene protein fgr oncogene protein hemoglobin Cowtown
Cyclin A and B fps Onkogen-Protein Hämoglobin CranstonCyclin A and B fps oncogene protein hemoglobin Cranston
Cyclophilin Fructosebisphosphat- Hämoglobin CreteilCyclophilin fructose bisphosphate hemoglobin Creteil
Cytidin-Deaminase Aldolase Hämoglobin DCytidine Deaminase Aldolase Hemoglobin D
Cytidylate-Deaminase Fumarase Hämoglobin D-Los Ange¬Cytidylate Deaminase Fumarase Hemoglobin D-Lot Ange¬
Cytochrom C-Peroxidase GABA-Aminotransferase lesCytochrome C peroxidase GABA aminotransferase les
Cytochrom P450 Galactosidase Hämoglobin D-PunjabCytochrome P450 galactosidase hemoglobin D-punjab
Cytosin- Gelatinase Hämoglobin FCytosine gelatinase hemoglobin F
Methyltransferase Gelsolin Hämoglobin Gower dbl Onkogen-Protein Glucophosphat-Isomerase Hämoglobin Hammers¬Methyltransferase Gelsolin Hemoglobin Gower dbl Oncogene protein Glucophosphate isomerase Hemoglobin Hammers¬
Defensin Glucosylceramid- mithDefensin glucosylceramide mith
Diacylglycerol- Galactosyltransferase Hämoglobin HiroshimaDiacylglycerol Galactosyltransferase Hemoglobin Hiroshima
Acyltransferase Glutaminase Hämoglobin IndianapolisAcyltransferase Glutaminase Hemoglobin Indianapolis
Dihydrofolate-Reductase Glutamin- Hämoglobin KansasDihydrofolate reductase glutamine hemoglobin Kansas
Dihydroorotatase Phosphoribosylpyrophosp Hämoglobin KariyaDihydroorotatase Phosphoribosylpyrophosph Hemoglobin Kariya
Dihydroorotat- hat-Amidotransferase Hämoglobin KempseyDihydroorotate-has amidotransferase hemoglobin Kempsey
Dehydrogenase Hämoglobin Kenya Hämoglobin Lepore Hydroxymethylglutaryl- Myeloperoxidase Hämoglobin M CoA-Reductase Myofilament Hämoglobin M Hyde Hydroxymethylglutaryl- Myristoyltransferase Park CoA-Sythetase Na / K ATPaseDehydrogenase hemoglobin Kenya Hemoglobin Lepore Hydroxymethylglutaryl Myeloperoxidase Hemoglobin M CoA Reductase Myofilament Hemoglobin M Hyde Hydroxymethylglutaryl myristoyltransferase Park CoA-Sytestase Na / K ATPase
Hämoglobin M Iwate Hydroxysteroid- N-Acetylglucuronidase Hämoglobin M Saskatoon Dehydrogenase NAD-abhängige Sterol-4- Hämoglobin Nancy Hypoxanthine-Guanine- carboxylase Hämoglobin Philly Phosphoribosyltransferase NADase Hämoglobin Quong Sze IMP-Dehydrogenase NADPH-abhängige 3- Hämoglobin Raleigh Indollyase Oxosteroidreductase Hämoglobin Ranier Inositolphosphat- Nexin Hämoglobin S Phosphatase N-ras Onkogen-Protein Hämoglobin Sealy int-1 Onkogen-Protein Nukleolusprotein B23 Hämoglobin Seattle Isocitratlyase Nukleosiddiphosphat- Hämoglobin St. Louis Kininbildendes Enzym Kinase Hämoglobin St. Mande Ki-ras Onkogen-Protein Ornithin- Hämoglobin Titusville Lactat-Dehydro genäse Aminotransferase Hämoglobin Torino Lactoferrin Ornithin- Hämoglobin Wayne Laminin Carbamoyltransferase Hämoglobin York Leukozyten-Elastase Ornithin-Decarboxylase Hämoglobin Zürich Lipocortin Orotate-Decarboxylase Ha-ras Onkogen-Protein Lipoxygenase Orotat- Hexokinase L-myc Onkogen-Protein Phosphoribosyltransferase Histaminase Lysozym p53 Histidin-Decarboxylase Malat-Dehydrogenase Peptidylamidoglycolate- HSP 27 Malat-Synthase LyaseHemoglobin M Iwate Hydroxysteroid N-Acetylglucuronidase Hemoglobin M Saskatoon Dehydrogenase NAD-dependent Sterol-4 Hemoglobin Nancy Hypoxanthine Guanine Carboxylase Hemoglobin Philly Phosphoribosyltransferase NADase Hemoglobin Quong Sze IMP Dehydrogenase NADPH-dependent 3-Hemoglobin Raleigh Indollyase Oxosteroid Reductase Hemoglobin Ranier Inositol Phosphate Nexin Hemoglobin S Phosphatase N-ras Oncogene protein Hemoglobin Sealy int-1 Oncogene protein Nuclear protein B23 Hemoglobin Seattle isocitrate lyase Nucleoside diphosphate hemoglobin St. Louis Kin-forming enzyme Kinase Hemoglobin St. Mande Ki-ras Oncogene protein Ornithine hemoglobin Titusville Lactate-dehydrogenated aminotransferase Hemoglobin Torino Lactoferrin Ornithine Hemoglobin Wayne Laminin Carbamoyltransferase Hemoglobin York Leukocyte Elastase Ornithine Decarboxylase Hemoglobin Zurich Lipocortin Orotate Decarboxylase Ha-ras Oncogene Protein Lipoxygenase Orotate Hexokinase L-myc Oncogene Protein Phosphorib osyltransferase histaminase lysozyme p53 histidine decarboxylase malate dehydrogenase peptidylamidoglycolate HSP 27 malate synthase lyase
Hydropyrimidine- Malonyltransacylase Peptidyl-Prolyl-Isomerase Hydrolase Mannosidase PF4 Hydroxyacyl-CoA- met Onkogen-Protein Phenylalanine- Dehydrogenase Methämoglobin Hydroxylase Hydroxymethylglutaryl- Methionin- Phosphatidat-Phosphatase CoA Spaltendes Enzyme Adenosyltransferase Phosphoenolpyruvate- mos Onkogen-Protein Carboxykinase Phosphofructokinase rel Onkogen-Protein tRNA-Synthetase Phosphoglucokinase Ribonucleotid-Reduktase Tropomyosin Phosphoglucomutase Ribosephosphate- Tryptophan-Synthase Phosphoglycerate-Kinase Pyrophosphat-Kinase Tubulin Phosphoglyceromutase Ricintropoelastin Tyrosinkinase Phospholipase A2 Saure Phosphatase Ubioquinon-Reduktase Phospholipase C Saure Protease UPA Phospholipase CGI Schweres Meromyosin Uridinmonophosphat- Phospholipase D Serine / Threonin-Kinase Kinase Phospholipase S Spectrin Vitamin K-Reduktase Phosphoribomutase Spermine-Synthase wee-\ Genproduct Phosphoribosylphosphat- Squalene-Epoxidase Xanthindehydrogenase Transferase Squalen-Monooxygenase Xanthinoxidase pim Onkogen-Protein src Onkogen-Protein Xylosyltransferase Plasminogenaktivator- Sterolmethyltransferase yes Onkogen-Protein Inhibitor SMC 1 pl3 α-Actin Porin Succinyl-CoA-Synthetase α-Mannosidase pRB (Retinoblastomgen- Superoxid-Dismutase α-Melogenin Produkt) Tartrat-Dehydrogenase α-Tubulin pRb Retinablastom- Thioesterase i8-Actin Genprodukt Thioredoxin /3-Glucuronidase Properdin Thrombospondin /3-GlycerophosphataseHydropyrimidine Malonyl Transacylase Peptidyl Prolyl Isomerase Hydrolase Mannosidase PF4 Hydroxyacyl CoAmet Oncogene Protein Phenylalanine Dehydrogenase Methaemoglobin Hydroxylase Hydroxymethylglutaryl Methionine Phosphatidate Phosphatase CoA Cleaving Enzyme Adenosyltransferase Phosphoenolpyruvate- mos Oncogene Protein Carboxykinase Phosphofructokinase rel Oncogene Protein tRNA Synthetase Phosphoglucokinase Ribonucleotide Reductase Tropomyosin Phosphoglucomutase Ribose Phosphate Tryptophan Synthase Phosphoglycerate Kinase Pyrophosphate Kinase Tubulin Phosphoglyceromutase Ricintropoelastin Tyrosine Kinase Phospholipase A2 Acid Phosphatase Ubioquinone Reductase Phospholipase C Acid Protease UPA Phospholipase CGI Heavy Meromyosin Uridine Monophosphate Phospholipase D Serine / Threonine kinase kinase phospholipase S spectrin vitamin K reductase phosphoribomutase spermine synthase wee \ gene product phosphoribosylphosphate squalene epoxidase xanthine dehydrogenase transferase squalene monooxygenase xanthine oxidase pim oncogene protein src oncogene protein xylosyltransferase plasminogen activator sterol methyltransferase yes oncogene protein inhibitor SMC 1 pl3 α-actin porin succinyl-CoA synthetase α-mannosidase pRB (retinoblastoma superoxide dismutase α-melogenin product) tartrate dehydrogenase α-tubulin pRb retinablastoma thio Esterase i8-actin gene product Thioredoxin / 3-glucuronidase Properdin Thrombospondin / 3-glycerophosphatase
Prostaglandin-Synthase Thromboxane-A2- /3-Ketoacyl-ACP- Proteinkinase C Synthetase Reduktase Purinnucleosid- Thymidylat-synthetase /3-Ketoacyl-ACP- Phosphorylase Transacylase Synthetase PyruvateDehydrogenase Triosephophat-Isomerase /?-Spectrin Pyruvate-Kinase Triosephosphate- j8-Tropomyosin raf Onkogen-Protein Dehyrogenase j3-TubulinProstaglandin synthase thromboxane A2- / 3-ketoacyl-ACP protein kinase C synthetase reductase purine nucleoside thymidylate synthetase / 3-ketoacyl-ACP phosphorylase transacylase synthetase pyruvate dehydrogenase triosephophate isomerase / - spectrin pyruvate kinase triose phosphate-j8-tropomyosin raf Oncogene protein dehydrogenase j3-tubulin
Eine weitere besonders bevorzugte Gruppe von intrazellulären Rezeptoren sind die HMG- Proteine wie beispielsweise in der internationalen Patentanmeldung PCT/EP96/00716 be- schrieben und insbesondere die HMGA-Proteine. Wie hierin verwendet bezeichnet der Begriff der HMGA-Proteine bevorzugterweise summarisch die folgenden Proteine: HMGAl, HMGAIa, HMGAIb und HMGA2.Another particularly preferred group of intracellular receptors are the HMG proteins, as described, for example, in international patent application PCT / EP96 / 00716. wrote and in particular the HMGA proteins. As used herein, the term HMGA proteins preferably denotes, in summary, the following proteins: HMGA1, HMGA1a, HMGA1b, and HMGA2.
Die HMGA-Proteine sind modular aufgebaut und besitzen je drei DNA-bindende Domänen, die als „AT-hooks" oder als „AT-Haken" bezeichnet werden und als DBDl bis DBD3 in Fig. 2 dargestellt sind, sowie einen sehr sauren C-terminalen Bereich. Es ist für den Fachmann offenkundig, dass Antagonisten, die an einen der „AT-hooks" binden, nicht nur die HMGAl- Proteine und dabei die beiden Splice-Varianten HMGAIa und HMGAIb erkennen (siehe Fig. 2), sondern auch Kreuzreaktivität mit ähnlichen DNA-bindenden Molekülen wie HMGA2 aufweisen. Außer HMGA2 besitzen noch viele weitere Proteine den „AT-hooks" ähnliche Sequenzen und stellen in jedem Falle weitere Rezeptoren dar. Solche Proteine sind unter anderen die in Tabelle 3 angegebenen:The HMGA proteins are modular and each have three DNA-binding domains, called "AT-hooks" or "AT-hooks", represented as DBD1 to DBD3 in Figure 2, and a very acidic C- terminal area. It is obvious to those skilled in the art that antagonists that bind to one of the "AT-hooks" not only recognize the HMGA1 proteins and thereby the two splice variants HMGAIa and HMGAIb (see FIG. 2), but also cross-reactivity with similar ones In addition to HMGA2, many other proteins have sequences similar to "AT-hooks" and are in any case other receptors. Such proteins include those listed in Table 3:
Tabelle 3:Table 3:
Spalte l: Proteindatenbank-Zugriffscodes; Spalte 2: ProteinbezeichnungColumn 1: protein database access codes; Column 2: protein name
Q9UKB0 Humanes HMG-Protein-RQ9UKB0 Human HMG protein R
Q9UKY1 ZHXl_Humanes Zinkfinger- und Homöobox-Protein 1Q9UKY1 ZHXl_Human Zinc Finger and Homeobox Protein 1
P55198 AF17_HUMAN AF- 17 Protein [MLLT6]P55198 AF17_HUMAN AF- 17 protein [MLLT6]
Q59F28 Humanes Trithorax Homologon (Fragment)Q59F28 Human Trithorax homologue (fragment)
Q6PJQ2 Humanes ZNF406 Protein (Fragment)Q6PJQ2 human ZNF406 protein (fragment)
Q75PJ9 Humanes ZFAT-I ProteinQ75PJ9 Human ZFAT-I protein
Q75PJ7 Humanes ZFAT-3 ProteinQ75PJ7 Human ZFAT-3 protein
Q75PJ6 Humanes TR-ZFAT ProteinQ75PJ6 Human TR-ZFAT protein
Q9ULG1 Humanes KIAA1259 ProteinQ9ULG1 Human KIAA1259 protein
Q9NUK2 Humanes Hypothetisches Protein FLJ11314Q9NUK2 Human Hypothetical Protein FLJ11314
Q9NTG6 Humanes Hypothetisches Protein DKFZp434B0616Q9NTG6 Human Hypothetical Protein DKFZp434B0616
Q8IX01 SFR14_HUMAN Mutmaßlicher SpleißfaktorQ8IX01 SFR14_HUMAN Suspected splice factor
Q9HSJ8 Humanes Hypothetisches Protein FLJ23363 Humanes MGC5306 Protein Spleiß- Isoform 2 von Q8IX01 Spleiß- Isoform 3 von Q8IX01 Spleiß-Isoform 4 von Q8IX01 RBBP5_HUMAN Retinoblastom-bindendes Protein 5 (RBBP-5) MECP2_HUMAN Methyl-CpG-bindendes Protein 2Q9HSJ8 Human Hypothetical Protein FLJ23363 Human MGC5306 Protein Splice Isoform 2 from Q8IX01 Splice Isoform 3 from Q8IX01 Splice Isoform 4 from Q8IX01 RBBP5_HUMAN Retinoblastoma Binding Protein 5 (RBBP-5) MECP2_HUMAN Methyl CpG Binding Protein 2
Humanes FLJ12800 ProteinHuman FLJ12800 protein
Humanes Methyl-CpG-bindendes Protein 2, Isoform BHuman methyl CpG binding protein 2, isoform B
Humanes Hypothetisches Protein FLJ13629Human Hypothetical Protein FLJ13629
Humanes Hypothetisches Protein DKFZp686A24l60 ENK7_HUMAN HERV-K_lq23.3 Provirus ENK16_HUMAN HERV-K_10pl4 Provirus Humanes MYB bindendes Protein Ia [MYBBPlA] Humanes Hüllprotein RIC-2 Humanes REPINl Protein (Hypothetisches Protein ZNF464) Humanes KIAA1205 Protein Humanes Dhfr Oribeta-bindendes Protein RIP60 Humaner Linensepithel -enthaltener Wachstumsfaktor p52 Humane regulatorische Untereinheit 2 der Proteinphosphatase-4 Humanes HMGA2/RAD51L1 FusionsproteinHuman hypothetical protein DKFZp686A24l60 ENK7_HUMAN HERV-K_lq23.3 Provirus ENK16_HUMAN HERV-K_10pl4 Provirus Human MYB Binding Protein Ia [MYBBPlA] Human Coat Protein RIC-2 Human REPINl Protein (Hypothetical Protein ZNF464) Human KIAA1205 Protein Human Dhfr Oribeta Binding Protein RIP60 Human Linen Epithelium - contained growth factor p52 Human protein phosphatase-4 regulatory subunit 2 Human HMGA2 / RAD51L1 fusion protein
095368 Humaner Transkriptioneller Koaktivator p52 Q9P015 Humanes HSPC145 (Mitochondriales Ribosomenprotein L15)095368 Human Transcriptional Coactivator p52 Q9P015 Human HSPC145 (Mitochondrial Ribosome Protein L15)
Q5U071 Humanes HMG Protein "box 2'Q5U071 Human HMG Protein 'box 2'
Q9H0Y1 Humanes Hypothetisches Protein DKFZp564I206Q9H0Y1 Human hypothetical protein DKFZp564I206
Q6ZP45 Humanes Hypothetisches Protein FLJ26517Q6ZP45 Human Hypothetical Protein FLJ26517
P17096-2 Spleiß-Isoform HMG-Y von P17096 [HMGAl]P17096-2 splice isoform HMG-Y of P17096 [HMGAl]
Q9Y6X0 SETBP_HUMAN SET-bindendes Protein (SEB) [SETBPl]Q9Y6X0 SETBP_HUMAN SET Binding Protein (SEB) [SETBPl]
Q8TEK3 DOT1L_HUMAN Histon-Lysine N-MethyltransferaseQ8TEK3 DOT1L_HUMAN histone lysine N-methyltransferase
Q8TEK3-2 Spleiß-Isoform 1 von Q8TEK3 [DOTlL]Q8TEK3-2 splice isoform 1 of Q8TEK3 [DOTlL]
Q03164 HRX_HUMAN Zinkfinger-Protein HRX (ALL-I)Q03164 HRX_HUMAN zinc finger protein HRX (ALL-I)
Q86YP1 Humaner Transkriptionsfaktor MLL UPN96240Q86YP1 Human transcription factor MLL UPN96240
Q86YN9 Humaner Transkriptionsfaktor MLL UPN95022Q86YN9 Human transcription factor MLL UPN95022
Q03164-2 Spleiß-Isoform 14P-18B von Q03164 [MLL]Q03164-2 splice isoform 14P-18B of Q03164 [MLL]
P04920 B3A2_HUMAN Anionenaustauscher-Protein 2P04920 B3A2_HUMAN anion exchanger protein 2
Q59GF1 Humane Anionenaustauscher-2 Typ a-VarianteQ59GF1 Human anion exchanger-2 type a variant
Q8TAG3 Humanes SLC4A2 ProteinQ8TAG3 Human SLC4A2 protein
Q6P391 Humanes PSIPl ProteinQ6P391 Human PSIP1 protein
075475 Humaner Linensepithel-enthaltener Wachstumsfaktor p75075475 Human Linen Epithelial-Contained Growth Factor p75
Q9UEY6 Humaner Anionenaustauscher-2 Typ a [SLC4A2]Q9UEY6 Human anion exchanger-2 type a [SLC4A2]
Q9UEY5 Humaner Anionenaustauscher-2 Typ b2 [SLC4A2]Q9UEY5 Human Anion Exchanger-2 Type b2 [SLC4A2]
Q9UEY4 Humaner Anionenaustauscher-2 Typ bl [SLC4A2]Q9UEY4 Human anion exchanger-2 type bl [SLC4A2]
Q9UER6 Humaner Transkriptioneller Koaktivator p75Q9UER6 Human Transcriptional Coactivator p75
000256 Humanes DFS70000256 Human DFS70
P04920-2 Spleiß-Isoform Bl von P04920 [SLC4A2]P04920-2 splice isoform Bl of P04920 [SLC4A2]
Q9BTB1 Humanes Hypothetisches Protein MGC10561Q9BTB1 Human Hypothetical Protein MGC10561
Q9UKB0 Humanes HMG Protein-RQ9UKB0 Human HMG Protein-R
043167 ZBT24_HUMAN Zinkfinger- und BTB-Domänen enthaltendes Protein043167 ZBT24_HUMAN protein containing zinc finger and BTB domains
Q8N455 Humanes ZBTB24 Protein [ZBTB24]Q8N455 Human ZBTB24 Protein [ZBTB24]
Q5TED5 Humanes Zinkfinger-Protein 450 [ZNF450]Q5TED5 Human Zinc Finger Protein 450 [ZNF450]
Q96CK0 Humanes Zinkfinger-Protein 653Q96CK0 Human Zinc Finger Protein 653
Q96AS7 Humanes Zinkfinger-Protein 653Q96AS7 Human zinc finger protein 653
P51888 PRELP_HUMAN Prolargin-VorläuferP51888 PRELP_HUMAN Prolargin Precursor
Q5JPC9 Humanes Hypothetisches Protein DKFZp667H216Q5JPC9 Human hypothetical protein DKFZp667H216
Q6FHG6 Humanes PRELP-PoteinQ6FHG6 Human PRELP Potein
Q6ZR44 Humanes Hypothetisches Protein FLJ46672Q6ZR44 Human Hypothetical Protein FLJ46672
Q8NEZ4 MLL3_HUMAN Myeloid/lymphoid-Leukämieprotein 3 HomologonQ8NEZ4 MLL3_HUMAN myeloid / lymphoid leukemia protein 3 homolog
Q96AC6 KIFC2_HUMAN Kinesin-ähnliches Protein KIFC2Q96AC6 KIFC2_HUMAN Kinesin-like protein KIFC2
Q9C0H5 K1688_HUMAN Protein KIAA1688Q9C0H5 K1688_HUMAN protein KIAA1688
P52926 HMGIC_HUMAN HMG Protein I -CP52926 HMGIC_HUMAN HMG Protein I -C
Q9UKV3 ACINU_HUMAN Induktor apoptotischer ChromatinkondensationQ9UKV3 ACINU_HUMAN Inductor of apoptotic chromatin condensation
Q59F82 Humane C21orf2 -ProteinvarianteQ59F82 Human C21orf2 protein variant
Q5VYT7 Humanes OTTHUMP00000021181Q5VYT7 Human OTTHUMP00000021181
Q96M56 Humanes Hypothetisches Protein FLJ32810Q96M56 Human Hypothetical Protein FLJ32810
Q69YJ6 Humanes Hypothetisches Protein DKFZp667N107Q69YJ6 Human hypothetical protein DKFZp667N107
Q8NEY3 SPAT4_HUMAN Spermatogenes-Assoziiertes Protein 4Q8NEY3 SPAT4_HUMAN spermatogenes-associated protein 4
Q12809 KCNH2_HUMAN Kalium Potential-gesteuerte Ionenkanal-SubfamilieQ12809 KCNH2_HUMAN Potassium Potential-driven ion channel subfamily
Q8IYY4 Humanes dem DAZ-interagierenden Protein 1-ähnliches Protein [DZIPlL]Q8IYY4 Human DAZ-interacting protein 1-like protein [DZIPLL]
Q6ZN04 Humanes Hypothetisches Protein FLJ16544Q6ZN04 Human Hypothetical Protein FLJ16544
Q5SXN7 Humanes Serologisch definiertes Kolonkrebs-Antigen 3Q5SXN7 Human Serologic Defined Colon Cancer Antigen 3
Q8IVG2 Humanes KIAA2009 Protein (Fragment) [RKHD3]Q8IVG2 Human KIAA2009 Protein (Fragment) [RKHD3]
Q75VX8 Humanes KIAA2038 Protein (Fragment) [KIAA2038]Q75VX8 Human KIAA2038 Protein (Fragment) [KIAA2038]
Q12809-2 Spleiß-Isoform 2 von Q12809 [KCNH2]Q12809-2 Splice Isoform 2 of Q12809 [KCNH2]
Vor diesem Hintergrund betrifft die vorliegende Erfindung auch L-Nukleinsäuren und insbesondere Spiegelmere, die gegen ein jegliches der in den Tabellen 1 bis 3 genannten Zielmoleküle gerichtet sind.Against this background, the present invention also relates to L-nucleic acids and in particular Spiegelmers which are directed against any of the target molecules mentioned in Tables 1 to 3.
Indem die L-Nukleinsäure als intrazellulär aktives Agens insbesondere innerhalb einer Zelle verwendet wird, um dort an einen intrazellulären Rezeptor zu binden, können intrazellulär verschiedene Formen der Wechselwirkungen zwischen dem intrazellulären Rezeptor und seinen Wechselwirkungspartnern beeinflusst werden. In Abhängigkeit von der Art der Wechselwirkungspartner des intrazellulären Rezeptors erlaubt somit die intrazelluäre Verwendung von L-Nukleinsäuren die Beeinflussung von Wechselwirkungen von Proteinen, Nukleinsäuren, Lipiden, Kohlenhydraten, oder Kombinationen von Proteinen, Nukleinsäuren, Lipiden, Kohlenhydraten miteinander und untereinander.By using the L-nucleic acid as an intracellularly active agent, particularly within a cell, to bind to an intracellular receptor, intracellularly various forms of interactions between the intracellular receptor and its interaction partners are influenced. Depending on the nature of the interaction partners of the intracellular receptor, the intracellular use of L-nucleic acids thus makes it possible to influence interactions of proteins, nucleic acids, lipids, carbohydrates or combinations of proteins, nucleic acids, lipids, carbohydrates with one another and with one another.
Im Zusammenhang mit der erfindungsgemäßen Verwendung einer L-Nukleinsäure, insbesondere eines Spiegeimers, als intrazelluläres Agens bzw. dem Verfahren zum Binden eines intrazellulärem Rezeptors ist beachtlich, dass es sich dabei bevorzugterweise im eine in vitro Anwendung bzw. ein in vitro Verfahren handelt.In connection with the inventive use of an L-nucleic acid, in particular a Spiegeimers, as an intracellular agent or the method for binding an intracellular receptor is noteworthy that it is preferably an in vitro application or an in vitro method.
Im Zusammenhang mit der erfindungsgemäßem Verwendung einer L-Nukleinsäure, insbesondere eines Spiegeimers, zur Herstellung eines Medikamentes für die Behandlung und/oder Prävention einer Erkrankung und/oder zur Herstellung eines Mittels zur Diagnose ist das Zielmolekül ein intrazelluläres Zielmolekül. In diesem Zusammenhang ist das intrazelluläre Zielmolekül ein solches, das an der zu verhindernden, zu therapierenden oder zu diagnostizierenden Erkrankung oder Krankheit kausal oder nicht-kausal beteiligt ist, in einem jeden Fall aber dessen Bindung an eine daran spezifisch bindende L-Nukleinsäure dazu führt, dass im Falle eines Medikamentes die Erkrankung gelindert, verhindert, oder geheilt wird und/oder im Falle eines diagnostischen Mittels die Erkrankung oder eine Disposition festgestellt oder diagnostiziert werden kann. Wie hierin verwendet umfasst der Begriff der Diagnose eine Erstdiagnose ebenso wie nachfolgende Diagnosen, insbesondere Diagnosen oder Untersuchungen, um, bspw., den Verlauf der Erkrankung oder die Stadien der Erkrankung zu verfolgen oder zu bestimmen. Es ist im Rahmen der Erfindung, dass das Ziehnolekül ein intrazellulärer Rezeptor wie hierin beschrieben ist, insbesondere ein Transkriptionsfaktor, ein intrazelluläres Zielmolekül oder ein HMG-Protein. Es ist im Rahmen der vorliegenden Erfindung ganz besonders bevorzugt, dass das Zielmolekül intrazellulär vorliegt, d.h. innerhalb einer Zelle und die auf die Erkrankung und/oder Diagnostik Einfluss nehmende Wechselwirkung zwischen der L- Nukleinsäure und insbesondere dem Spiegeimer und dem Zielmolekül, d. h. dem Rezeptor, intrazellulär erfolgt. Es ist jedoch auch im Rahmen der vorliegenden Erfindung, wenn das Zielmolekül außerhalb einer Zelle vorliegt und die Wechselwirkung zwischen der L- Nukleinsäure und insbesondere dem Spiegeimer und dem Zielmolekül, d. h. dem Rezeptor, extrazellulär erfolgt.In connection with the inventive use of an L-nucleic acid, in particular a Spiegeimers, for the preparation of a medicament for the treatment and / or prevention of a disease and / or for the production of an agent for diagnosis, the target molecule is an intracellular target molecule. In this context, the intracellular target molecule is one which is causally or non-causally involved in the disease or disease to be prevented, treated or diagnosed, but in each case results in its binding to an L-nucleic acid specifically binding thereto; that in the case of a drug, the disease is alleviated, prevented, or cured and / or in the case of a diagnostic agent, the disease or a disposition can be detected or diagnosed. As used herein, the term diagnosis includes a first diagnosis as well as subsequent diagnoses, particularly diagnoses or examinations, to, for example, track or determine the course of the disease or the stages of the disease. It is within the scope of the invention that the target molecule is an intracellular receptor as described herein, in particular a transcription factor, an intracellular target molecule or an HMG protein. It is very particularly preferred in the context of the present invention that the target molecule is present intracellularly, ie within a cell and the interaction influencing the disease and / or diagnosis between the L-nucleic acid and in particular the spiegelmer and the target molecule, ie the receptor, intracellularly. However, it is also within the scope of the present invention, when the target molecule is outside of a cell and the interaction between the L- Nucleic acid and especially the Spiegeimer and the target molecule, ie the receptor, extracellular takes place.
Die indikationsmäßige Anwendung des unter Verwendung einer L-Nukleinsäure hergestellten Medikamentes, wobei die Nukleinsäure gegen ein intrazelluläres Zielmolekül gerichtet ist, ergibt sich für den Fachmann aus der Beteiligung des intrazellulären Zielmoleküls an dem der jeweiligen Indikation zugrundeliegenden Pathogenitätsmechanismus. So ist bspw. für HMGA-Proteine bekannt, dass diese mit Karzinomen (u.a. von Brust, Lunge, Haut, Schilddrüse) sowie Leukämien und Lymphomen sowie anderen malignen Tumoren wie u.a. Sarkomen (Rhabdomyosarkom, Osteosarkom) assoziiert sind. Ausserdem werden sie in vielerlei mesenchymalen Tumoren, u.a. Hamartome (Brust und Lunge), Fettgewebstumoren (Lipome), pleomorphen Adenomen der Kopfspeicheldrüsen, Uterus-Leiomyomen, Angiomyxomen, Fibroadenomen der Brust, Polypen des Endometriums und atherosklerotischen Plaques exprimiert. HMGA ist ein interessantes therapeutisches Target. Blockade von HMGA könnte ein geeigneter Ansatzpunkt zur Kontrolle des Krebses sein und seine metastatische Verbreitung verhindern. Wie detaillierter hierin beschrieben sind gegen HMGA-Proteine gerichtete L-Nukleinsäuren auch für die Diagnose und/oder Therapie von Virus erkrankungen und Arteriosklerose geeignet infolge der Beteiligung der HMGA-Proteine an der Regulation der Transkription einer Vielzahl viraler Gene bzw. der starken Expression von HMGA und insbesondere HMGAl in dem von Areteriosklerose betroffenen Gewebe, das mit neointimalen, vaskuläre glatten Muskelzellen, Makrophagen und neuen Blutgefäßen assoziiert istThe indication application of the medicament prepared using an L-nucleic acid, wherein the nucleic acid is directed against an intracellular target molecule, results for the person skilled in the art from the involvement of the intracellular target molecule in the pathogenicity mechanism on which the respective indication is based. For example, HMGA proteins are known to be associated with carcinomas (including the breast, lung, skin, thyroid), as well as leukemias and lymphomas, as well as other malignant tumors such as the like. Sarcomas (rhabdomyosarcoma, osteosarcoma) are associated. In addition, they are used in many mesenchymal tumors, i.a. Hamartomas (breast and lung), adipose tissue tumors (lipomas), pleomorphic adenomas of the salivary glands, uterine leiomyomas, angiomyxomas, breast fibroadenomas, polyps of the endometrium, and atherosclerotic plaques. HMGA is an interesting therapeutic target. Blockade of HMGA may be a suitable starting point for the control of cancer and prevent its metastatic spread. As described in more detail herein, L-nucleic acids directed against HMGA proteins are also useful for the diagnosis and / or therapy of viral diseases and arteriosclerosis due to the involvement of the HMGA proteins in the regulation of transcription of a variety of viral genes or the high expression of HMGA and in particular HMGA1 in the atherosclerosis affected tissue associated with neointimal vascular smooth muscle cells, macrophages and new blood vessels
Obwohl - wie von den vorliegenden Erfindern überraschend festgestellt - Nukleinsäuren, bevorzugt L-Nukleinsäuren und bevorzugterweise Spiegelmere in der Lage sind, als solches eine Phospholipid-Doppelmembran wie eine Cytoplasmamembran zu durchdringen und dann intrazellulär funktional zu sein im Sinne der - spezifischen - Wechselwirkung mit dem intrazellulären Rezeptor, kann die Wirksamkeit der Einschleusung der L-Nukleinsäure durch die Verwendung verschiedener Techniken beeinflusst und insbesondere erhöht werden. Zu diesen Techniken gehört die Verwendung von chemischen Verbindungen oder Molekülen ebenso wie die Verwendung von physikalischen Maßnahmen. Unabhängig von der Art werden diese Techniken hierin allgemein als Abgabevehikel bezeichnet. Es ist im Rahmen der vorliegenden Erfindung, dass die Erfinder ebenfalls festgestellt haben, dass auch Aptamere diese Eigenschaft aufweisen und wie die somit Spiegelmere ebenfalls zusammen mit der erfmdungsge- mäßen Zusammensetzung zu den grundsätzlich gleichen Zwecken, Anwendungen und Verwendungen verwendet oder herangezogen werden können.Although, as surprisingly stated by the present inventors, nucleic acids, preferably L-nucleic acids and preferably spiegelmers are capable of penetrating as such a phospholipid double membrane as a cytoplasmic membrane and then being intracellularly functional in the sense of - specific - interaction with the intracellular receptor, the efficacy of the introduction of L-nucleic acid can be influenced and in particular increased by the use of different techniques. These techniques include the use of chemical compounds or molecules as well as the use of physical measures. Whatever the nature, these techniques are generally referred to herein as delivery vehicles. It is within the scope of the present invention that the inventors have also found that aptamers also have this property and, like the spiegelmers thus also together with the erfmdungsge- According to the composition can be used or used for the basically same purposes, applications and uses.
Bei der Verwendung von chemischen Verbindungen bzw. Molekülen kann weiter unterschieden werden, ob die Nukleinsäure für die Abgabe modifiziert werden muss, oder ob sie nicht modifiziert werden muss. Eine Modifikation zu Zwecken der Verwendung eines Abgabevehikels ist typischerweise nicht erforderlich, wenn das Abgabevehikel ein Vesikel darstellt oder umfasst, wie beispielsweise bei Liposomen, Polypeptid-Vehikeln, Cyclodextrinen, Dendrimeren, Nano- und Mikropartikeln sowie Polyethylenimin. Eine Modifikation zu Zwecken der Verwendung eines Abgabevehikels ist dagegen typischerweise erforderlich wenn das Abgabevehikel Rezeptor-vermittelte Endozytose, fusogene Peptide, Signalpeptide oder Ii- pophile Konjugate verwendet. Die Gruppe der physikalischen Techniken umfasst insbesondere Elektroporation und Iontophorese. Es wird anerkannt werden, dass den Fachleuten auf dem Gebiet weitere Techniken bekannt sind, um eine Verbindung über eine Phospholipid- Doppelmembran wie eine Cytoplasmamembran zu transportieren, die grundsätzlich auch für den Transfer eine funktionalen Nukleinsäure wie beispielsweise eines Aptamers und/oder eines Spielgelmers geeignet sind.When using chemical compounds or molecules, it is further possible to distinguish whether the nucleic acid has to be modified for delivery or whether it does not have to be modified. Modification for purposes of using a delivery vehicle is typically not required when the delivery vehicle is or comprises a vesicle, such as in liposomes, polypeptide vehicles, cyclodextrins, dendrimers, nano- and microparticles, and polyethyleneimine. On the other hand, modification for purposes of using a delivery vehicle is typically required when the delivery vehicle uses receptor-mediated endocytosis, fusogenic peptides, signal peptides, or biopsy conjugates. The group of physical techniques includes in particular electroporation and iontophoresis. It will be appreciated that those skilled in the art are aware of other techniques for transporting a compound via a phospholipid double membrane, such as a cytoplasmic membrane, which are also generally suitable for the transfer of a functional nucleic acid such as an aptamer and / or a gelator ,
Im folgenden sollen die einzelnen Abgabevehikel, die im Rahmen der verschiedenen Aspekte der vorliegenden Erfindung verwendet werden können, detaillierter beschrieben werden.In the following, the individual delivery vehicles that can be used in the various aspects of the present invention will be described in more detail.
Liposomen bestehen aus künstlichen kationischen Lipiden wie N-[I -(2,3 -dioleoyloxy) pro- pyl]-N,N,N-trimethylammoniumchlorid (DOTMA) und N-[l-(2,3-dioleoyloxy) propyl]- N,N,N-trimethylammoniumsulfat (DOTAP), in denen die kationischen Gruppen mit den negativ geladenen Nukleinsäuren wechselwirken und deren anionischen Ladung neutralisieren. Der Transport erfolgt über Endozytose (PNAS, 93:11493-11498, 1996). Allerdings sind kationische Liposomen zytotoxisch, insbesondere in höheren Konzentrationen, was ihre Anwendung in vitro und in vivo begrenzt (Biochem Biophys Res Commun, 197:818, 1993; Biochem Biophys Res Commun, 1372:55-68, 1998). Eine nicht toxische Formulierung stellt dagegen das amphiphile Pyridinium-basierte Lipid SAINT-2 dar (Nucleic Acids Res, 29:2079-2087, 2001). Eine Alternative stellen auch pH-sensitive Liposomen dar, die aus amphipatischen Molekülen wie Cholesterylhemisuccinat (CHEMS) und Dioleylphosphatidylethanolamin (DOPE) bestehen (J Pharmacol Exp Ther, 297:1129-1136, 2001). Verschiedenste Formulie- rungen von Liposomen finden sich in den Übersichtsartikeln von Dass und Torchili (Drug Delivery, 9:169-180, 2002; Nat Rev Drug Disc, 4:145-160, 2005).Liposomes consist of artificial cationic lipids such as N- [1- (2,3-dioleoyloxy) propyl] -N, N, N-trimethylammonium chloride (DOTMA) and N- [1- (2,3-dioleoyloxy) propyl] - N, N, N-trimethylammonium sulfate (DOTAP), in which the cationic groups interact with the negatively charged nucleic acids and neutralize their anionic charge. Transport is via endocytosis (PNAS, 93: 11493-11498, 1996). However, cationic liposomes are cytotoxic, especially at higher concentrations, limiting their use in vitro and in vivo (Biochem Biophys Res Commun, 197: 818, 1993, Biochem Biophys Res Commun, 1372: 55-68, 1998). In contrast, a non-toxic formulation is the amphiphilic pyridinium-based lipid SAINT-2 (Nucleic Acids Res, 29: 2079-2087, 2001). An alternative are also pH-sensitive liposomes consisting of amphipatic molecules such as cholesteryl hemisuccinate (CHEMS) and dioleoylphosphatidylethanolamine (DOPE) (J Pharmacol Exp Ther, 297: 1129-1136, 2001). Various formulations Reviews of liposomes can be found in review articles by Dass and Torchili (Drug Delivery, 9: 169-180, 2002, Nat Rev Drug Disc, 4: 145-160, 2005).
Bei der Rezeptor-vermittelten Endozytose (RME) werden Transportmechanismen, die bereits in der Zellmembran vorhanden sind, genutzt. Dazu wird die Nukleinsäure beispielsweise über einen Poly-L-lysin (PPL)-Linker kovalent mit einem Transporter-Protein (,,Carrier"-Protein) verknüpft. Die Auswahl des Transporter-Proteins ist dabei abhängig von der Fähigkeit an bestimmte Rezeptoren der Zellmembran zu binden und in der Zelle durch Endozytose zu akkumulieren. So kann ein zellspezifischer Transport realisiert werden. So konnte beispielsweise ein gegen c-myc gerichtetes Antisense-Phosphorothioat in M- 14 humane Melanom-Zellen geschleust werden (Anticancer Res, 17:29-35, 1997). Allerdings hängt ein effektiver Transport mittels RME dabei nicht nur von der Affinität des Rezeptors für den Liganden sondern auch von der Limitierung des ausgewählten Rezeptors bezüglich der Zellen - speziell in vivo - ab. Des weiteren muss der ausgewählte Ligand inaktiv oder verstärkend bezogen auf das therapeutischen Ergebnis sein, um eine mögliche Toxizität des Transportvehikels zu vermeiden. So ist die Auswahl und die ubiquitäre Verbreitung des ausgewählten Rezeptors in vivo entscheidend für einen erfolgreichen RME-basierten Transport. Des weiteren konnte eine Sequestration von Nukleinsäuren in endosomalen Kompartments bei RME-basiertem Transport beobachtet werden, was diese Methode für einen intrazellulären Transport bzw. eine intrazelluläre Abgabe oder Delivery wenig vielversprechend erscheinen lässt. Zuallerletzt muss die Verknüpfung zwischen Rezeptor und Nukleinsäure so gewählt werden, dass sowohl die Funktion des einen oder des anderen nicht reduziert wird (J Pharmaceutical Science, 92 (8): 1559- 1573, 2003).Receptor-mediated endocytosis (RME) utilizes transport mechanisms that are already present in the cell membrane. For this purpose, for example, the nucleic acid is covalently linked to a transporter protein ("carrier" protein) via a poly-L-lysine (PPL) linker, the selection of the transporter protein being dependent on the ability to particular receptors of the cell membrane Cell-specific transport can be achieved, for example, by targeting an antisense phosphorothioate directed against c-myc into M-14 human melanoma cells (Anticancer Res, 17: 29-35 However, effective delivery by RME depends not only on the affinity of the receptor for the ligand but also on the limitation of the receptor selected on the cells, especially in vivo, and the inactivated or amplified ligand must be obtained be on the therapeutic result to avoid possible toxicity of the transport vehicle. "So the choice and the ubiquitous V In vivo, the release of the selected receptor is crucial for successful RME-based transport. Furthermore, a sequestration of nucleic acids in endosomal compartments was observed in RME-based transport, which makes this method not very promising for intracellular transport or intracellular delivery or delivery. Lastly, the linkage between receptor and nucleic acid must be chosen so as not to diminish the function of either one or the other (J Pharmaceutical Science, 92 (8): 1559-1573, 2003).
Fusogene Peptide sind verwendet worden, um Peptid-Oligonukleotid-Konjugaten die Fusion mit der Zellmembran zu ermöglichen und so den Transport in die Zelle zu realisieren (Bio- conjug Chem, 9: 466-475, 1998; Bioconjug Chem, 6:43-53, 1995; Nucleic Acids Research, 25:2730-2736, 1997).Fusogenic peptides have been used to allow peptide-oligonucleotide conjugates to fuse with the cell membrane and thus to facilitate transport into the cell (Bioconjug Chem., 9: 466-475, 1998; Bioconjug Chem., 6: 43-53 , Nucleic Acids Research, 25: 2730-2736, 1997).
Der selektive Import von Kernproteinen aus dem Zytosol in den Nukleus wird durch kurze Peptidsequenzen, die „Nuclear localization signals" (NLS) genannt werden, vermittelt. So können verschiedene NLS-Peptidderivate verwendet werden, um Nukleinsäuren in den Nukleus zu transportieren (Bioconjug Chem, 10:1005-1012, 1999; Bioconjug Chem, 10:598-606, 1999; Bioconjug Chem, 6:101-108, 1995). Zudem gibt es auch sogenannte „Signal import Peptides" (IP), die die zelluläre Aufnahme von Nukleinsäuren befördern können und beispielsweise aus dem Kaposi 's Fibroblastenwachstumsfaktor (K-FGF) abgeleitet werden konnten (Adv Drug Deliv Rev, 44:35-49, 2000).The selective import of nuclear proteins from the cytosol into the nucleus is mediated by short peptide sequences called "nuclear localization signals" (NLS), so various NLS peptide derivatives can be used to deliver nucleic acids into the nucleus (Bioconjug Chem. 10: 1005-1012, 1999; Bioconjug Chem, 10: 598-606, 1999; Bioconjug Chem. 6: 101-108, 1995). In addition, there are also so-called "signal import peptides" (IP), which can promote the cellular uptake of nucleic acids and, for example, could be derived from Kaposi's fibroblast growth factor (K-FGF) (Adv Drug Deliv Rev, 44: 35-49, 2000).
Durch Blöcke von Polypeptiden können Vesikel analog zu viralen Kapsiden ausgebildet werden, die als mögliche Transportvehikel für einen intrazellulären Transport dienen (Nat Materials, 3(4):244-8, 2004).Blocks of polypeptides allow vesicles to be formed analogously to viral capsids that serve as potential delivery vehicles for intracellular transport (Nat Materials, 3 (4): 244-8, 2004).
Der hydrophile Charakter von Oligonukleotiden und das anionische Phosphodiester-Rückgrat reduzieren die zelluläre Permeation. Daher stellen lipophile Konjugate eine Möglichkeit dar, die Fähigkeit von Oligonukleotiden zu erhöhen, an Lipoproteine zu binden und dadurch die intrazelluläre Delivery zu verbessern. Das am besten untersuchte Konjugat ist das Cholesterin (Antisense and Nucleic Acid Drug Development, 12:103-128, 2002).The hydrophilic character of oligonucleotides and the anionic phosphodiester backbone reduce cellular permeation. Therefore, lipophilic conjugates provide a way to increase the ability of oligonucleotides to bind to lipoproteins and thereby improve intracellular delivery. The best studied conjugate is cholesterol (Antisense and Nucleic Acid Drug Development, 12: 103-128, 2002).
Cyclodextrine sind zyklische Oligosaccharide, die eine zentrale hydrophobe Kavität und multiple Hydroxylgruppen an der äußeren Oberfläche aufweisen. Cyclodextrine konnten so bereits für den Transport von Antisense-Oligonukleotiden in humane T- Zelllinien (Antisense Res Dev, 5:185-192, 1995) und auch in vivo zum intrazellulären Transport bzw. zur intrazellulären Abgabe oder Delivery von immunogenen CpG-Sequenzen verwendet werden (Bio- chem Pharmacol, 52:1537-1544, 1996). Verschiedenste Formulierungen von Cycloodextrinen finden sich in dem Übersichtsartikel von Davis und Brewster (Nature Reviews Drug Discovery 3:1023-1035, 2004).Cyclodextrins are cyclic oligosaccharides that have a central hydrophobic cavity and multiple hydroxyl groups on the outer surface. Cyclodextrins have thus already been used for the transport of antisense oligonucleotides into human T cell lines (Antisense Res Dev, 5: 185-192, 1995) and also in vivo for intracellular transport or intracellular delivery or delivery of immunogenic CpG sequences (Biochem Pharmacol, 52: 1537-1544, 1996). Various formulations of cyclodextrins can be found in the review by Davis and Brewster (Nature Reviews Drug Discovery 3: 1023-1035, 2004).
Dendrimere sind hochverzweigte Makromoleküle, die sich aus repetitiven Einheiten von - typischerweise - Polyamiden zusammensetzen. Die Moleküle tragen auf ihrer Oberfläche funktionelle Gruppen wie primäre Aminogruppen, die mit anderen Molekülen durch elektrostatische Interaktion wechselwirken. Dadurch findet schnell und hoch reproduzierbar eine komplexe Formbildung statt, die zu Komplexen mit schwacher Zytotoxizität führt (Nucleic Acids Research, 28:4225-4231, 2000; Clin Cancer Res, 7:3606-3612, 2001;)Dendrimers are highly branched macromolecules composed of repetitive units of - typically - polyamides. The molecules carry on their surface functional groups such as primary amino groups, which interact with other molecules through electrostatic interaction. As a result, complex, rapid, and highly reproducible complex formation occurs, resulting in complexes with weak cytotoxicity (Nucleic Acids Research, 28: 4225-4231, 2000, Clin Cancer Res, 7: 3606-3612, 2001;
Zyanacrylatnanopartikel sind seit Beginn der 1990er Jahre für die Abgabe oder Delivery von Oligonukleotiden getestet worden. Die Wechselwirkung von Oligonukleotiden zu den Nano- Partikeln erfolgt durch Ionen-Paare der anionischen Ladung der Oligonukleotide mit verschiedenen hydrophoben Kationen vorrangig mit geladenden Nanopartikeln. Typischerweise werden zur Bildung von Nanopartiklen Polyisohexyl-(PIHCA), Polyisobutyl-(PIBCA) oder Polyhexycyanoacrylate (PHCA) verwendet, obwohl auch eine Vielzahl von lipophilen Kati- on-Oligonukleotid-Paaren getestet wurde (Pharm Res., 1 :1370-1378, 1994; PNAS, 91:10460- 10464, 1994; Pharm Res, 9:441-449, 1992). Auch zur in vivo Anwendung wurden Nanoparti- kel bereits eingesetzt (Biochem Biophys Res Commun, 279:401-406, 2000; Pharm Res, 13:38-43, 1996).Cyanoacrylate nanoparticles have been tested since the early 1990's for delivery or delivery of oligonucleotides. The interaction of oligonucleotides with the nano- Particles are formed by ion pairs of the anionic charge of the oligonucleotides with different hydrophobic cations, primarily with charged nanoparticles. Typically, polyisohexyl (PIHCA), polyisobutyl (PIBCA), or polyhexycyanoacrylates (PHCA) are used to form nanoparticles, although a variety of lipophilic cation-oligonucleotide pairs have also been tested (Pharm Res., 1: 1370-1378). 1994; PNAS, 91: 10460-10464, 1994; Pharm Res. 9: 441-449, 1992). Nanoparticles have also been used for in vivo use (Biochem Biophys Res Commun, 279: 401-406, 2000, Pharm Res, 13: 38-43, 1996).
Mikropartikel oder sogenannte Mikrokugeln („microspheres") sind typischerweise aus bioab- baubaren Polymeren Poly(d,l-laktid-co-glykolide [P(LA-GA)] und werden zum verzögerten Abgabe von Oligonukleotiden eingesetzt (J Pharm Sei, 91:790-799; 2000; J Controlled Release, 69:197-207, 2000; J Drug Traget, 5:291-302, 1998)Microparticles or so-called microspheres are typically biodegradable polymers poly (d, l-lactide-co-glycolide [P (LA-GA)] and are used for the sustained release of oligonucleotides (J Pharm Sei, 91: 790-799, 2000; J Controlled Release, 69: 197-207, 2000; J Drug Traget, 5: 291-302, 1998).
Elektroporation ist eine Transporttechnologie, die ein starkes elektrisches Feld benutzt, um die Lipiddoppelmembran zu destabilisieren, dadurch die Zellmembran zu permeabilisieren und so einen Transport der zu verabreichenden Substanz, die auch ionisiert vorliegen kann (Iontophorese), in die Zelle zu ermöglichen. Elektroporation ist bereits erfolgreich verwendet worden, um transdermalen Transport von Oligonukleotiden ex vivo sowie in vivo zu ermöglichen (Int J Pharm, 184:147-156, 1999; J Drug Traget, 5:275-289, 1998; Pharm Res, 15:1596- 1602, 1998; Int J Cancer, 85:260-266, 2000; Biochem Biophys Res Commun, 212:286-292, 1995; Blood, 88:731-741, 1996).Electroporation is a transport technology that uses a strong electric field to destabilize the lipid double membrane, thereby permeabilizing the cell membrane and thus allowing transport of the substance to be administered, which may also be ionized (iontophoresis), into the cell. Electroporation has been used successfully to facilitate transdermal delivery of oligonucleotides ex vivo and in vivo (Int J Pharm, 184: 147-156, 1999, J Drug Traget, 5: 275-289, 1998, Pharm Res, 15: 1596 Int J Cancer, 85: 260-266, 2000; Biochem Biophys Res Commun, 212: 286-292, 1995; Blood, 88: 731-741, 1996).
Durch Aufwendung von hohem Druck kann die Aufnahme „nackter" Oligonukleotide in Zellen in vitro und ex vivo verbessert werden. Die Notwendigkeit geschlossener Systeme zur Verwendung dieser Technologie lässt nur eine. Verwendung für ex vivo Anwendungen zu (PNAS, 96:6411-6416, 1999; Hum Gene Ther, 10:2355-2664, 1999).By using high pressure, uptake of "naked" oligonucleotides in cells can be improved in vitro and ex vivo The need for closed systems to use this technology allows only one use for ex vivo applications (PNAS, 96: 6411-6416, 1999 Hum Gene Ther, 10: 2355-2664, 1999).
Auch die Verwendung von Schockwellen, akustischen Hochdruckpulsen, ermöglicht den Transport von Oligonukleotiden in Zellen (J Mol Med, 79:306-313, 2001; Cancer Res, 58:219-221, 1998). Ultraschall ist ebenfalls eine akustische Technolgie vergleichbar zu den Schockwellen, benutzt allerdings höhere Frequenzbereiche (MHz statt Hz) und kürzere Verwendungszeiten (Sekunden bis Minuten) und wurde bereits unterstützend für gentherapeuti- sehe Ansätze verwende (Hum Gene Ther, 7:1339-1346, 1996; Invest Radiol, 32:723-727, 1997; Ultrasound Med Bio, 25:1451 -1457, 1999).Also, the use of shock waves, high pressure acoustic pulses, allows the transport of oligonucleotides into cells (J Mol Med, 79: 306-313, 2001, Cancer Res, 58: 219-221, 1998). Ultrasound is also an acoustic technology comparable to the shock waves, but uses higher frequency ranges (MHz instead of Hz) and shorter use times (seconds to minutes) and has already been supportive for gene therapy. See (Gene Gene Ther, 7: 1339-1346, 1996; Invest Radiol, 32: 723-727, 1997; Ultrasound Med Bio, 25: 1451-1457, 1999).
In einem weiteren Aspekt der vorliegenden Erfindung wird ein neues Abgabevehikel bereitgestellt, das insbesondere für den Transport von funktionalen Nukleinsäuren wie Aptameren, bevorzugt funktionalen L-Nukleinsäuren und ganz besonders bevorzugt Spiegelmeren geeignet ist. Das Abgabevehikel ist dabei eine mizellenartige oder liposomenartige Struktur auf der Grundlage von Polyethylenimin. Ohne darauf im folgenden festgelegt sein zu wollen, gehen die vorliegenden Erfinder derzeit davon aus, dass die Nukleinsäure in der micellenartigen oder liposomenartigen Struktur eingebettet oder enthalten vorliegt. Polyethylenimin kann grundsätzlich als lineares oder verzweigtes Polyethylenimin vorliegen und auch verwendet werden, wobei verzweigtes Polyethylenimin in der verzweigten Form besonders bevorzugt ist. Des weiteren kann Polyethylenimin als hochmolekulares oder niedermolekulares Polyethylenimin vorliegen und auch verwendet werden. Bevorzugterweise weist hochmolekulares Polyethylenimin ein Molekulargewicht von etwa 800 kDa auf und niedermolekulares Polyethylenimin ein Molekulargewicht von etwa 3 kDa auf. Im Rahmen der vorliegenden Erfindung wird ein Polyethylenimin mit einem mittleren Molekulargewicht von etwa 25 kDa bevorzugt, wobei es sich dabei bevorzugtererweise um ein verzweigtes Polyethylenimin mit einem Molekulargewicht von etwa 25 kDa handelt.In a further aspect of the present invention, a novel delivery vehicle is provided, which is particularly suitable for the transport of functional nucleic acids such as aptamers, preferably functional L-nucleic acids and most preferably Spiegelmeren. The delivery vehicle is a micelle-like or liposomal-like structure based on polyethyleneimine. Without wishing to be bound by the following, the present inventors currently assume that the nucleic acid is embedded or contained in the micelle-like or liposomal-like structure. Polyethyleneimine may, in principle, be present as a linear or branched polyethylenimine and also be used, with branched polyethylenimine in the branched form being particularly preferred. Furthermore, polyethyleneimine can be present as a high molecular weight or low molecular weight polyethyleneimine and also be used. Preferably, high molecular weight polyethyleneimine has a molecular weight of about 800 kDa and low molecular weight polyethyleneimine has a molecular weight of about 3 kDa. In the context of the present invention, a polyethyleneimine having an average molecular weight of about 25 kDa is preferred, which is more preferably a branched polyethylenimine having a molecular weight of about 25 kDa.
Obgleich es für ein Funktionieren nicht obligatorisch, ist es doch bevorzugt, dass bei dem erfindungsgemäßen Abgabevehikel die abzugebende Nukleinsäure selbst auch eine Modifikation trägt. Dabei ist es bevorzugt, wenn die Modifikation aus der Gruppe ausgewählt ist, die PEG-Reste umfasst. Dabei ist weiter bevorzugt, wenn der PEG-Rest ein Molekulargewicht von etwa 1000 bis 10000 Da, bevorzugtererweise etwa von 1200 bis 5000 Da und weiter bevorzugtererweise etwa von 1500 bis 2500 Da und am bevorzugtesten von etwa 2000 Da aufweist.Although not obligatory for functioning, it is preferred that in the delivery vehicle of the invention, the nucleic acid to be delivered itself also carries a modification. It is preferred if the modification is selected from the group comprising PEG radicals. It is further preferred that the PEG moiety has a molecular weight of about 1,000 to 10,000 Da, more preferably about 1,200 to 5,000 Da, and more preferably about 1,500 to 2,500 Da, and most preferably about 2,000 Da.
Bei der Mischung der Nukleinsäure mit dem Abgabevehikel zur Herstellung einer erfindungsgemäßen Zusammensetzung wird ein Quotient aus Gesamtanzahl der Stickstoffgruppen des Polyethylenimins und Gesamtanzahl der Phoshpatgruppen der mit oder durch das Abgabevehikel abzugebenden oder zu verpackenden Nukleinsäure von etwa 1 bis 20, bevorzugter- weise von etwa 1,5 bis 10, bevorzugtererweise von 2 bis 5 und am bevorzugtesten von etwa 2 bis 3 eingestellt bzw. realisiert.When mixing the nucleic acid with the delivery vehicle to prepare a composition according to the invention, a quotient of the total number of nitrogen groups of the polyethyleneimine and the total number of phosphate groups of the nucleic acid to be delivered or packaged with or by the delivery vehicle is from about 1 to 20, preferably Example of about 1.5 to 10, more preferably from 2 to 5 and most preferably adjusted from about 2 to 3 or realized.
Das erfindungsgemäße Abgabevehikel erlaubt somit, auch für funktionale Nukleinsäure wie Aptamere und insbesondere L-Nukleinsäuren wie Spiegelmere den Mechanismus des intrazellulären Transports von Nukleinsäuren über Kondensation bzw. Verpackung mit geladenen Partikeln oder Reagenzien und damit verbundene Änderung der Ladung des Gesamtkomplexes zu nutzen. Dieser Komplex wird leicht über Endozytose aufgenommen und gelangt somit in das Zytosol der Zelle. Ein Nachteil dieser Methode ist die Stabilität der DNA/ RNA bzw. das Freisetzen der Nukleinsäure aus dem endosomalen Kompartiment. Im Zytosol der Zelle entsteht aus dem eingeschnürten Endosom durch das Einbringen von Proteasen bzw. Nuklea- sen und durch Protonierung des Kompartiments schnell ein Lysosom. Nukleasen verdauen dort die Nukleinsäuren. Das gilt jedoch nicht für Spiegelmere, da diese durch ihre unnatürliche Konfiguration nukleasestabil sind. Zudem sind Nukleinsäuren im saurem Milieu des Ly- sosoms nicht stabil. Allerdings gilt dies eher für Nukleinsäuren aus DNA, weniger für Nukleinsäuren, die aus RNA aufgebaut sind. Über Exozytose bzw. den Abbau im Golgi-Apparat wird der gesamte Komplex schnell wieder aus der Zelle transportiert und somit gelangen nur wenige Nukleinsäuren in die Zelle. Eine der Herausforderung an ein geeignetes Transfekti- onssystem ist somit die Stabilisierung, sowie die Freisetzung der Nukleinsäure aus den Endo- somen in das Zytosol. Hinsichtlich der Stabilität haben RNA-Spiegelmere ideale Eigenschaften für eine Transfektion von eukaryotischen Zellen, da sie als Enantiomere nicht von Enzymen gespalten werden.The delivery vehicle according to the invention thus also makes it possible to use the mechanism of the intracellular transport of nucleic acids via condensation or packaging with charged particles or reagents and associated change in the charge of the overall complex, also for functional nucleic acids such as aptamers and in particular L-nucleic acids such as Spiegelmers. This complex is easily absorbed via endocytosis and thus enters the cytosol of the cell. A disadvantage of this method is the stability of the DNA / RNA or the release of the nucleic acid from the endosomal compartment. In the cytosol of the cell, a lysosome is rapidly formed from the constricted endosome by the introduction of proteases or nucleases and by protonation of the compartment. Nucleases digest the nucleic acids there. However, this does not apply to spiegelmers, as they are nuclease-stable due to their unnatural configuration. In addition, nucleic acids are not stable in the acidic milieu of the lysosome. However, this applies more to nucleic acids from DNA, less to nucleic acids made up of RNA. Through exocytosis or degradation in the Golgi apparatus, the entire complex is quickly transported back out of the cell and thus only a few nucleic acids enter the cell. One of the challenges posed by a suitable transfection system is thus the stabilization as well as the release of the nucleic acid from the endosomes into the cytosol. In terms of stability, RNA spiegelmers have ideal properties for transfection of eukaryotic cells since they are not cleaved by enzymes as enantiomers.
Die erfindungsgemäße Verwendung der L-Nukleinsäuren und insbesondere im Zusammenhang mit der erfindungsgemäßen Zusammensetzung ist gerade für diese Wirkstoffklasse von Bedeutung, da deren Wirkmechanismus auf einem stöchiometrischen Ansatz und nicht auf einem katalytischen Ansatz beruht, bei dem bereits die intrazelluläre Abgabe von einigen wenigen Molekülen ausreichend ist, "um die gewünschte Wirkung zu erzielen. Insoweit wird mit der vorliegenden Erfindung ein bisher durch die Techniken des Standes der Technik nicht befriedigter Bedarf befriedigt.The use according to the invention of the L-nucleic acids and in particular in connection with the composition according to the invention is of particular importance for this class of drugs, since their mechanism of action is based on a stoichiometric approach and not on a catalytic approach in which the intracellular delivery of a few molecules is already sufficient "in order to achieve the desired effect. In that regard, is satisfied with the present invention, a previously unmet by the techniques of the prior art required.
Das mit den erfindungsgemäßen Abgabevehikeln bereitgestellte bzw. ausgebildete erfindungsgemäße Transfektionssystem basiert auf der Bildung von Mizellen aus Nukleinsäuren und verzweigtem Polyethylenimin (PEI). Das Phosphodiesterrückgrat der Nukleinsäuren in- teragiert mit den freien Stickstoff-Positionen des PEI und bildet über Querverzweigung kleine Mizellen, welche aufgrund des PEI eine positive Ladung haben. Diese Mizellen werden leicht durch Einschnürung der Plasmamembran als Endosomen von einer Zelle aufgenommen. Das PEI puffert nun einströmende Protonen ab, woraufhin viele Chlorid-Ionen im Inneren des Endosoms zu einem Anschwellen des Kompartiments aufgrund des osmotischen Drucks führen. Dieser Effekt des PEI wird als Protonen-Schwamm-Effekt in der Literatur beschrieben und führt letztlich zum Platzen des Endosoms und zur Freisetzung der Spiegelmere in das Zytosol. (Pharm Res, 22 (3): 373-80, 2005; Eur J Cell Biol 83 (3): 97-111, 2004; Gene Ther 9(24): 1700-7, 2002).The transfection system according to the invention provided or designed with the delivery vehicles according to the invention is based on the formation of micelles from nucleic acids and branched polyethyleneimine (PEI). The phosphodiester backbone of the nucleic acids interacts with the free nitrogen positions of the PEI and cross-branches to form small micelles, which have a positive charge due to the PEI. These micelles are easily taken up by constricting the plasma membrane as endosomes from a cell. The PEI now buffers incoming protons, whereupon many chloride ions inside the endosome lead to a swelling of the compartment due to the osmotic pressure. This effect of PEI is described as a proton sponge effect in the literature and ultimately leads to the bursting of the endosome and the release of the spiegelmers into the cytosol. (Pharm Res., 22 (3): 373-80, 2005; Eur J Cell Biol 83 (3): 97-111, 2004; Gene Ther 9 (24): 1700-7, 2002).
Es ist im Rahmen der vorliegenden Erfindung, dass die erfindungsgemäße Zusammensetzung als Aerosol verabreicht wird.It is within the scope of the present invention that the composition according to the invention is administered as an aerosol.
Des Weiteren können Spiegelmere mit Signalpeptiden für die intrazelluläre, sowie intranukle- äre Abgabe (engl. „Delivery"), als auch für die Organ spezifische Delivery derivatisiert werden. Eine Kopplung von Signalpeptiden direkt an das Polyethylenimin kann für eine gerichte Lokalisation zu Organen oder innerhalb der Zelle verwendet werden.Furthermore, spiegelmers can be derivatized with signal peptides for intracellular as well as intranuclear delivery, as well as for organ specific delivery Coupling of signal peptides directly to the polyethyleneimine can be done for a localized localization to organs or within the cell can be used.
In einem noch weiteren Aspekt betrifft die vorliegende Erfindung L-Nukleinsäuren, insbesondere Spiegelmere und noch bevorzugter RNA-Spiegelmere, die gegen HMGA-Proteine gerichtet sind. Die hierin offenbarten Spiegelmere gegen HMGA-Proteine stellen insbesondere Beispiele dar für die der vorliegenden Anmeldung ebenfalls zugrundeliegende Erkenntnis, dass L-Nukleinsäuren und insbesondere Spiegelmere in der Lage sind, eine Phospholipid- Doppelmembran bzw. eine Cytoplasmamembran einer Zelle zu überwinden und intrazellulär mit dem intrazellulären Rezeptor, auf dessen spezifische Bindung hin sie selektiert worden sind, zu binden. Hinsichtlich der Ausgestaltung der HMGA-Proteine und der dagegen gerichteten L-Nukleinsäuren gilt das hierin zu der intrazellulären Verwendung von L-Nukleinsäure offenbarte auch im Zusammenhang mit dem vorliegenden Aspekt der Erfindung (und vice versa) und wird zur Vermeidung unnötiger Wiederholungen an dieser Stelle durch Bezugnahme wiederholt. Die HMG (high mobility group)-Familie von DNA-bindenden Phosphoproteinen sind als Nicht-Histon-Komponenten des Chromatins ubiquitär in Säugerzellen vorhanden (Grosschedl et al. 1994). Die basischen HMG-Proteine werden in drei verschiedene Familien eingeteilt - die HMGB- (früher: HMG-1/-2), die HMGN- (früher: HMG-14/-17), und die HMGA-Familie (früher: HMG-IΛ7C). Jede HMG-Familie besitzt ihr charakteristisches funktionelles Sequenzmotiv: die „HMG-box" (HMGB-Familie), die „nucleosomal binding domain" (HMGN- Familie), bzw. den „AT-hook" (HMGA-Familie).In yet another aspect, the present invention relates to L-nucleic acids, particularly spiegelmers, and more preferably RNA spiegelmers directed against HMGA proteins. The disclosed herein Spiegelmers against HMGA proteins are particularly examples of the present application also underlying finding that L-nucleic acids and spiegelmers in particular are able to overcome a phospholipid double membrane or a cytoplasmic membrane of a cell and intracellularly with the intracellular To bind receptor on the specific binding of which they have been selected. With regard to the design of the HMGA proteins and the L-nucleic acids directed against it, the one disclosed herein for the intracellular use of L-nucleic acid also applies in connection with the present aspect of the invention (and vice versa) and is used to avoid unnecessary repetitions at this point Reference repeated. The HMG (high mobility group) family of DNA-binding phosphoproteins are ubiquitous in mammalian cells as non-histone components of chromatin (Grosschedl et al., 1994). The basic HMG proteins are divided into three different families - the HMGB (formerly HMG-1 / -2), the HMGN (formerly HMG-14 / -17), and the HMGA family (formerly HMG). IΛ7C). Each HMG family has its own unique functional sequence motif: the "HMG-box" (HMGB family), the "nucleosomal binding domain" (HMGN family), and the "AT-hook" (HMGA family).
Zum gegenwärtigen Stand umfasst die HMGA-Familie zwei Gene, HMGAl und HMGA2. Von HMGAl können durch alternatives splicing drei verschiedene Proteine exprimiert werden (HMGAIa [früher: HMG-I], HMGAIb [früher: HMG-Y], HMGAIc [früher: HMG-I/R]), von HMGA2 nur eines (HMGA2 [früher: HMGI-C]). HMGAIa, HMGAIb und HMGA2 sind Polypeptide von ungefähr 100 Aminosäuren Länge und weisen eine modulare Sequenzorganisation auf: sie besitzen drei stark basische Regionen („AT-hook") die die schmale kleine Furche von doppelsträngiger AT-reicher DNA binden (Reeves & Nissen 1990). Der C-Terminus dagegen enthält viele saure Aminosäuren. Die Proteine besitzen frei in Lösung keine stabile Sekundär struktur und nehmen erst eine definierte Konformation an, wenn sie im Komplex mit DNA oder anderen Proteinen vorliegen (Huth et al 1997). HMGA-Proteine gehören zu den am stärksten modifizierten Proteinen im Säugerzellkern und werden phosphoryliert, acety- liert, und methyliert (Reeves & Beckerbauer 2001).At the present time, the HMGA family includes two genes, HMGA1 and HMGA2. From HMGA1, three different proteins can be expressed by alternative splicing (HMGAIa [formerly HMG-I], HMGAIb [formerly HMG-Y], HMGAIc [formerly HMG-I / R]), HMGA2 only one (HMGA2 [earlier : HMGI-C]). HMGA1a, HMGA1b and HMGA2 are polypeptides of approximately 100 amino acids in length and have a modular sequence organization: they have three strongly basic regions ("AT-hooks") which bind the narrow minor groove of double-stranded AT-rich DNA (Reeves & Nissen 1990) The C-terminus, on the other hand, contains many acidic amino acids, which have no stable secondary structure in solution and do not adopt a defined conformation until complexed with DNA or other proteins (Huth et al 1997) to the most highly modified proteins in the mammalian cell nucleus and are phosphorylated, acetylated, and methylated (Reeves & Beckerbauer 2001).
Die HMGA-Proteine besitzen per se keine transkriptioneile Aktivität, organisieren aber als s.g. architektonische Transkriptionsfaktoren durch ihre Protein-Protein sowie Protein-DNA- Interaktionen die Ausbildung des Nukleoprotein-DNA-Transkriptionskomplexes (Wolffe 1994). Sie nehmen somit regulatorisch auf die Expression einer Vielzahl von Genen einen aktivierenden oder inhibitorischen Einfluß. Das prominenteste Beispiel einer positiven Regulation ist die Involvierung von HMGAl in die Regulation des IFN-/3 (Thanos & Maniatis, 1992). So stimuliert beispielsweise im Falle des IFN-ß-Promotors das HMGAIb die Bindung von NF-κB und ATF-2 an die DNA-Doppelhelix und verändert gleichzeitig die DNA- Struktur dergestalt, dass NF-κB und ATF-2 miteinander und vermutlich auch mit der restlichen Transkriptionsmaschinerie interagieren können (Thanos & Maniatis 1992, Du et al 1993). Ein weiterer transkriptionsaktivierender Effekt im Zusammenhang mit der arteriosklerotischen Pathogenese ist die durch HMGAl induzierte CD44-Genregulation (Foster et al 1998). CD44 ist ein Zelloberflächen-Glykoprotein und in die Migration und Proliferation glatter Muskelzellen nach Endothelverletzung involviert (Jain et al 1996, Cuff et al 2001). Die transkriptioneile Regulation von CD44 wird durch die Bindung von c-Fos und c-Jun an die AP-I Bindungsstelle im CZW-Promotor induziert und durch die Bindung von HMGAl verstärkt. Untersuchungen in Ratten zeigten, daß es durch CD44-Überexpression zu einer verstärkten Rekrutierung glatter Muskelzellen kommt und dies direkten Einfluß auf die Entstehung von arteriosklerotischen Läsionen hat (Pellacani et al 1999; Foster et al. 1998; 2000).The HMGA proteins do not have any transcriptional activity per se, but as so-called architectural transcription factors, through their protein-protein and protein-DNA interactions, they organize the formation of the nucleoprotein-DNA transcription complex (Wolffe 1994). They thus have an activating or inhibitory influence on the expression of a multiplicity of genes. The most prominent example of a positive regulation is the involvement of HMGA1 in the regulation of IFN- / 3 (Thanos & Maniatis, 1992). For example, in the case of the IFN-β promoter, the HMGAIb stimulates the binding of NF-κB and ATF-2 to the DNA double helix and at the same time alters the DNA structure such that NF-κB and ATF-2 interact with each other and presumably also with the rest of the transcription machinery (Thanos & Maniatis 1992, Du et al 1993). Another transcriptional activating effect associated with arteriosclerotic pathogenesis is HMGA1-induced CD44 gene regulation (Foster et al 1998). CD44 is a cell surface glycoprotein and involved in the migration and proliferation of smooth muscle cells after endothelial injury (Jain et al 1996, Cuff et al 2001). Transcriptional regulation of CD44 is induced by the binding of c-Fos and c-Jun to the AP-I binding site in the CZW promoter and enhanced by the binding of HMGA1. Studies in rats have shown that CD44 overexpression leads to an increased recruitment of smooth muscle cells and has a direct influence on the development of arteriosclerotic lesions (Pellacani et al 1999, Foster et al., 1998, 2000).
Untersuchungen zur Expression des in der chromosomalen Bande 6ρ21.3 lokalisierten HMGAl-Gens und des in der Region 12ql4-15 lokalisierten HMGA2- Gens zeigten, dass diese hauptsächlich bei Prozessen zellulärer Differenzierung aktiv sind. Dementsprechend ist eine starke Expression dieser Gene während der Embryonalentwicklung und in undifferenzierten Zellen (Chiappetta et al 1996) sowie in Wachstumsfaktor-stimulierten Zellen zu finden (Friedman et al 1993; Johnson et al 1990; Ogram et al 1995; Holth et al 1997). Im adul- ten, differenzierten Gewebe ist lediglich in der Retina HMGAl stark exprimiert, während in den übrigen Geweben HMGA2 gar nicht und HMGAl nur noch in sehr geringen Konzentrationen zu finden ist (Bussemakers et al 1991; Chiappetta et al 1996; Rogalla et al 1996; Zhou et al 1995; Chau et al 2000). Eine reaktivierte Expression von HMGA-Proteinen in differenziertem Normalgewebe wird dabei mit dem Wachstum und der Differenzierung von Adipozy- ten (Zhou et al 1995; Anand & Chada 2000; Melillo et al 2001), der Proliferation glatter Muskelzellen in den Blutgefäßen nach Gefäßverletzungen (Chin et al 1999), der Immunantwort bei entzündlichen Reaktionen (Pellacani et al 1999) sowie mit apoptotischen Prozessen (Diana et al 2001; Sgarra et al 2003) assoziiert. Die Menge an HMGAl variiert dabei in Abhängigkeit von der Proliferationsrate der Zellen (Johnson et al 1990).Investigations on the expression of the HMGA1 gene located in the chromosomal band 6ρ21.3 and the HMGA2 gene localized in the region 12ql4-15 revealed that they are mainly active in processes of cellular differentiation. Accordingly, strong expression of these genes is found during embryonic development and in undifferentiated cells (Chiappetta et al 1996) as well as in growth factor-stimulated cells (Friedman et al 1993, Johnson et al 1990, Ogram et al 1995, Holth et al 1997). In the adult, differentiated tissue HMGA1 is strongly expressed only in the retina, while in the other tissues HMGA2 is not found at all and HMGA1 is found only in very low concentrations (Bussemakers et al 1991, Chiappetta et al 1996, Rogalla et al 1996 Zhou et al 1995; Chau et al 2000). A reactivated expression of HMGA proteins in differentiated normal tissue is thereby associated with the growth and differentiation of adipocytes (Zhou et al 1995, Anand & Chada 2000, Melillo et al 2001), the proliferation of smooth muscle cells in the blood vessels after vascular injury (Chin et al 1999), the immune response in inflammatory reactions (Pellacani et al 1999) and apoptotic processes (Diana et al 2001, Sgarra et al 2003). The amount of HMGA1 varies depending on the proliferation rate of the cells (Johnson et al 1990).
Im Verlauf der Embryonalentwicklung konzentriert sich die HMGAl -Expression auf spezifische Organe ekto-, meso- oder endodermalen Ursprungs, während HMGA2 auf mesenchymale Gewebe beschränkt ist. Bislang liegen keine Informationen über den Phänotyp von HMGAl -knockout Mäusen vor, möglicherweise weil das Fehlen dieses Faktors die embryonale Entwicklung zu sehr schädigt. HMGΛ 2-knockout Mäuse dagegen sind zwergwüchsig und weisen besonders wenig Fettgewebe auf (Zhou et al 1995) und sind darüber hinaus gegen diätinduzierte Fettleibigkeit resistent (Anand & Chada 2000). Schließlich ist HMGA2- bzw. HMGAlb-Expression nicht nachweisbar im Fettgewebe von normalen Mäusen, jedoch dramatisch erhöht im Fett von fetten oder diabetischen Mäusen (Chada et al. 2004), was auf einen Zusammenhang von Adipositas und HMGA-Expression hindeutetDuring embryonic development, HMGA1 expression is concentrated on specific organs of ecto-, meso- or endodermal origin, while HMGA2 is restricted to mesenchymal tissues. So far, there is no information on the phenotype of HMGA1 knockout mice, possibly because the lack of this factor damages embryonic development too much. HMGΛ 2-knockout mice, on the other hand, are dwarf and have low levels of adipose tissue (Zhou et al 1995) and are also resistant to diet-induced obesity (Anand & Chada 2000). Finally, HMGA2 or HMGAlb expression is undetectable in adipose tissue of normal mice, but dramatically increased in fat of fat or diabetic mice (Chada et al., 2004), suggesting an association between obesity and HMGA expression
Überexpression von HMGAl beeinflusst im Einzelnen (Reeves et al 2001):In detail, overexpression of HMGA1 influences (Reeves et al 2001):
• Regulatoren von Zellzyklus und Wachstum wie cdc25A,• regulators of cell cycle and growth such as cdc25A,
• Intermediäre Filamentmarker wie Zytokeratin, Typ 1• Intermediary filament markers such as cytokeratin, type 1
• Apoptoseregulatoren wie TRARl 5• apoptosis regulators such as TRARl 5
• Onkogene und Tumorsuppressor-Gene wie METOncogenic and tumor suppressor genes such as MET
• Gene für DNA-Reparatur und -Rekombination wie DNase XGenes for DNA repair and recombination such as DNase X.
• Regulatoren von Zellschicksal und -entwicklung wie frizzled-5• Cell fate and development regulators like frizzled-5
• Rezeptoren wie FGFRl• receptors like FGFRl
• Zelladhäsions-, Motilitäts- und Invasionsgene wie collagen type 1• Cell adhesion, motility and invasion genes such as collagen type 1
• Angiogenese-Regulatoren wie FGFR2Angiogenesis regulators such as FGFR2
• Invasionsregulatoren wie MMP-16• Invasion regulators like MMP-16
• kleinen GTPasen der Rho-Familie und ihre Regulatoren wie RhoC• small GTPases of the Rho family and their regulators such as RhoC
• Zell-Zellinteraktionsgene wie Cadherin 12• cell-cell interaction genes such as cadherin 12
• Wachstumsfaktoren und Zytokine wie IL-11• Growth factors and cytokines such as IL-11
Abnormale Regulation von HMGAl könnte daher zu generellen Alterationen der Genexpression führen und dadurch signifikant zur Bildung von transformierten und/oder metastatischen Phänotypen beitragen.Abnormal regulation of HMGA1 could therefore lead to general alterations in gene expression, thereby significantly contributing to the formation of transformed and / or metastatic phenotypes.
HMGA-Proteine scheinen in mesenchymalen bzw. epithelialen Tumoren unterschiedliche Rollen zu spielen: in malignen epithelialen Tumoren ist HMGA-Expression eher mit späteren Stadien der Karzinogenese assoziiert, während die benignen - eher selten konvertierenden mesenchymalen Tumoren - bereits in früher Hyperplasie HMGA exprimieren. Dies deutet darauf hin, dass HMGA-Proteine in Geweben von unterschiedlicher embryonaler Herkunft verschiedene Funktionen erfüllen, woraus sich auch unmittelbar die entsprechenden Anwen- düngen der erfindungsgemäßen L-Nukleinsäuren in der Diagnose und/oder Therapie von - entsprechenden - Erkrankungen ergeben, wie auch im Folgenden auch detaillierter dargstellt.HMGA proteins appear to play different roles in mesenchymal or epithelial tumors: in malignant epithelial tumors, HMGA expression is more associated with later stages of carcinogenesis, while benign - rarely-converting mesenchymal tumors - already express HMGA in early hyperplasia. This indicates that HMGA proteins in tissues of different embryonic origins perform different functions, which also directly affects the corresponding applications. fertilize the L-nucleic acids according to the invention in the diagnosis and / or treatment of - corresponding - diseases, as shown in more detail below dargstellt.
In Tiermodellen wurde die Expression von HMGAl in verschiedenen menschlichen und tierischen Neoplasmen untersucht. Die Rolle von HMGA-I konnte in Tiermodellen bezüglich Tumorigenese (Leman et al 2003; Ram et al 1993) sowie neoplastischer Progression gezeigt werden (Bussemakers et al 1991; Nestl et al 2001; Ram et al 1993).Animal models investigated the expression of HMGA1 in various human and animal neoplasms. The role of HMGA-I has been demonstrated in animal models of tumorigenesis (Leman et al 2003, Ram et al 1993) and neoplastic progression (Bussemakers et al 1991, Nestl et al 2001, Ram et al 1993).
Erhöhte Expression des HMGAl -Gens ist belegt für Karzinome vonIncreased expression of the HMGA1 gene is proven for carcinomas of
• Prostata (Bussemaker et al 1991; Tamimi et al 1996, Leman et al 2003; Nestl et al 2001)• prostate (Bussemaker et al 1991, Tamimi et al 1996, Leman et al 2003, Nestl et al 2001)
• Pankreas ( Nestl et al 2001 ; Abe et al 2000, 2002; Tarbe et al 2001)• Pancreas (Nestl et al 2001, Abe et al 2000, 2002, Tarbe et al 2001)
• Schilddrüse (Chiappetta et al 1998, 1995)Thyroid (Chiappetta et al 1998, 1995)
• Zervix (Bandiera et al 1998)• cervix (Bandiera et al 1998)
• Magen (Xiang et al 1997)Stomach (Xiang et al 1997)
• Brust (Holth et al 1997; Baldassarre et al 2003; Reeves et al 2001; Nestl et al 2001; Ram et al 1993; Dolde et al 2002)• Brust (Holth et al 1997, Baldassarre et al 2003, Reeves et al 2001, Nestl et al 2001, Ram et al 1993, Dolde et al 2002)
• Colon/Rektum (Fedele et al 1996; Abe et al 1999; Kim et al 1999; Chiapetta et al 2001)• Colon / rectum (Fedele et al 1996, Abe et al 1999, Kim et al 1999, Chiapetta et al 2001)
• Ovarien (Masciullo et al 2003) • und weiterhin für• Ovaries (Masciullo et al 2003) • and continue for
• Neuroblastome (Giannini et al 2000; 1999) sowie• Neuroblastomas (Giannini et al 2000, 1999) as well as
• Lymphome (Wood et al 2000a; b).• Lymphomas (Wood et al 2000a, b).
Die genaue Basis für die erhöhte Expression und die Rolle des HMGAl-Gens in der Pathogenese des Tumors und des Prozesses der Metastasierung ist zwar noch nicht ganz geklärt. Verschiedene Studien legen jedoch nahe, dass die Stärke der HMGA 1 -Expression des jeweiligen Tumors als prognostischer Marker mit dessen Metastasierungspotential korreliert und damit ein charakteristisches Merkmal für eine maligne transformierte Zelle darstellt (Giancotti et al 1987).The exact basis for the increased expression and role of the HMGA1 gene in the pathogenesis of the tumor and the process of metastasis is still not fully understood. Various studies suggest, however, that the strength of HMGA 1 expression of the tumor as a prognostic marker correlates with its metastatic potential and thus is a characteristic feature of a malignant transformed cell (Giancotti et al 1987).
Weitere HMGAl -assoziierte - in diesem Falle benigne, mesenchymale Tumore - sind charakterisiert durch chromosomale Veränderungen in der chromosomalen HMGL4 /-Region 6p21.3. Derartige Aberrationen wurden bislang unter anderem fürOther HMGAl-associated - in this case benign, mesenchymal tumors - are characterized by chromosomal alterations in the chromosomal HMGL4 / region 6p21.3. Such aberrations have so far been among others for
• Uterus-Leiomyome (Mark et al 1988; Ozisik et al 1993)• uterine leiomyomas (Mark et al 1988, Ozisik et al 1993)
• Lipome (Sreekantaiah et al 1990)Lipomas (Sreekantaiah et al 1990)
• Endometriumpolypen (Fletcher et al 1992; Dal Cin et al 1995) sowie• endometrial polyps (Fletcher et al 1992, Dal Cin et al 1995) and
• chondroide Hamartome der Lunge (Fletcher et al 1991; Johansson et al 1992, 1993)• chondroid hamartomas of the lung (Fletcher et al 1991, Johansson et al 1992, 1993)
beschrieben.described.
Aberrationen in den genetischen Mechanismen, die Wachstum und Proliferation kontrollieren, sind die primäre Ursache für Karzinogenese. Die Expression von HMGA-Proteinen ist stark mit Tumorentwicklung assoziiert, wie in einer Anzahl von Arbeiten gezeigt werden konnte (Giancotti et al. 1987, 1989, 1993). So wurde eine beträchtliche HMGA2-Expression in chemisch oder viral erzeugten wie auch in spontan erhaltenen Tumoren gefunden, während in nicht-transformierten Zellen bzw. gesundem Gewebe dieses Protein nicht nachgewiesen werden konnte (Giancotti et al. 1989). In Einklang damit fehlten mit onkogenen Retroviren infizierten Zellen, in denen die Synthese von HMGA2-Expression spezifisch blockiert worden war, verschiedene phänotypische Marker für Transformation (Berlingieri et al. 1995).Aberrations in the genetic mechanisms that control growth and proliferation are the primary cause of carcinogenesis. The expression of HMGA proteins is strongly associated with tumor development, as shown in a number of papers (Giancotti et al., 1987, 1989, 1993). Thus, a considerable HMGA2 expression was found in chemically or virally generated as well as in spontaneously obtained tumors, whereas in non-transformed cells or healthy tissue this protein could not be detected (Giancotti et al., 1989). Consistent with this, oncogenic retrovirus-infected cells in which the synthesis of HMGA2 expression had been specifically blocked lacked various phenotypic markers for transformation (Berlingieri et al., 1995).
Die Schlüsselrolle der HMGA-Proteine für normales wie auch pathologisches Wachstum konnte in Mausmodellen herausgearbeitet werden: HMGA2 knockout-MMse zeigen Zwergwuchs, d. h. die Tiere sind ca. 60% kleiner als Wildtyp-Mäuse. Diese Zwergmäuse jedoch weisen eine hohe Resistenz gegen chemisch induzierte Hauttumoren auf.The key role of HMGA proteins for both normal and pathological growth could be identified in mouse models: HMGA2 knockout MMse show dwarfism, d. H. the animals are about 60% smaller than wild-type mice. However, these dwarf mice have a high resistance to chemically induced skin tumors.
Mit Hilfe zytogenetischer Untersuchungen wurden in den letzten Jahren für eine ganze Reihe von benignen Tumoren mesenchymalen Ursprungs - hierbei handelt es sich um die größte Gruppe gutartiger Neoplasien des Menschen - strukturelle Aberrationen der chromosomalen Region 12ql4-15 das HMGA2-Gen betreffend gefunden. Trotz einer Vielzahl an Aberrationen (Schoenmakers et al 1995; Kottickal et al 1998; Klotzbüchel et al 1999) haben die veränderten Formen aber immer eine Gemeinsamkeit: sie beinhalten alle die drei DNA-bindenden Domänen, gleichzeitig verlieren sie aber sowohl die saure C-terminale Domäne als auch auf Ebene der RNA die Informationen des 3'UTRs.With the help of cytogenetic studies, a number of benign tumors of mesenchymal origin - the largest group of benign neoplasms in humans - have been identified in recent years as structural aberrations of the chromosomal region 12ql4-15 concerning the HMGA2 gene. Despite a multitude of aberrations (Schoenmakers et al 1995; Kottickal et al 1998; Klotzbüchel et al 1999), the altered forms always have one thing in common: they contain all three DNA-binding domains, but at the same time lose both the acidic C-terminal domain and at the level the RNA the information of the 3'UTRs.
Solche Veränderungen wurden bereits für viele (meist gutartige) mesenchymalen HMGA- assoziierte Tumore gefunden:Such changes have already been found in many (mostly benign) mesenchymal HMGA-associated tumors:
• Leiomyome des Uterus, die häufigsten Unterleibstumoren bei Frauen und Indikation . für über 200.000 jährliche Hysterektomien in den USA (Heim et al 1988; Turc-Carel et al 1986; Vanni et al 1988)• Leiomyomas of the uterus, the most common abdominal tumors in women and indication. for over 200,000 annual hysterectomies in the US (Heim et al 1988, Turc-Carel et al 1986, Vanni et al 1988)
• Lipome (Heim et al 1988; Turc-Carel et al 1986; Mandahl et al 1987; Sreekantaiah et al 1991; Beige et al 1992)• Lipome (Heim et al 1988, Turc-Carel et al 1986, Mandahl et al 1987, Sreekantaiah et al 1991, Beige et al 1992)
• Endometriumpolypen (Walter et al 1989; Vanni et al 1993; Dal Cin et al 1995)Endometrial polyps (Walter et al 1989, Vanni et al 1993, Dal Cin et al 1995)
• chondroide Hamartome der Lunge (Fletcher et al 1991 , 1995 ; Dal Cin et al 1993)• chondroid hamartomas of the lung (Fletcher et al 1991, 1995, Dal Cin et al 1993)
• pleomorphe Adenome der Kopfspeicheldrüsen (Mark et al 1980, 1986; Bullerdiek et al 1987)• pleomorphic adenomas of the salivary glands (Mark et al 1980, 1986, Bullerdiek et al 1987)
• Hämangiopericytome (Mandahl et al 1993)Hemangiopericytomas (Mandahl et al 1993)
• chondromatöse Tumore (Mandahl et al 1989; Bridge et al 1992)• chondromatous tumors (Mandahl et al 1989, Bridge et al 1992)
• benigne Tumore der Brust (Birdsal et al 1992; Rohen et al 1995; Staats et al 1996)• benign breast tumors (Birdsal et al 1992, Rohen et al 1995, Staats et al 1996)
• aggressive Angiomyxome (Kazmierczak et al 1995)• aggressive angiomyomas (Kazmierczak et al 1995)
• diffuse Astrocytome• diffuse astrocytomas
• Osteoklastome (Nuguera et al 1989)• osteoclastomas (Nuguera et al 1989)
Die Hauptursache für Mortalität und Morbidität von Krebspatienten ist die metastatische Verbreitung des primären Neoplasmas im Körper. Metastasierung ist ein kein einfacher Vorgang, da eine erfolgreiche Kolonisierung von entfernten Organen durch ausgestreute neoplastische Zellen viele Stadien durchlaufen muss. Neoplastische Zellen müssen sich vom primären Neoplasma lösen, in den Blutkreislauf eintreten, an entfernten Orten wieder extravadieren, und schliesslich im Parenchym des entsprechenden Organs wieder proliferieren. Bei den verschiedenen Stadien dieser hochkomplexen metastatischen Kaskade sind viele Gene beteiligt die Proteine wie Proteasen, Adhäsionsmoleküle, Motilitätsfaktoren und angiogene Faktoren exprimieren.The main cause of mortality and morbidity of cancer patients is the metastatic spread of the primary neoplasm in the body. Metastasis is not a simple process, as successful colonization of distant organs by scattered neoplastic cells must pass through many stages. Neoplastic cells must detach from the primary neoplasm, enter the bloodstream, extravagate at distant locations, and finally proliferate again in the parenchyma of the corresponding organ. Many genes are involved in the different stages of this highly complex metastatic cascade express proteins such as proteases, adhesion molecules, motility factors and angiogenic factors.
Welches dieser Gene letztendlich das ausschlaggebende für die Metastasierung ist, ist nicht bekannt. Das HMGAl-Gen als einer der wichtigsten Faktoren, der diesen Prozess kontrolliert, ist jedoch ein valider Kandidat dafür. Die Genprodukte von HMGAl beeinflussen die Transkription vieler Gene, die für erfolgreiche Metastasierung wichtig sind. So wurde bereits gezeigt, dass andere Metastase-assoziierte Gene bei Suppression von HMGAl -Expression ihrerseits vermindert exprimiert werden (Battista 1998; Vallone 1997).Which of these genes is ultimately the key to metastasis is unknown. However, the HMGA1 gene as one of the most important factors controlling this process is a valid candidate for this. The gene products of HMGA1 affect the transcription of many genes that are important for successful metastasis. For example, other metastasis-associated genes have been shown to be less expressed when suppressed by HMGA1 expression (Battista 1998, Vallone 1997).
HMGAl ist daher ein interessantes therapeutisches Zielmolekül. Die Blockade von HMGAl ist somit grundsätzlich geeignet den Krebs zu kontrollieren und seine metastatische Verbreitung zu verhindern (Evans 2004; Sgarra 2004). So konnte beispielsweise durch Einsatz von gegen HMGA-Transkripte gerichtete Antisense-RNAs in Krebszellen in vitro die Zellprolife- ration verringert oder die Zellen sogar zur Apoptose gebracht werden (Masciullo 2003; Scala 2000; Chau 2003). Im Tiermodell wurde gezeigt, dass durch Gentherapie (adoenovirale Expression von gegen HMGA-Transkripte gerichtete Antisense-RNAs) das Wachstum von verschiedenen Pankreaskrebs-Xenografts drastisch reduziert wird (Trapasso et al 2004).HMGA1 is therefore an interesting therapeutic target molecule. The blockade of HMGA1 is therefore in principle suitable for controlling the cancer and preventing its metastatic spread (Evans 2004, Sgarra 2004). For example, by using antisense RNAs directed against HMGA transcripts in cancer cells in vitro, it was possible to reduce cell proliferation or even to induce apoptosis (Masciullo 2003, Scala 2000, Chau 2003). The animal model has shown that gene therapy (adoenoviral expression of antisense RNAs directed against HMGA transcripts) drastically reduces the growth of various pancreatic cancer xenografts (Trapasso et al 2004).
HMGAl könnte weiterhin als prognostischer diagnostischer Marker verwendet werden, um zu bestimmen, welche Patienten von einer aggressiveren Krebstherapie profitieren würden. Es besteht eine enge Korrelation zwischen dem Grad der malignen Transformation und der Menge an exprimiertem HMGAl. Dies kann wiederum mit einer schlechten Prognose bei vielen menschlichen Krebstypen korreliert werden, wie Prostata- ( Tamimi 1996; Bussemakers 1991) und kolorektale Karzinome (Abe 1999) bzw. Neuroblastome (Giannini 2000).HMGA1 could continue to be used as a prognostic diagnostic marker to determine which patients would benefit from more aggressive cancer therapy. There is a close correlation between the degree of malignant transformation and the amount of HMGA1 expressed. This in turn can be correlated with a poor prognosis in many human cancers, such as prostate (Tamimi 1996, Bussemakers 1991) and colorectal carcinoma (Abe 1999) or neuroblastoma (Giannini 2000).
HMGA-Proteine werden von vielen Viren als von der Wirtszelle bereitgestellte Kontrollfaktoren für die Expression viraler Gene oder als Cofaktoren, unter anderem vonHMGA proteins are considered by many viruses to be control factors for the expression of viral genes or cofactors provided by the host cell, among others
• humanem Papovavirus JC (Leger et al 1995)Human papovavirus JC (Leger et al 1995)
• Epstein-Barr- Virus (Schaefer et al 1997)• Epstein-Barr virus (Schaefer et al 1997)
• Herpes-Simplex-Virus (Panagiotidis 1999 ; French et al 1996 )• herpes simplex virus (Panagiotidis 1999, French et al 1996)
• HIV-I Virus (Henderson et al 2000) verwendet.HIV-1 virus (Henderson et al 2000) used.
Insbesondere werden HMGA Proteine mit der Regulation der Transkription einer Vielzahl viraler Gene in einer Wirtszelle in Verbindung gebracht. Beispiele hierfür sind die Regulation der Expression der frühen und spät expremierten Gene des humanen Papovavirus JC (Leger et al. 1995), Regulation des EBNAl (Epstein-Barr virus nuclear antigen 1) Gens des Ebstein- Bar Virus (EBV), welches mitverantwortlich für die Kontrolle viraler Latenz ist, (Schaefer et al. 1997), Regulation des IE-3 (immediate-early) Gens des Herpes Simplex Virus-1 (HSV-I), welches das frühzeitig expremierte Protein ICP4 codiert (Panagiotidis et al. 1999), Regulation des während der Latenzphase aktiven Promotors 2 des HSV-I (French et al. 1996) und Regulation des LTR (long terminal repeats) -Promotors des humanen HIV-I Virus (Henderson et al 2000).In particular, HMGA proteins are implicated in the regulation of transcription of a variety of viral genes in a host cell. Examples include the regulation of the expression of the early and late expressed genes of the human papovavirus JC (Leger et al., 1995), regulation of the EBNA1 (Epstein-Barr virus nuclear antigen 1) gene of the Ebstein-Bar virus (EBV), which is responsible for the control of viral latency is, (Schaefer et al., 1997), regulation of the IE-3 (immediate early) gene of herpes simplex virus-1 (HSV-I), which encodes the early expressed protein ICP4 (Panagiotidis et al., 1999 ), Regulation of the latent phase active promoter 2 of HSV-I (French et al., 1996) and regulation of the LTR (long terminal repeats) promoter of the human HIV-1 virus (Henderson et al., 2000).
Die Requirierung von HMGA seitens der Wirtszelle im Rahmen viraler Erkrankungen ist nicht nur auf virale Gen-Regulation beschränkt. HMGAl scheint auch eine entschiedene Rolle als architektonischer Kofaktor bei der Integration der viralen DNA des HIV-I Virus, des Moloney murinen Leukämie Virus (MoMuLv) und Sarkomen Geflügelgrippe Virus (ASV) in das menschliche Genom zu spielen und scheint somit ein interessanter therapeutischer Ansatz antiviraler Therapie zu sein (Van Maele et al. 2006, Li et al 1998, Hindmarsh et al. 1999)The requisition of HMGA by the host cell in the context of viral diseases is not limited to viral gene regulation. HMGA1 also appears to play a decided role as an architectural cofactor in integrating the viral DNA of the HIV-I virus, the Moloney murine leukemia virus (MoMuLv) and sarcoma poultry flu virus (ASV) into the human genome and thus appears to be an interesting therapeutic approach of antiviral Therapy (Van Maele et al 2006, Li et al 1998, Hindmarsh et al., 1999)
Somit sind Inhibitoren von HMGA Proteinen auch zur Behandlung und der Diagnose von Virusinfektionen geeignet (Reeves & Beckerbauer 2002).Thus, inhibitors of HMGA proteins are also suitable for the treatment and diagnosis of viral infections (Reeves & Beckerbauer 2002).
Infolge der vorstehend dargelegten Beteiligung von HMGA-Proteinen an verschiedenen Erkrankungen bzw. ihrer Eignung als diagnostische Marker, können dagegen gerichtete L- Nukleinsäure und insbesondere Spiegelmere für die Prävention, Therapie und Diagnose von eben diesen Erkrankungen verwendet werden. Besonders bevorzugte Spiegelmere sind dabei die hierin beschriebenen Spiegelmeren. In diesem Zusammenhang wird von den Fachleuten anerkannt werden, dass obwohl die einzelnen Spiegelmere für ein bestimmtes HMGA-Protein generiert worden sind, infolge des in Beispiel 2 dargestellten Domänen-Ansatzes diese auch eine Kreuzreaktivität mit anderen HMGA-Proteinen erlauben, wie sich auch aus dem in Fig. 2 dargestellten Alignment ergibt. Weiterhin wird von den Fachleuten auf dem Gebiet anerkannt werden, dass die erfindungsgemäßen Nukleinsäuren eine Reihe von Strukturmotiven aufweisen, die eine Klasse von Spiegelmeren definieren, die gegen HMGA-Proteine als intrazelluläre Rezeptoren binden. Die verschiedenen Strukturmotive werden detaillierter in Beispiel 1 weiter dargestellt.In contrast, as a result of the above-mentioned involvement of HMGA proteins in various diseases or their suitability as diagnostic markers, directed L-nucleic acid and in particular spiegelmers can be used for the prevention, therapy and diagnosis of precisely these diseases. Particularly preferred spiegelmers are the spiegelmer described herein. In this regard, it will be appreciated by those skilled in the art that although the individual spiegelmers have been generated for a given HMGA protein, as a result of the domain approach illustrated in Example 2, these also allow cross-reactivity with other HMGA proteins, as can be seen in US Pat in Fig. 2 shows alignment. Furthermore, it will be appreciated by those skilled in the art that the nucleic acids of the invention have a number of structural motifs that define a class of spiegelmers that bind to HMGA proteins as intracellular receptors. The various structural motifs are further detailed in Example 1.
Die erfϊndungsgemäßen Nukleinsäuren umfassen in einer bevorzugten Ausführungsform auch solche Nukleinsäuren, die im Wesentlichen homolog zu den spezifisch hierin offenbarten Sequenzen sind. Der Begriff „im Wesentlichen homolog" soll hierin bevorzugterweise so verstanden werden, dass die Homologie wenigstens 75 %, bevorzugterweise 85 %, bevorzugtererweise 90 % und am bevorzugtesten mehr als 95, 96, 97, 98 oder 99 % beträgt.In a preferred embodiment, the nucleic acids according to the invention also comprise those nucleic acids which are substantially homologous to the sequences specifically disclosed herein. The term "substantially homologous" herein is preferably understood to mean that the homology is at least 75%, preferably 85%, more preferably 90%, and most preferably more than 95, 96, 97, 98 or 99%.
Der Begriff der erfindungsgemäßen Nukleinsäuren oder Nukleinsäuren gemäß der vorliegenden Erfindung soll weiterhin auch jene Nukleinsäuren umfassen, die Nukleinsäuresequenzen umfassen, wie sie hierin offenbart sind oder Teile davon, bevorzugterweise in dem Umfang, dass die Nukleinsäuren oder die besagten Teile davon an der Bindung an HMGA-Proteine beteiligt sind. Eine derartige Nukleinsäure kann von den hierin offenbarten abgeleitet werden, z. B. durch Verkürzung oder Trunkierung. Eine Verkürzung kann entweder ein oder beide Enden der Nukleinsäuren, wie sie hierin offenbart sind, betreffen. Eine Verkürzung kann auch die innere Sequenz aus Nukleotiden betreffen, d. h. sie kann Nukleotid(e) zwischen dem 5'- bzw. dem 3 '-terminalen Nukleotid betreffen. Darüber hinaus soll der Begriff Verkürzung auch die Deletion von so wenig wie einem einzelnen Nukleotid von der Sequenz der hierin offenbarten Nukleinsäuren betreffen. Verkürzung kann auch mehr als einen Bereich der erfindungsgemäßen Nukleinsäure(n) betreffen, wobei ein jeder dieser Bereiche so klein wie ein Nukleotid lang sein kann.The term of the inventive nucleic acids or nucleic acids according to the present invention should furthermore also include those nucleic acids which comprise nucleic acid sequences as disclosed herein or parts thereof, preferably to the extent that the nucleic acids or the said parts thereof are involved in binding to HMGAs. Proteins are involved. Such nucleic acid can be derived from those disclosed herein, e.g. B. by shortening or truncation. A truncation may refer to either or both ends of the nucleic acids as disclosed herein. A truncation may also involve the inner sequence of nucleotides, i. H. it may involve nucleotide (s) between the 5 'and 3' terminal nucleotides, respectively. In addition, the term truncation should also refer to the deletion of as little as a single nucleotide from the sequence of the nucleic acids disclosed herein. Shortening may also refer to more than one region of the nucleic acid (s) of the invention, wherein each of these regions may be as small as one nucleotide in length.
Die Nukleinsäuren gemäß der vorliegenden Erfindung können darüber hinaus entweder D- Nukleinsäuren oder L-Nukleinsäuren sein. Bevorzugterweise sind die erfindungsgemäßen Nukleinsäuren L-Nukleinsäuren. Zusätzlich ist es möglich, dass ein oder mehrere Teile der Nukleinsäure als D-Nukleinsäuren vorliegt, oder wenigstens ein oder mehrere Teile der Nukleinsäuren L-Nukleinsäuren sind. Der Begriff „Teil" der Nukleinsäuren soll sowenig wie ein Nukleotid bezeichnen. Derartige Nukleinsäuren werden allgemein hierin als D- bzw. L- Nukleinsäuren bezeichnet. Deshalb bestehen in einer bevorzugten Ausführungsform die Nuk- leinsäuren gemäß der vorliegenden Erfindung aus L-Nukleotiden und umfassen wenigstens ein D-Nukleotid. Ein derartiges D-Nukleotid ist bevorzugterweise an einem Teil befestigt, der von dem/den Bereich(en) verschieden ist, die die Nukleinsäuren gemäß der vorliegenden Erfindung definieren, bevorzugterweise jenen Teilen davon, mit denen eine Wechselwirkung mit anderen Teilen der Nukleinsäuren erfolgt. Bevorzugterweise ist ein derartiges D- Nukleotid am Ende eines jeden Bereiches bzw. einer jeden Nukleinsäure gemäß der vorliegenden Erfindung befestigt. In einer bevorzugten Ausführungsform können derartige D- Nukleotide als ein Spacer oder ein Linker fungieren, der bevorzugterweise Modifikationen wie PEG und HES an die Nukleinsäuren gemäß der vorliegenden Erfindung bindet.The nucleic acids according to the present invention may furthermore be either D-nucleic acids or L-nucleic acids. Preferably, the nucleic acids according to the invention are L-nucleic acids. In addition, it is possible that one or more parts of the nucleic acid are present as D-nucleic acids, or at least one or more parts of the nucleic acids are L-nucleic acids. The term "part" of the nucleic acids is not intended to refer to any nucleotide, and such nucleic acids are generally referred to herein as D- or L-nucleic acids. Therefore, in a preferred embodiment, the nucleic acids L-acids according to the present invention from L-nucleotides and comprise at least one D-nucleotide. Such a D-nucleotide is preferably attached to a part other than the region (s) defining the nucleic acids according to the present invention, preferably those parts thereof which interact with other parts of the nucleic acids. Preferably, such a D-nucleotide is attached to the end of each region or nucleic acid according to the present invention. In a preferred embodiment, such D-nucleotides may function as a spacer or a linker which preferably binds modifications such as PEG and HES to the nucleic acids of the present invention.
Im Rahmen der vorliegenden Erfindung umfassen in einer Ausfuhrungsform die erfindungsgemäßen Nukleinsäuren auch solche, die Teil einer längeren Nukleinsäure sind, wobei diese längeren Nukleinsäuren mehrere Teile umfassen können, wobei wenigstens ein Teil eine Nukleinsäure gemäß der vorliegenden Erfindung oder ein Teil davon ist. Der andere Teil oder die anderen Teile dieser längeren Nukleinsäuren können entweder eine D-Nukleinsäure oder eine L-Nukleinsäure sein. Eine jegliche Kombination kann in Verbindung mit der vorliegenden Erfindung und zu den Zwecken bzw. Verwendungen verwendet werden, wie sie für die erfindungsgemäßen Nukleinsäuren hierin offenbart sind. Dieser andere Teil bzw. diese anderen Teile der längeren Nukleinsäure können eine Funktion aufweisen, die vom Binden und insbesondere vom Binden an HMGA-Protein, verschieden ist. Eine mögliche Funktion besteht darin, eine Wechselwirkung mit anderen Molekülen, z. B. zu Zwecken der Immobilisierung, Kreuzvernetzung, des Nachweises, der Amplifikation oder Modifikation oder Molekulargewichtserhöhung zu erlauben.In the context of the present invention, in one embodiment, the nucleic acids according to the invention also include those which are part of a longer nucleic acid, wherein these longer nucleic acids can comprise several parts, wherein at least one part is a nucleic acid according to the present invention or a part thereof. The other part or parts of these longer nucleic acids may be either a D-nucleic acid or an L-nucleic acid. Any combination may be used in connection with the present invention and for the purposes or uses as disclosed for the nucleic acids of the invention herein. This other part or parts of the longer nucleic acid may have a function other than binding and in particular binding to HMGA protein. One possible function is to interact with other molecules, e.g. B. for purposes of immobilization, cross-linking, detection, amplification or modification or molecular weight increase to allow.
Insbesondere in diesem Zusammenhang sind L-Nukleinsäuren, wie hierin verwendet, Nukleinsäuren, die aus L-Nukleotiden bestehen, bevorzugterweise vollständig aus L-Nukleotiden bestehen.In particular in this context, L-nucleic acids as used herein are nucleic acids consisting of L-nucleotides, preferably consisting entirely of L-nucleotides.
Entsprechend sind insbesondere D-Nukleinsäuren, wie hierin verwendet, Nukleinsäuren, die aus D-Nukleotiden bestehen, bevorzugterweise vollständig aus D-Nukleotiden bestehen.Accordingly, in particular, D-nucleic acids, as used herein, are nucleic acids consisting of D-nucleotides, preferably consisting entirely of D-nucleotides.
Unabhängig davon, ob die erfindungsgemäße Nukleinsäure aus D-Nukleotiden, L- Nukleotiden oder einer Kombination davon aus beiden besteht, wobei die Kombination, z. B., eine zufällige Kombination oder eine definierte Sequenz aus Bereichen ist, die aus wenigstens einem L-Nukleotid und wenigstens einer D-Nukleinsäure bestehen, kann die Nukleinsäure aus einem oder mehreren Desoxyribonukleotiden, Ribonukleotiden und Kombinationen davon bestehen.Regardless of whether the nucleic acid according to the invention consists of D-nucleotides, L-nucleotides or a combination thereof of both, wherein the combination, for. B., is a random combination or sequence of regions consisting of at least one L-nucleotide and at least one D-nucleic acid, the nucleic acid may consist of one or more deoxyribonucleotides, ribonucleotides, and combinations thereof.
In einem weiteren Aspekt betrifft die vorliegende Erfindung eine pharmazeutische Zusammensetzung, die aus mindestens einer der erfindungsgemäßen Nukleinsäuren in Kombination mit einer oder mehreren anderen Nukleinsäuren besteht, wobei die andere(n) Nukleinsäuren bevorzugterweise an von HMGA-Protein verschiedene Zielmoleküle bindet/binden oder eine von den erfindungsgemäßen Nukleinsäuren verschiedene Funktion ausübt/ausüben.In a further aspect, the present invention relates to a pharmaceutical composition which consists of at least one of the nucleic acids according to the invention in combination with one or more other nucleic acids, wherein the other nucleic acids preferably bind / bind to target molecules other than HMGA protein or one of performs / exercise various functions on the nucleic acids of the invention.
Die Konstruktion der erfindungsgemäßen Nukleinsäuren als L-Nukleinsäure ist aus mehreren Gründen vorteilhaft. L-Nukleinsäuren sind Enantiomere von natürlicher Weise auftretenden Nukleinsäuren. D-Nukleinsäuren sind jedoch in wässrigen Lösungen und insbesondere in biologischen Systemen und in biologischen Proben infolge des umfänglichen Vorhandenseins von Nukleasen nicht sehr stabil. Natürlicherweise auftretende Nukleasen, insbesondere Nukleasen aus tierischen Zellen, sind nicht in der Lage, L-Nukleinsäuren abzubauen. Infolge dessen ist die biologische Halbwertszeit der L-Nukleinsäure in einem derartigen System, einschließlich des menschlichen und tierischen Körpers, signifikant erhöht. Infolge der fehlenden Abbaubarkeit von L-Nukleinsäuren werden keine Nuklease- Abbauprodukte erzeugt und somit werden keine dadurch bedingten Nebenwirkungen beobachtet. Dieser Aspekt grenzt die L- Nukleinsäure von faktisch allen anderen Verbindungen ab, die bei der Therapie von Erkrankungen und/oder Störungen verwendet werden und die Anwesenheit von HMGA oder dessen kausale Involvierung umfassen L-Nukleinsäuren, die spezifisch an ein Zielmolekül durch einen Mechanismus binden, der von dem Watsoη-Crick-Basenpaarung unterschiedlich ist, oder Aptamere, die teilweise oder vollständig aus L-Nukleotiden bestehen, insbesondere wobei jene Teile des Aptamers, die an der Bindung des Aptamers an das Zielmolekül beteiligt sind, werden als Spiegelmere bezeichnet.The construction of the nucleic acids according to the invention as L-nucleic acid is advantageous for several reasons. L-nucleic acids are enantiomers of naturally occurring nucleic acids. However, D-nucleic acids are not very stable in aqueous solutions and especially in biological systems and in biological samples due to the extensive presence of nucleases. Naturally occurring nucleases, especially animal cell nucleases, are unable to degrade L-nucleic acids. As a result, the biological half-life of L-nucleic acid in such a system, including the human and animal body, is significantly increased. Due to the lack of degradability of L-nucleic acids no nuclease degradation products are produced and thus no side effects are observed. This aspect effectively delimits the L-nucleic acid from any other compounds used in the therapy of diseases and / or disorders, and the presence of HMGA or its causal involvement comprises L-nucleic acids that specifically bind to a target molecule through a mechanism, which is different from the Watsoη-Crick base pairing, or aptamers which are partially or fully composed of L-nucleotides, especially those portions of the aptamer involved in the binding of the aptamer to the target molecule are referred to as Spiegelmers.
Es ist auch im Rahmen der vorliegenden Erfindung, dass die erfindungsgemäßen Nukleinsäuren, unabhängig davon, ob sie als D-Nukleinsäuren, L-Nukleinsäuren oder D-L- Nukleinsäuren vorliegen, und ob sie DNA oder RNA sind, als einzelsträngige oder dop- pelsträngige Nukleinsäuren vorhanden sein können. Typischerweise sind die erfindungsgemäßen Nukleinsäuren einzelsträngige Nukleinsäuren, die infolge der Primärsequenz definierte Sekundärstrukturen aufweisen und somit auch Tertiärstrukturen ausbilden können. Die erfindungsgemäßen Nukleinsäuren können jedoch auch doppelsträngig sein in dem Sinne, dass zwei Stränge, die komplementär oder teilweise komplementär zueinander sind, miteinander hybridisiert sind. Dies verleiht den Nukleinsäuren Stabilität, was insbesondere vorteilhaft sein wird, wenn die Nukleinsäure in der natürlicherweise auftretenden D-Form statt der L-Form vorliegt.It is also within the scope of the present invention that the nucleic acids according to the invention, whether they are present as D-nucleic acids, L-nucleic acids or DL-nucleic acids, and whether they are DNA or RNA, are available as single-stranded or double-stranded nucleic acids. pelsträngige nucleic acids may be present. Typically, the nucleic acids according to the invention are single-stranded nucleic acids which, as a consequence of the primary sequence, have defined secondary structures and can thus also form tertiary structures. However, the nucleic acids according to the invention can also be double-stranded in the sense that two strands which are complementary or partially complementary to one another are hybridized with one another. This confers stability to the nucleic acids, which will be particularly advantageous when the nucleic acid is present in the naturally occurring D-form rather than the L-form.
Die erfindungsgemäßen Nukleinsäuren können modifiziert werden. Derartige Modifikationen können einzelne Nukleotide der Nukleinsäure betreffen und sind in der Technik gut bekannt. Beispiele für eine derartige Modifikation sind, unter anderem, beschrieben in Venkatesan N. et al. (2003) Curr Med Chem. Oct;10(19):1973-91; Kusser, W.(2000) J Biotechnol, 74: 27-38; Aurup, H. et al. (1994) Nucleic Acids Res, 22, 20-4; Cummins, L.L. et al, (1995) Nucleic Ac- ids Res, 23, 2019-24; Eaton, B.E. et al. (1995) Chem Biol, 2, 633-8; Green, LS. et al., (1995) Chem Biol, 2, 683-95; Kawasaki, A.M. et al., (1993) J Med Chem, 36, 831-41; Lesnik, E.A. et al., (1993) Biochemistry, 32, 7832-8; Miller, L.E. et al., (1993) J Physiol, 469, 213-43. Eine derartige Modifikation kann beispielhaft ein H-Atom, ein F-Atom oder eine O-CH3-Gruppe oder NH2-Gruppe an der 2'-Position eines einzelnen Nukleotids sein, das in der Nukleinsäure enthalten ist. Darüberhinaus kann die Nukleinsäure gemäß der vorliegenden Erfindung wenigstens ein LNA-Nukleotid umfassen. In einer Ausführungsform besteht die Nukleinsäure gemäß der vorliegenden Erfindung aus LNA-Nukleotiden, bevorzugterweise vollständig aus LN A-Nukleotiden .The nucleic acids according to the invention can be modified. Such modifications may involve single nucleotides of the nucleic acid and are well known in the art. Examples of such modification include, inter alia, described in Venkatesan N. et al. (2003) Curr Med Chem. Oct; 10 (19): 1973-91; Kusser, W. (2000) J. Biotechnol. 74: 27-38; Aurup, H. et al. (1994) Nucleic Acids Res, 22, 20-4; Cummins, LL et al, (1995) Nucleic Acids Res, 23, 2019-24; Eaton, BE et al. (1995) Chem Biol, 2, 633-8; Green, LS. et al., (1995) Chem Biol, 2, 683-95; Kawasaki, AM et al., (1993) J Med Chem, 36, 831-41; Lesnik, EA et al., (1993) Biochemistry, 32, 7832-8; Miller, LE et al., (1993) J Physiol, 469, 213-43. Such a modification may be, for example, an H atom, an F atom or an O-CH 3 group or NH 2 group at the 2 'position of a single nucleotide contained in the nucleic acid. Moreover, the nucleic acid according to the present invention may comprise at least one LNA nucleotide. In one embodiment, the nucleic acid according to the present invention consists of LNA nucleotides, preferably entirely of LN A nucleotides.
In einer Ausführungsform können die Nukleinsäuren gemäß der vorliegenden Erfindung eine mehrteilige Nukleinsäure sein. Eine mehrteilige Nukleinsäure, wie hierin verwendet, ist eine Nukleinsäure, die aus wenigstens zwei Nukleinsäuresträngen besteht. Diese wenigstens zwei Nukleinsäurestränge bilden eine funktionale Einheit, wobei die funktionale Einheit ein Ligand für ein Zielmolekül ist. Die wenigstens zwei Nukleinsäurestränge können von einer der erfindungsgemäßen Nukleinsäuren abgeleitet werden entweder durch Spalten der Nukleinsäure, um zwei Stränge zu erzeugen, oder durch Synthetisieren von einer Nukleinsäure entsprechend einem ersten Teil der erfindungsgemäßen, d. h. Gesamtnukleinsäure, und einer weiteren Nukleinsäure entsprechend dem zweiten Teil der Gesamtnukleinsäure. Es wird anerkannt, dass sowohl die Spaltung als auch die Synthese verwendet werden kann, um eine mehrteilige Nukleinsäure zu erzeugen, wo mehr als die beiden beispielhaft oben beschriebenen Stränge Vorhandensein können. Mit anderen Worten, die wenigstens zwei Nukleinsäurestränge sind bevorzugterweise verschieden von zwei Strängen, die komplementär zueinander sind und miteinander hybridisieren, obwohl eine Komplementarität in einem bestimmten Umfang zwischen den verschiedenen Nukleinsäureteilen bestehen kann.In one embodiment, the nucleic acids according to the present invention may be a multi-part nucleic acid. A multi-part nucleic acid as used herein is a nucleic acid consisting of at least two nucleic acid strands. These at least two nucleic acid strands form a functional unit, wherein the functional unit is a ligand for a target molecule. The at least two strands of nucleic acid can be derived from one of the nucleic acids of the invention either by cleaving the nucleic acid to generate two strands, or by synthesizing one nucleic acid corresponding to a first part of the invention, ie total nucleic acid, and another nucleic acid corresponding to the second part of the total nucleic acid , It is recognized that Both cleavage and synthesis can be used to generate a multi-part nucleic acid where more than the two strands may be present as described above. In other words, the at least two strands of nucleic acid are preferably different from two strands that are complementary to each other and hybridize to each other, although there may be some degree of complementarity between the different nucleic acid parts.
Die vorliegenden Erfinder haben festgestellt, dass die Nukleinsäuren gemäß der vorliegenden Erfindung einen sehr vorteilhaften KD-Wertebereich oder Dissoziationswertebereich und damit eine sehr vorteilhafte Bindungskonstante aufweisen. Ein Beispiel, um die Bindungskonstante zu bestimmen, ist die Verwendung eines Gleichgewichtsanbindungsassay , wie er in Beispiel 1 beschrieben ist.The present inventors have found that the nucleic acids according to the present invention have a very advantageous K D value range or dissociation value range and thus a very advantageous binding constant. An example to determine the binding constant is the use of an equilibrium binding assay as described in Example 1.
Der KD- Wert der erfindungsgemäßen Nukleinsäuren beträgt bevorzugterweise weniger als 1 μM. Ein KD- Wert von etwa ein μM soll für eine nicht-spezifische Bindung einer Nukleinsäure an ein Ziel charakteristisch sein. Wie von den Fachleuten anerkannt werden wird bewegt sich der KD- Wert einer Gruppe von Verbindungen wie beispielsweise der Nukleinsäuren gemäß der vorliegenden Erfindung, innerhalb eines bestimmten Bereiches. Der oben erwähnte KD von etwa 1 μM ist ein bevorzugterer oberer Grenzwert für den KD- Wert. Der bevorzugte untere Grenzwert für den KD von das Zielmolekül bindenden Nukleinsäuren kann etwa pikomolar oder niedriger sein. Es ist im Rahmen der vorliegenden Erfindung, dass die KD- Werte von einzelnen Nukleinsäuren, die an HMGA binden, bevorzugterweise innerhalb dieses Bereiches liegen. Bevorzugte Bereiche können ausgewählt werden, indem eine erste Zahl innerhalb dieses Bereiches ausgewählt wird, und eine zweite Zahl innerhalb dieses Bereiches. Bevorzugte obere Werte sind 0,25 μM, 0,1 μM, bevorzugte untere Werte sind 100 nM, 10 nM, 1 nM und 0,05 nM.The K D value of the nucleic acids according to the invention is preferably less than 1 μM. A K D value of about one μM should be characteristic of non-specific binding of a nucleic acid to a target. As will be appreciated by those skilled in the art, the KD value of a group of compounds such as the nucleic acids according to the present invention will vary within a particular range. The above-mentioned K D of about 1 μM is a more preferred upper limit of the K D value. The preferred lower limit for the KD of the target molecule-binding nucleic acids may be about picomolar or lower. It is within the scope of the present invention that the K D values of individual nucleic acids which bind to HMGA are preferably within this range. Preferred ranges can be selected by selecting a first number within this range and a second number within that range. Preferred upper values are 0.25 μM, 0.1 μM, preferred lower values are 100 nM, 10 nM, 1 nM and 0.05 nM.
Die erfindungsgemäßen Nukleinsäuren binden bevorzugterweise an HMGAIb bei 37° C in Lösung mit einer Dissoziationskonstante KD<20 nM , wie in Beispiel 2 dargestellt.The nucleic acids according to the invention preferably bind to HMGAIb at 37 ° C. in solution with a dissociation constant K D <20 nM, as shown in Example 2.
Die Nukleinsäuren gemäß der vorliegenden Erfindung können eine beliebige Länge aufweisen unter der Voraussetzung, dass sie noch in der Lage sind, an das Zielmolekül zu binden. Es wird in der Technik anerkannt werden, dass bestimmte Längen der Nukleinsäuren gemäß der vorliegenden Erfindung bevorzugt sind. Typischerweise beträgt die Länge zwischen 15 und 120 Nukleotiden. Es wird von den Fachleuten weiterhin anerkannt werden, dass irgendeine ganze Zahl zwischen 15 und 120 eine bevorzugte mögliche Länge für die Nukleinsäuren gemäß der vorliegenden Erfindung ist. Bevorzugterere Bereiche für die Länge der Nukleinsäuren gemäß der vorliegenden Erfindung sind Längen von etwa 20 bis 100 Nukleotiden, etwa 20 bis 80 Nukleotiden, etwa 20 bis 60 Nukleotiden, etwa 20 bis 50 Nukleotiden und etwa 30 bis 50 Nukleotiden.The nucleic acids according to the present invention may be of any length provided that they are still capable of binding to the target molecule. It It will be appreciated in the art that certain lengths of the nucleic acids according to the present invention are preferred. Typically, the length is between 15 and 120 nucleotides. It will be further appreciated by those skilled in the art that any integer between 15 and 120 is a preferred length of potential for the nucleic acids of the present invention. Preferred ranges for the length of the nucleic acids according to the present invention are lengths of about 20 to 100 nucleotides, about 20 to 80 nucleotides, about 20 to 60 nucleotides, about 20 to 50 nucleotides and about 30 to 50 nucleotides.
In einer^Ausführungsform können die erfindungsgemäßen Nukleinsäuren modifiziert vorliegen. Eine besonders bevorzugte Form der Modifizierung ist die PEGylierung. Dabei handelt es sich um die Modifizierung der erfindungsgemäßen Nukleinsäuren durch Kopplung mit Polyethylenglycol (PEG) oder anderer Gruppen.In one embodiment ^ nucleic acids of the invention can be modified. A particularly preferred form of modification is pegylation. This is the modification of the nucleic acids according to the invention by coupling with polyethylene glycol (PEG) or other groups.
Infolge der hohen Stabilität der erfindungsgemäßen Nukleinsäuren, insbesondere in der Aus- führungsförm, dass diese als L-Nukleinsäuren vorliegen, ist eine direkte Gabe der erfindungsgemäßen Nukleinsäuren zur Behandlung eines Patienten, der einer solchen Behandlung bedarf, möglich. Bevorzugterweise werden die erfindungsgemäßen Nukleinsäuren als physiologische Lösung zur lokalen oder systemischen Verabreichung bereitgestellt.As a result of the high stability of the nucleic acids according to the invention, especially in the embodiment that they are present as L-nucleic acids, a direct administration of the nucleic acids according to the invention is possible for the treatment of a patient in need of such treatment. Preferably, the nucleic acids of the invention are provided as a physiological solution for local or systemic administration.
Neben der direkten Verwendung der erfindungsgemäßen Nukleinsäuren zur Behadnlung, Prävention und Diagnostik der hierin beschrieben Erkrankungen kann diese einzeln oder in Kombination mit anderen in einer pharmazeutischen Zusammensetzumng vorliegen bzw. verwendet werden. Die pharmazeutische Zusammensetzung gemäß der vorliegenden Erfindung umfasst somit wenigstens eine der Nukleinsäuren gemäß der vorliegenden Erfindung und bevorzugterweise einen pharmazeutisch akzeptablen Binder. Ein derartiger Binder kann ein jeglicher bekannter oder auf dem Gebiet bekannter Binder sein. Insbesondere ist ein derartiger Binder irgendein Binder, wie er im Zusammenhang mit der Herstellung des Medikaments beschrieben ist, wie hierin offenbart. In einer weiteren Ausführungsform umfasst die pharmazeutische Zusammensetzung ein weiteres pharmazeutisch aktives Agens. Es ist im Rahmen der vorliegenden Erfindung, dass das hierin beschriebene Medikament die pharmazeutische Zusammensetzung darstellt, wie sie hierin beschrieben ist. Bevorzugterweise ist die pharmazeutische Zusammensetzung für die intravenöse Verabreichung. Es ist jedoch auch im Rahmen der vorliegenden Erfindung, dass derartige pharmazeutische Zusammensetzungen intramuskulär, intraperitoneal, oder subkutan verabreicht werden können. Andere Wege der Verabreichung sind per orum oder intranasal, wobei diejenige Verabreichungsart bevorzugt ist, die am wenigsten invasiv ist, unter gleichzeitiger Beibehaltung der Wirksamkeit der pharmazeutischen Zusammensetzung bzw. des pharmazeutisch aktiven Agens.In addition to the direct use of the nucleic acids according to the invention for the treatment, prevention and diagnosis of the diseases described herein, these can be present or used individually or in combination with others in a pharmaceutical composition. The pharmaceutical composition according to the present invention thus comprises at least one of the nucleic acids according to the present invention and preferably a pharmaceutically acceptable binder. Such a binder may be any known or known binder in the art. In particular, such a binder is any binder as described in connection with the preparation of the medicament as disclosed herein. In another embodiment, the pharmaceutical composition comprises another pharmaceutically active agent. It is within the scope of the present invention that the medicament described herein is the pharmaceutical composition as described herein. Preferably, the pharmaceutical composition is for intravenous administration. However, it is also within the scope of the present invention that such pharmaceutical compositions can be administered intramuscularly, intraperitoneally, or subcutaneously. Other routes of administration are oral or intranasal, with the preferred mode of administration being the least invasive, while retaining the efficacy of the pharmaceutical composition or pharmaceutically active agent.
Die erfindungsgemäßen Nukleinsäuren sind bevorzugterweise als solches oder im Zusammenhang mit der erfindungsgemäßen pharmazeutischen- Zusammensetzung in einem pharmazeutisch akzeptablen Lösungsmittel enthalten oder gelöst. Derartige Lösungsmittel sind insbesondere jene, die aus der Gruppe ausgewählt sind, Wasser, physiologische Kochsalzlösung, PBS, oder eine Glukoselösung, insbesondere eine 5% Glukose-Lösung umfasst. Ein derartiger Träger kann, z. B., Wasser, Puffer, PBS, Glucoselösung, bevorzugterweise eine 5% Glukoselösung (iso-osmotisch), Stärke, Zucker, Gelatine oder irgendeine andere akzeptable Trägersubstanz sein. Derartige Träger sind den Fachleuten auf dem Gebiet im allgemeinen bekannt.The nucleic acids of the invention are preferably contained or dissolved as such or in association with the pharmaceutical composition of the invention in a pharmaceutically acceptable solvent. Such solvents are especially those selected from the group consisting of water, physiological saline, PBS, or a glucose solution, especially a 5% glucose solution. Such a carrier can, for. B., water, buffer, PBS, glucose solution, preferably a 5% glucose solution (iso-osmotic), starch, sugar, gelatin or any other acceptable vehicle. Such carriers are generally known to those skilled in the art.
Es ist im Rahmen der vorliegenden Erfindung, dass die pharmazeutische Zusammensetzung mindestens eine der erfindungsgemäßen Nukleinsäuren in ihren verschiedenen Ausfuhrungsformen enthält, einschließlich, aber nicht darauf beschränkt, die Nukleinsäure als Koηjugat, wie hierin beschrieben.It is within the scope of the present invention that the pharmaceutical composition contains at least one of the nucleic acids according to the invention in their various embodiments, including, but not limited to, the nucleic acid as a co-conjugate as described herein.
In einer weiteren Ausfuhrungsform umfasst das Medikament ein weiteres pharmazeutisch aktives Agens. Derartige weitere pharmazeutische aktive Agenzien sind beispielsweise Pro- teasehemmer, Proliferationsinhibitoren und Angiogenesehemmer und/ oder Agenzien die zystostatsich wirken. Alternativ oder zusätzlich ist ein derartiges weiteres pharmazeutisch aktives Agens eine weitere Nukleinsäure gemäß der vorliegenden Erfindung. Alternativ umfasst das Medikament wenigstens eine oder mehrere Nukleinsäuren, die an ein Zielmolekül binden, das von HMGA verschieden ist oder eine Funktion aufweist, die verschieden ist von einer der Nukleinsäuren gemäß der vorliegenden Erfindung. Die pharmazeutische Zusammensetzung gemäß der vorliegenden Erfindung kann für die Behandlung, Diagnose und/oder Prävention einer jeglichen der hierin beschriebenen Erkrankungen oder Störungen verwendet werden.In a further embodiment, the medicament comprises a further pharmaceutically active agent. Such further pharmaceutically active agents are, for example, protease inhibitors, proliferation inhibitors and angiogenesis inhibitors and / or agents which have a cystostatic effect. Alternatively or additionally, such another pharmaceutically active agent is another nucleic acid according to the present invention. Alternatively, the medicament comprises at least one or more nucleic acids that bind to a target molecule other than HMGA or having a function different from any of the nucleic acids of the present invention. The pharmaceutical composition according to the present invention may be used for the treatment, diagnosis and / or prevention of any of the diseases or disorders described herein.
In einem weiteren Aspekt betrifft die vorliegende Erfindung ein Verfahren für die Behandlung eines Lebewesens, das einer derartiger Behandlung bedarf, wobei das Verfahren die Verabreichung einer pharmazeutisch aktiven Menge von wenigstens einer der Nukleinsäuren gemäß der vorliegenden Erfindung umfasst. In einer Ausführungsform leidet das Lebewesen unter einer Erkrankung oder es besteht das Risiko, dass es an einer derartigen Erkrankung erkrankt, wobei die Erkrankung eine jede der hierin offenbarten ist, insbesondere eine jede Erkrankung, die im Zusammenhang mit der Verwendung von einer der Nukleinsäuren gemäß der vorliegenden Erfindung für die Herstellung eines Medikaments beschrieben ist.In a further aspect, the present invention relates to a method of treating a subject in need of such treatment, the method comprising administering a pharmaceutically active amount of at least one of the nucleic acids according to the present invention. In one embodiment, the subject is suffering from or at risk of contracting such a disorder, the disorder being any of those disclosed herein, in particular, any disorder associated with the use of any of the nucleic acids according to the present invention present invention for the preparation of a medicament is described.
Obgleich sich die Verwendung der erfindungsgemäßen Nukleinsäuren bereits aus der oben dargestellten Involvierung der HMGA-Proteine bei den verschiedenen Erkrankungen und Zuständen ergibt, soll auf diesen Aspekt im folgenden zur Veranschaulichung weiter eingegangen werden.Although the use of the nucleic acids according to the invention already results from the above-described involvement of the HMGA proteins in the various diseases and conditions, this aspect will be discussed further below for the purpose of illustration.
HMGA Proteine und deren Gene wurden insbesondere vermehrt mit der Diagnose und Prognose neoplastischer Erkrankungen in Verbindung gebracht und als potentielle Biomarker vorgeschlagen. In gesundem Gewebe ist das Expressionsniveau von HMGA la/b Proteinen sehr niedrig, wenn überhaupt detektierbar. Erhöhte HMGA la/b Proteinexpression ist charakteristisch für den Phänotyp einer Vielzahl von Tumoren und Metastasen unterschiedlichster Krebserkrankungen (Sarhadi et al. 2006, Balcercak et al. 2005, Bliese et al. 2006, Chang et al. 2005, Peters et al. 2005, Sato et al. 2005, Chiappetta et al.2004, Li et al. 2004 , Chuma et al. 2004 , Donato et al. 2004, Czyz et al. 2004, Kettunen et al. 2004, Lee et al. 2004, Chen et al. 2004, Abe et al. 2003, Blacerczak et al. 2003, Flohr et al. 2003 , Masciullo et al. 2003, Nam et al. 2003, Pierantoni et al. 2003). Hohe HMGA-Proteinexpression korreliert signifikant mit einer schlechten Prognose und der Entstehung von Metastasen. Die Detektion des HMGAl a/b Expressionsniveaus in Biopsien und deren histologischen Charakterisierung stellt einen diagnostischen Ansatz zur Früherkennung, Prognose und Identifizierung von neoplastischen Erkrankungen dar, insbesondere den vorstehend dargestellten Erkrankugnen und Zuständen. Des Weiteren ist in der Literatur eine Assoziation von HMGAl Proteinen mit arteriosklerotischen Plaques beschrieben (Schlueter et al. 2005.). HMGAl reguliert CD44, eines der hauptsächlichen Zielgene für die Entstehung von Plaques. Dabei zeigte im Vergleich zum umliegenden Gewebe, dass die betroffene Regionen wie neointimale, vaskuläre glatte Muskelzellen, Makrophagen und neue Blutgefäßen eine starke Expression von HMGAl aufweisen. HMGAl scheint hierbei einer der Mediatoren bei der Entstehung von Plaques zu sein und stellt so ein Zielmolekül für die Diagnostik dar.In particular, HMGA proteins and their genes have been increasingly associated with the diagnosis and prognosis of neoplastic diseases and have been proposed as potential biomarkers. In healthy tissue, the level of expression of HMGA la / b proteins is very low, if detectable at all. Increased HMGA la / b protein expression is characteristic of the phenotype of a variety of tumors and metastases of various cancers (Sarhadi et al., 2006, Balcercak et al., 2005, Bliese et al., 2006, Chang et al., 2005, Peters et al. Sato et al., 2005, Chiappetta et al.2004, Li et al., 2004, Chuma et al., 2004, Donato et al., 2004, Czyz et al., 2004, Kettunen et al., 2004, Lee et al., 2004, Chen et 2004, Abe et al 2003, Blacerczak et al 2003, Flohr et al 2003, Masciullo et al 2003, Nam et al 2003, Pierantoni et al 2003). High HMGA protein expression correlates significantly with poor prognosis and metastatic disease. The detection of the HMGA1a / b expression level in biopsies and their histological characterization represents a diagnostic approach for the early detection, prognosis and identification of neoplastic diseases, in particular the diseases and conditions described above. Furthermore, an association of HMGA1 proteins with arteriosclerotic plaques is described in the literature (Schlueter et al., 2005). HMGA1 regulates CD44, one of the major target genes for plaque formation. In comparison with the surrounding tissue, the affected regions, such as neointimal, vascular smooth muscle cells, macrophages and new blood vessels, show a high expression of HMGA1. HMGA1 seems to be one of the mediators in the development of plaques and thus represents a target molecule for the diagnosis.
Die hier beschriebenen L-Nukleinsäuren und insbesondere die Spiegeimer, die HMGA la/b binden,. - können im Rahmen der dem Fachmann bekannten Methoden ähnlich Antikörpern eingesetzt werden. Bisher sind nur sehr wenig spezifische (differenzierende) und affine Antikörper gegen HMGAl identifiziert worden und kommerziell erhältlich. Dies scheint durch die nicht vorhandene Sekundärstruktur von HMGAl bedingt zu sein, welche kein geeignetes Ziel für den MHC Komplex bei der Generierung von Antikörpern darstellt.The L-nucleic acids described herein, and in particular the spiegelmer, that bind HMGA la / b. - Can be used in the context of the methods known in the art similar to antibodies. So far only very few specific (differentiating) and affine antibodies to HMGA1 have been identified and are commercially available. This seems to be due to the lack of secondary structure of HMGA1, which is not a suitable target for the MHC complex in the generation of antibodies.
Vor diesem Hintergrund konnte hierin überraschenderweise gezeigt werden, dass das biotiny- lierte HMGAl a/b bindende Spiegeimer 5 '-bio-NOX-A50 im Western Blot HMGAl a/b als einzelne Bande in Krebszelllinien erkennt. Des Weiteren konnte - wie in Beispiel 2 beschrieben - rekombinant expremiertes HMGAIb Protein detektiert werden. Die Detektion des bioti- nylierten Spiegeimers erfolgt beispielsweise über einen anti-Biotin Antikörper konjugiert mittels Horse Raddish Peroxidase (HRP).Against this background, it has surprisingly been found here that the biotinylated HMGA1 a / b recognizes baclimeric 5 '-bio-NOX-A50 binding bacteria in the Western blot HMGA1 a / b as a single band in cancer cell lines. Furthermore, as described in Example 2, recombinantly expressed HMGAIb protein could be detected. The detection of the biotinylated spiegelmer is carried out, for example, via an anti-biotin antibody conjugated by means of Horse Raddish Peroxidase (HRP).
Einen weiteren Ansatz stellt in die in-vivo Diagnostik vom HMGA la/b dar, bei der die erfi- undungsgemäßen Nukleinsäuren verwendet werden können. Tumore und Metastasen sind oft eingebettet von nekrotischen Tumorzellen, welche HMGAl a/b in das umliegende Gewebe abgeben. Die Detektion des extrazellulären HMGA la/b- stellt einen Ansatz der Diagnose vom in gesunden Gewebe eingebetteten Tumoren und Metastasen dar.Another approach is the in vivo diagnosis of HMGA la / b, in which the nucleic acids according to the invention can be used. Tumors and metastases are often embedded by necrotic tumor cells, which release HMGA1 a / b into the surrounding tissue. The detection of extracellular HMGA la / b represents an approach to the diagnosis of tumors and metastases embedded in healthy tissue.
Wie bevorzugterweise hierin verwendet ist ein Diagnostikum oder diagnostisches Agens oder diagnostisches Mittel in der Lage, entweder direkt oder indirekt ein HMGA-Protein, bevorzugterweise HMGA la/b, wie hierin beschrieben, nachzuweisen und bevorzugtererweise HMGAla/b, wie hierin beschrieben im Zusammenhang mit den verschiedenen Störungen und Erkrankungen. Das Diagnostikum ist geeignet für den Nachweis und/oder die Nachsorge für eine jegliche der hierin beschriebenen Krankheiten bzw. Erkrankungen. Ein derartiger Nachweis ist möglich durch die Bindung der Nukleinsäuren gemäß der vorliegenden Erfindung an HMGAl a/b. Ein derartiges Binden kann entweder direkt oder indirekt nachgewiesen werden. Die entsprechenden Verfahren und Mittel sind den Fachleuten auf dem Gebiet bekannt. Unter anderem können die Nukleinsäuren gemäß der vorliegenden Erfindung eine Markierung umfassen, die den Nachweis der Nukleinsäuren gemäß der vorliegenden Erfindung erlaubt, bevorzugterweise der Nukleinsäure, die an HMGA-Protein und bevorzugterweise HMGAl a/b gebunden ist oder binden kann. Eine derartige Markierung ist bevorzugterweise ausgewählt aus der Gruppe bestehend aus radioaktiven, enzymatischen und Fluoreszenz-Markierungen. Im Prinzip können alle bekannten Tests, die für Antikörper entwickelt worden sind, für die Nukleinsäuren gemäß der vorliegenden Erfindung angepasst werden, wobei der Zielmolekül- bindende Antikörper durch eine Zielmolekül-bindende Nukleinsäure ersetzt ist. In Antikörper-Tests, die unmarkierte Zielmolekül-bindende Antikörper verwenden, erfolgt der Nachweis bevorzugterweise durch einen Sekundärantikörper, der mit radioaktiven, enzymatischen oder Fluoreszenz-Markierungen modifiziert ist und an den Zielmolekül-bindenden Antikörper an seinem Fc-Fragment bindet. Im Falle einer Nukleinsäure, bevorzugterweise einer Nukleinsäure gemäß der vorliegenden Erfindung, ist die Nukleinsäure mit einer derartigen Markierung modifiziert, wobei bevorzugterweise eine derartige Markierung ausgewählt ist aus der Gruppe bestehend aus Biotin, CY-3 und CY-5, und eine derartige Markierung nachgewiesen wird durch einen Antikörper, der gegen eine derartige Markierung gerichtet ist, z. B. ein anti- Biotin-Antikörper, ein anti-CY-3-Antikörper oder ein anti-CY5-Antikörper oder in dem Fall, dass die Markierung Biotin ist, wird die Markierung durch Streptavidin oder Avidin nachgewiesen, das natürlicherweise an Biotin bindet. Ein derartiger Antikörper, Streptavidin oder Avidin ist wiederum bevorzugterweise mit einer entsprechenden Markierung modifiziert, z. B. einer radioaktiven, enzymatischen oder Fluoreszenz-Markierung, analog einem Sekundärantikörper.As preferably used herein, a diagnostic or diagnostic agent or diagnostic agent is capable of detecting, either directly or indirectly, an HMGA protein, preferably HMGA la / b as described herein, and more preferably HMGAla / b as described herein in connection with U.S. Patent Nos. 4,646,974; different disorders and Diseases. The diagnostic agent is suitable for detection and / or aftercare for any of the diseases or diseases described herein. Such detection is possible by the binding of the nucleic acids according to the present invention to HMGA1 a / b. Such binding can be detected either directly or indirectly. The corresponding methods and means are known to those skilled in the art. Among other things, the nucleic acids according to the present invention may comprise a label which allows the detection of the nucleic acids according to the present invention, preferably the nucleic acid which is bound or capable of binding to HMGA protein and preferably HMGA1 a / b. Such a label is preferably selected from the group consisting of radioactive, enzymatic and fluorescent labels. In principle, any known antibody-engineered assays can be adapted for the nucleic acids of the present invention with the target-binding antibody replaced by a target-molecule-binding nucleic acid. In antibody assays using unlabelled target-binding antibodies, detection is preferably by a secondary antibody modified with radioactive, enzymatic or fluorescent labels and binding to the target-binding antibody on its Fc fragment. In the case of a nucleic acid, preferably a nucleic acid according to the present invention, the nucleic acid is modified with such a label, whereby preferably such a label is selected from the group consisting of biotin, CY-3 and CY-5, and such a label is detected by an antibody directed against such label, e.g. As an anti-biotin antibody, an anti-CY-3 antibody or an anti-CY5 antibody or in the case that the label is biotin, the label is detected by streptavidin or avidin, which binds naturally to biotin. Such an antibody, streptavidin or avidin is in turn preferably modified with a corresponding label, e.g. As a radioactive, enzymatic or fluorescent label, analogous to a secondary antibody.
In einer weiteren Ausführungsform werden die Nukleinsäuren gemäß der vorliegenden Erfindung nachgewiesen oder analysiert durch ein zweites Nachweismittel, wobei das Nachweismittel ein molekularer Leuchtturm (engl, „molecular beacon") ist. Die Technik der molekularen Leuchttürme ist den Fachleuten auf dem Gebiet bekannt. Kurz gesagt sind diese molekularen Leuchttürme Nukleinsäuresonden, die ein reverses Komplement zu der nachzuweisen- den Nukleinsäureprobe sind, und hybridisieren deshalb mit einem Teil der nachzuweisenden Nukleinsäureprobe, die es nachzuweisen gilt. Nach Binden der Nukleinsäureprobe werden die Fluorophorgruppen des molekularen Leuchtturms voneinander getrennt, was zur Änderung des Fluoreszenzsignals fuhrt, bevorzugterweise eine Änderung der Intensität. Diese Änderung korreliert mit der Menge an vorhandener Nukleinsäureprobe.In a further embodiment, the nucleic acids according to the present invention are detected or analyzed by a second detection means, wherein the detection means is a molecular beacon The technique of molecular beacons is known to those skilled in the art these molecular lighthouses are nucleic acid probes that have a reverse complement to the are the nucleic acid sample, and therefore hybridize with a portion of the nucleic acid sample to be detected which is to be detected. After binding the nucleic acid sample, the fluorophore groups of the molecular beacon are separated from each other, resulting in the change of the fluorescence signal, preferably a change in intensity. This change correlates with the amount of nucleic acid sample present.
Es ist im Rahmen der vorliegenden Erfindung, dass die erfindungsgemäßen Nukleinsäuren im Rahmen der verschiedenen hierin offenbarten Aspekte entsprechend als L-Nukleinsäuren verwendet werden können.It is within the scope of the present invention that the nucleic acids according to the invention can be used correspondingly as L-nucleic acids within the scope of the various aspects disclosed herein.
Die erfmdungsgemäßen Nukleinsäuren können weiterhin als Ausgangsmaterial für das Design von pharmazeutischen Wirkstoffen (engl, drug design) verwendet werden. Grundsätzlich gibt es hierzu zwei mögliche Ansätze. Ein Ansatz besteht in dem Screening von Bibliotheken von Verbindungen, wobei derartige Bibliotheken von Verbindungen bevorzugterweise Bibliotheken von niedermolekularen Verbindungen (engl, low oder small molecules) sind. Derartige Bibliotheken sind den Fachleuten auf diesem Gebiet bekannt. In einer Ausführungsform, ist das Screening ein Hochdurchsatzscreening. Bevorzugterweise ist Hochdruchsatzscreening schnell, effizient und wird als Versuch-und-Fehler-Evaluation („Trial-and-Error-Evaluation") von Wirkstoffen in einem Zielmolekül-basierten Assay durchgeführt.The nucleic acids according to the invention can furthermore be used as starting material for the design of pharmaceutical active ingredients (English, drug design). Basically, there are two possible approaches. One approach is to screen libraries of compounds, such libraries of compounds being preferably low molecular weight (small molecule) libraries. Such libraries are known to those skilled in the art. In one embodiment, the screening is high throughput screening. Preferably, high-level screening is fast, efficient, and is performed as a trial-and-error evaluation of drugs in a target-molecule-based assay.
Alternativ können gemäß der vorliegenden Erfindung die Nukleinsäuren für das rationale Design von Wirkstoffen verwendet werden. Bevorzugterweise ist das rationale Design von Wirkstoffen das Design eines pharmazeutischen Wirkstoffkandidaten. Beginnend von der dreidimensionalen Struktur des Zielmoleküls, die üblicherweise durch Methoden wie Röng- tenstrukturanalyse oder Magnetresonanzspektroskopie (NMR = nuclear magnetic resonance spectroscopy) bestimmt wird, werden Computerprogramme verwendet, um Datenbanken mit Strukturen einer Vielzahl verschiedener chemischer Verbindungen zu durchsuchen. Die Auswahl wird dabei von dem Computer durchgeführt. Die ausgewählten Verbindungen werden zusätzlich im Labor getestet.Alternatively, according to the present invention, the nucleic acids can be used for the rational design of drugs. Preferably, the rational design of drugs is the design of a pharmaceutical drug candidate. Starting from the three-dimensional structure of the target molecule, which is usually determined by methods such as X-ray analysis or nuclear magnetic resonance spectroscopy (NMR), computer programs are used to search databases with structures of a variety of different chemical compounds. The selection is carried out by the computer. The selected compounds are additionally tested in the laboratory.
Das rationale Design von Wirkstoffen kann dabei seinen Ausgangspunkt von irgendeiner der Nukleinsäuren gemäß der vorliegenden Erfindung nehmen und umfaßt eine Struktur, insbesondere eine dreidimensionale Struktur, die ähnlich der Struktur der erfindungsgemäßen Nuk- leinsäure(n) ist oder identisch ist zu dem Teil der Struktur der erfindungsgemäßen Nuklein- säure(n), die die Bindung an HMG-Proteine vermittelt. In einem jeden Fall zeigt eine derartige Struktur noch das gleiche oder ein zumindest ähnliches Bindungsverhalten, wie die erfin- dungsgemäße(n) Nukleinsäure(n). In entweder einem weiteren Schritt oder als ein alternativer Schritt wird bei dem rationalen Design von Wirkstoffen die bevorzugterweise dreidimensionale Struktur jener Teile der an HMG-Proteine bindenden Nukleinsäuren durch chemische Gruppen nachgeahmt, die bevorzugterweise verschieden sind von Nukleotiden und Nukleinsäuren. Durch dieses Nachahmen, auch als Mimikry bezeichnet, kann eine Verbindung konstruiert werden, die von der Nukleinsäure bzw. den Nukleinsäuren verschieden ist, die als Ausgangsmaterialien für das rationale Design des Wirkstoffes verwendet wurde. Eine derartige Verbindung oder Wirkstoff ist bevorzugterweise ein kleines Molekül (engl, small molecu- Ie) oder ein Peptid.The rational design of active ingredients may here be based on any of the nucleic acids according to the present invention and comprises a structure, in particular a three-dimensional structure, which is similar to the structure of the nucleated nucleic acid according to the invention. Liche acid (s) is or is identical to that part of the structure of the nucleic acid (s) of the invention, which mediates the binding to HMG proteins. In any case, such a structure still shows the same or at least a similar binding behavior as the nucleic acid (s) according to the invention. In either a further step, or as an alternative step, in the rational design of drugs, the preferably three-dimensional structure of those parts of the HMG protein-binding nucleic acids is mimicked by chemical groups, which are preferably different from nucleotides and nucleic acids. By this mimic, also referred to as mimicry, a compound can be constructed which is different from the nucleic acid or nucleic acids used as starting materials for the rational design of the active ingredient. Such a compound or drug is preferably a small molecule (Engl., Small molecule) or a peptide.
Im Falle des Screenings von Verbindungsbibliotheken unter Verwendung kompetitiver Tests, die den Fachleuten auf dem Gebiet bekannt sind, können geeignete HMG-Analoga, HMG- Agonisten und HMG-Antagonisten gefunden werden. Derartige kompetitive Assays können wie folgt aufgebaut sein. Die erfindungsgemäße Nukleinsäure, bevorzugterweise ein Spiegeimer, d. h. eine das Zielmolekül bindende L-Nukleinsäure, wird an eine bevorzugterweise feste Phase gekoppelt. Um HMG-Analoga zu identifizieren, wird mit einer Markierung versehenes HMG-Protein zu dem Testsystem hinzugegeben. Alternativ könnte auch das HMG- Protein an eine feste Phase gekoppelt werden und die erfindungsgemäße Nukleinsäure könnte markiert sein. Ein potentielles Analogon bzw. ein potentieller Agonist oder Antagonist würde mit den HMG-Molekülen, die an das Spiegeimer binden, kompetitieren, was mit einer Abnahme des Signals, das von der entsprechenden Markierung erhalten wird, einhergehen würde. Das Screenen auf Agonisten oder Antagonisten kann die Verwendung eines Zellkultur- Testsystems umfassen, das den Fachleuten auf dem Gebiet bekannt ist.In the case of screening of compound libraries using competitive assays known to those skilled in the art, appropriate HMG analogs, HMG agonists, and HMG antagonists can be found. Such competitive assays can be constructed as follows. The nucleic acid according to the invention, preferably a spiegelmer, d. H. an L-nucleic acid binding the target molecule is coupled to a preferably solid phase. To identify HMG analogs, labeled HMG protein is added to the test system. Alternatively, the HMG protein could also be coupled to a solid phase and the nucleic acid according to the invention could be labeled. A potential analogue or potential agonist or antagonist would compete with the HMG molecules that bind to the spiegelmer, which would be accompanied by a decrease in the signal obtained from the corresponding label. Screening for agonists or antagonists may involve the use of a cell culture assay system known to those skilled in the art.
In einem weiteren Aspekt können die erfindungsgemäßen Nukleinsäuren infolge ihres charakteristischen Bindungsverhaltens an HMG-Protein für die Targetvalidierung („Target" ist englisch für „Zielmolekül") verwendet werden. Die erfindungsgemäßen Nukleinsäuren können in einem ex vivo-Organmodell verwendet werden, um die Funktion von HMG-Protein zu studieren. Grundsätzlich existieren ex vivo Modelle, in denen HMG- Agonisten/ Antagonisten getestet werden können. Ein Kit gemäß der vorliegenden Erfindung kann wenigstens eine oder mehrere der erfindungsgemäßen Nukleinsäuren umfassen. Zusätzlich kann der Kit wenigstens eine oder mehrere Positiv- oder Negativkontrollen umfassen. Als Positivkontrollen kann z. B. HMG-Protein verwendet werden, gegen das die erfindungsgemäße Nukleinsäure gescreent wurde, oder an die diese bindet, bevorzugterweise in flüssiger Form. Als Negativkontrolle kann unter anderem ein Peptid verwendet werden, welches sich hinsichtlich seiner biophysikalischen Eigenschaften ähnlich wie HMG-Protein verhält, welches jedoch nicht durch die erfindungsgemäßen Nukleinsäuren erkannt wird oder ein Peptid mit gleicher Aminosäurezusammensetzung aber von HMG-Protein verschiedener Sequenz.In a further aspect, the nucleic acids according to the invention can be used owing to their characteristic binding behavior to HMG protein for the target validation ("target" is English for "target molecule"). The nucleic acids of the invention can be used in an ex vivo organ model to study the function of HMG protein. Basically ex vivo models exist in which HMG agonists / antagonists can be tested. A kit according to the present invention may comprise at least one or more of the nucleic acids of the invention. In addition, the kit may include at least one or more positive or negative controls. As positive controls can z. For example, HMG protein against which the nucleic acid of the invention has been screened or to which it binds, preferably in liquid form, may be used. As a negative control, among other things, a peptide can be used, which behaves in terms of its biophysical properties similar to HMG protein, which is not recognized by the nucleic acids of the invention or a peptide with the same amino acid composition but of HMG protein of different sequence.
Weiterhin kann der Kit einen oder mehrere Puffer umfassen. Die verschiedenen Bestandteile können in dem Kit in trockener oder lyophilisierter Form, oder gelöst in einer Flüssigkeit vorliegen. Der Kit kann eine oder mehrere Behältnisse umfassen, die wiederum ein oder mehrere der Bestandteile des Kits enthalten können. Bevorzugterweise enthalten die Gefäße Reaktionsansätze, wie sie für eine einmalige Durchführung eines Experimentes unter Verwendung einer oder mehrerer Bestandteile des Kits erforderlich sind.Furthermore, the kit may comprise one or more buffers. The various ingredients may be present in the kit in dry or lyophilized form, or dissolved in a liquid. The kit may include one or more containers, which in turn may contain one or more of the components of the kit. Preferably, the vessels contain reaction mixtures as required for a one-time experiment using one or more components of the kit.
Es wird anerkannt werden, dass, sofern nicht gegenteiliges angegeben ist, die hierin angeführten Sequenzen in 5 '-3 '-Richtung angegeben sind. Weiterhin wird anerkannt werden, dass der Begriff, das zwei Abschnitt miteinander hybridisieren, hierin so verstanden wird, dass die Abschnitte in vitro aufgrund von allgemeinen Basenpaarungsregeln hybridisieren können, oder dass die Abschnitte unter den Bedingungen der Anwendung hybridisieren oder hybridisieren können, jedoch nicht notwendigerweise miteinander unter den Bedingungen der Anwendung hybridisiert sind bzw. hybridisiert vorliegen.It will be appreciated that unless stated otherwise, the sequences set forth herein are in the 5 '-3' direction. Further, it will be appreciated that the term "hybridizing" the two sections is understood herein to mean that the sections can hybridize in vitro due to general base pairing rules, or that the sections can hybridize or hybridize under the conditions of use, but not necessarily together are hybridized or hybridized under the conditions of use.
Die verschiendenen SEQ.ID., der chemische Aufbau der Nukleinsäuren wie hierin offenbart und das Zielmolekül HMGA Ia/ Ib wie hierin verwendet, die tatsächlichen Sequenzen und die interne Referenz sind in der folgenden Tabelle zusammengefasst. The various SEQ.ID.s, the chemical structure of the nucleic acids as disclosed herein and the target molecule HMGA Ia / Ib as used herein, the actual sequences and the internal reference are summarized in the following table.
Es ist im Rahmen der vorliegenden Erfindung, dass, sofern für die einzelnen Abschnitte der erfindungsgemäßen Nukleinsäuren keine Sequenzen explizit angegeben sind, diese gemäß der hierin offenbarten technischen Lehre frei gewählt werden können, d. h. so gewählt werden können, dass sie das erforderliche Bindungsverhalten an das jeweilige Zielmolekül zeigen und/oder die hierin beschriebenen Strukturen, insbesondere Sekundärstrukturen auszubilden in der Lage sind.It is within the scope of the present invention that, provided that no sequences are explicitly specified for the individual sections of the nucleic acids according to the invention, they can be freely selected according to the technical teaching disclosed herein, d. H. can be chosen so that they show the required binding behavior to the respective target molecule and / or the structures described herein, in particular secondary structures are able to form.
Weiterhin ist es im Rahmen von bevorzugten Ausführungsformen der vorliegenden Erfindung, dass für den Fall, dass in Sequenzen, die als RNA-Sequenzen bezeichnet werden, T statt U angegeben sind, T für U stehen soll.Furthermore, it is within the scope of preferred embodiments of the present invention that in the event that in sequences which are referred to as RNA sequences, T are given instead of U, T should stand for U.
Die vorliegende Erfindung wird weiter anhand der folgenden Figuren und Beispiele erläutert, aus denen sich weitere Merkmale, Ausfuhrungsformen und Vorteile ergeben. Dabei zeigtThe present invention will be further explained with reference to the following figures and examples, from which further features, embodiments and advantages will be apparent. It shows
Fig. IA durch in vitro Selektion gegen D-21AS-HMGAla/b erzeugte Aptamere, die die 21 AS-HMGAl a/b-Domäne binden;FIG. 1A shows aptamers generated by in vitro selection against D-21AS-HMGAla / b, which bind the 21 AS-HMGA1a / b domain; FIG.
Fig. IB eine Darstellung der identifizierten, wiederholt auftretenden Sequenzbereiche der durch in vitro Selektion gegen D-2 IAS -HMGA la/b erzeugten Aptamere, die die 2 IAS- HMGAla/b-Domäne binden;Figure 1B is a representation of the identified recurring sequence regions of the aptamers produced by in vitro selection against D-2 IAS -HMGA la / b, which bind the 2 IAS-HMGAla / b domain;
Fig. 2 einen Sequenzvergleich von HMGAl a/b und HMGA2;FIG. 2 shows a sequence comparison of HMGA1 a / b and HMGA2; FIG.
Fig.3 eine Verkürzung von HMGA 1 a/b-bindendem Aptamer NOX- f;FIG. 3 shows a truncation of HMGA 1 a / b-binding aptamer NOX-f;
Fig. 4 die Bindungseigenschaften von verkürzten HMGAl a/b-bindendem Aptamer NOX-f; Fig. 5 einen Kompetitionsassay zur Messung der Bindung von HMGA an die doppelsträngi- ge natürliche Ziel-DNA im Multiwellplatten-Assay; die Bindung des Spiegeimers kompetiert mit der Bindung des rekombinanten HMGAIb an die biotinylierte dsDNA (AT-hook Motiv). Die Detektion des gebundenen HMGAIb erfolgt über den His-Tag per Nickel-HRP, welche ein Substrat in fluoreszierendes Signal umsetzt; Fig. 6 einen Vergleich von Spiegeimer NOX-A und Spiegelmmer NOX-f (48nt; 33nt) im kompetitiven Multiwellplatten-Assay; Spiegeimer NOX-A, sowie Spiegeimer NOX-f und dessen verkürzte Variante Spiegeimer NOX-D3 verhindern im Plattenassay die Bindung von rekombinaten HMGAIb an seinen natürlichen vorkommenden Bindungspartner im niedrig nanomolaren Bereich.Figure 4 shows the binding properties of truncated HMGA1 a / b binding aptamer NOX-f; 5 shows a competition assay for measuring the binding of HMGA to the double-stranded natural target DNA in the multiwell plate assay; the binding of the spiegelmer competes with the binding of the recombinant HMGAIb to the biotinylated dsDNA (AT-hook motif). The detection of the bound HMGAIb via the His-tag via nickel-HRP, which converts a substrate into a fluorescent signal; Figure 6 is a comparison of spiegelmer NOX-A and spiegelmer NOX-f (48nt; 33nt) in the competitive multiwell plate assay; Spiegelmer NOX-A, as well as Spiegeimer NOX-f and its shortened version Spiegeimer NOX-D3 in the plate assay prevent the binding of recombinant HMGAIb to its natural occurring binding partner in the low nanomolar range.
Fig. 7 die Aktivität von 2kDa-PEG-gekoppeltem Spiegeimer NOX-A sowie nichtfunktionalem Kontrollspiegelmer im kompetitiven Multiwellplatten-Assay; das PEGylierte Spiegeimer NOX-A kompetiert die Bindung von rekombinantem HMGAIb an das AT-Hook- Motiv der dsDNA mit einer IC50 von 15nM; das inverse Kontroll-Spiegelmer von NOX-A zeigt bei hohen Spiegeimerkonzentrationen eine unspezifische Interaktion mit HMGAIb;Figure 7 shows the activity of 2kDa PEG-coupled spiegelmer NOX-A and non-functional control mirror mer in the competitive multiwell plate assay; the PEGylated spiegelmer NOX-A competes with the binding of recombinant HMGAIb to the AT-hook motif of the dsDNA with an IC50 of 15nM; the inverse control spiegelmer of NOX-A exhibits a nonspecific interaction with HMGAIb at high spiegelmer concentrations;
Fig. 8 eine Western Blot; Nachweis von immobilisiertem HMGAIb durch biotinyliertes Spiegeimer; rekombinantes HMGAIb wandert im elektrophoretischen Feld wie ein 2OkDa großes Protein und kann bei niedrigen Konzentrationen (3nM) durch das biotinylierte Spiegeimer (hier am Beispiel von NOX-A) erkannt werden; ein inverses Kontroll Spiegeimer konnte HGMGAIb nicht erkennen;Fig. 8 is a Western blot; Detection of immobilized HMGAIb by biotinylated spiegelmer; recombinant HMGAIb migrates in the electrophoretic field like a 2OkDa protein and can be detected at low concentrations (3nM) by the biotinylated spiegelmer (here by the example of NOX-A); an inverse control spiegelmer could not detect HGMGAIb;
Fig. 9: die Aktivität von freiem und PEGyliertem Spiegeimer NOX-A im kompetitiven Multiwellplatten-Assay;Figure 9 shows the activity of free and PEGylated spiegelmer NOX-A in the competitive multiwell plate assay;
Fig. 10: eine Untersuchung der Verpackung von PEGyliertem Spiegeimer in Mizellen im "RiboGreen exclusion assay";FIG. 10: an examination of the packaging of PEGylated spiegelmer in micelles in the "RiboGreen exclusion assay";
Fig. 11 die Stabilität von PEI-Spiegelmer-Mizellen im "RiboGreen exclusion assay";FIG. 11 shows the stability of PEI spiegelmer micelles in the "RiboGreen exclusion assay"; FIG.
Fig. 12 die effiziente Aufnahme von in PEI-Mizellen verpacktem Spiegeimer, genauer einen Vergleich der Transfektion von „nacktem" Spiegeimer im Vergleich zu in Mizellen verpackten Spiegelmeren am Beispiel von Spiegeimer NOX-A-3'PEG2kDa.; die Zellen die mit Spiegeimer-Mizellen transfiziert wurden, zeigten bei geringerer Einstellung der Sensitivi- tät der Kamera (camera gain) eine stärkere Fluoreszenz im Zytosol verglichen mit Zellen die nur mit reinem Spiegeimer inkubiert wurden; die Effizienz lag bei beiden Transfektions- methoden bei >95%; Fig. 13 die Freisetzung von Spiegeimer aus dem endosomalen Kompartiment; Spiegeimer Mizellen zeigten eine deutlich höhere Fluoreszenz im Vergleich zu reinem Spiegeimer; Spiegelmer-Mizellen zeigten ein punktuelles perinukleäres, sowie zytoplasmatisches Verteilungsmuster; die punktuelle Verteilung weist auf eine Lokalisation in endosomalen Kompartimenten hin; die diffuse Verteilung im Zytosol und an der Plasmamembran deutet auf aus Endosomen freigesetztes Spiegeimer hin;12 shows the efficient uptake of PEI micellar-packed spiegelmer, more precisely a comparison of the transfection of "naked" spiegelmer compared to micellar-packed spiegelmer using the example of spiegelmer NOX-A-3'PEG2kDa; Micelles were transfected, with a lower camera sensitivity setting, cytoplasmic fluorescence was more potent than cells incubated with pure spiegelmer, with efficiencies of> 95% in both transfection methods; Fig. 13 shows the release of spiegelmer from the endosomal compartment; Spiegelmer micelles showed a significantly higher fluorescence compared to pure spiegelmer; Spiegelmer micelles showed a selective perinuclear and cytoplasmic distribution pattern; the punctual distribution indicates a localization in endosomal compartments; the diffuse distribution in the cytosol and on the plasma membrane indicates spiked liberated from endosomes;
Fig. 14 einen Proliferationsassay mit "nacktem" Spiegeimer; dosisabhängige Hemmung der Proliferation von MCF-7 Zellen bei hohen Spiegeimerkonzentrationen nach 2 Tagen im Zellkulturmedium (Quantifizierung über Resazurin);FIG. 14 shows a proliferation assay with a "naked" spiegelmer; FIG. dose-dependent inhibition of the proliferation of MCF-7 cells at high levels of spiegelime after 2 days in the cell culture medium (quantitation via resazurin);
Fig. 15 die Proliferation von H1299-Zellen ("non-small cell lung Cancer") nach Behandlung mit PEI-verpacktem NOX-A-2kDa PEG; Hemmung der Proliferation von H- 1299 Zellen bei 1 μM Spiegeimer, appliziert als PEI-Spiegelmer-Mizellen (N/P 2,5); NOX-A zeigte eine geringe Hemmung der Proliferation im Vergleich zum Kontroll-Spiegelmer ;FIG. 15 shows the proliferation of non-small cell lung cancer (H1299) cells after treatment with PEI-packed NOX-A-2kDa PEG; Inhibition of proliferation of H-1299 cells with 1 μM spiegelmer administered as PEI spiegelmer micelles (N / P 2.5); NOX-A showed a slight inhibition of proliferation compared to the control spiegelmer;
Fig. 16 die Inhibierung der HMGAl a/b-induzierten cdc25a-Genexpression, nachgewiesen durch quantitative RT-PCR; Bestimmung der spezifischen Hemmung der cdc25a mRNA Expression in H-1299 Zellen durch lμM NOX-A Spiegelmer-Mizellen (N/P 2,5) mittels RT-PCR;FIG. 16 shows the inhibition of HMGA1a / b-induced cdc25a gene expression as detected by quantitative RT-PCR; Determination of specific inhibition of cdc25a mRNA expression in H-1299 cells by lμM NOX-A Spiegelmer micelles (N / P 2.5) by means of RT-PCR;
Fig. 17 Dosisabhängige Inhibition der cdc25a mRNA-Expression durch SpiegeimerFig. 17 Dose-dependent inhibition of cdc25a mRNA expression by spiegelmer
NOX-A; Quantifizierung der Dosis-abhängigen Hemmung der cdc25a mRNA Expression in Hl 299 Zellen mittels RT-PCR; NOX-A Spiegelmer-Mizellen (N/P 2,5) zeigten ab 25OnM eine spezifische Hemmung der cdc25a mRNA Expression; bei einer Konzentration >4μM zeigte sich ein unspezischer Effekt des Kontroll-Spiegelmers, sowie toxische Effekte des Po- lyethylenimins (PEI) bei > lOμM (Daten nicht gezeigt);NOX-A; Quantification of the dose-dependent inhibition of cdc25a mRNA expression in HI 299 cells by RT-PCR; NOX-A Spiegelmer micelles (N / P 2.5) showed a specific inhibition of cdc25a mRNA expression after 25OnM; at a concentration> 4 μM, an unspecific effect of the control spiegelmer and toxic effects of polyethylenimine (PEI) at> 10 μM were shown (data not shown);
Fig. 18 die Hemmung des Tumorwachstums im Xenograft-Modell in Nacktmäusen durch das Spiegeimer NOX-A; Inhibition des Tumorwachstums nach subkutaner Injektion von PSN-I Zellen durch 2mg/kg Spiegelmer-Mizellen (N/P 2,5). Spiegeimer NOX-A zeigte eine deutliche Reduktion des Tumorwachstums; Fig. 19 die statistische Analyse der Daten aus dem Xenograft- Versuchs; Inhibition desFig. 18 shows the inhibition of tumor growth in the xenograft model in nude mice by the spiegelmer NOX-A; Inhibition of tumor growth after subcutaneous injection of PSN-I cells by 2 mg / kg spiegelmer micelles (N / P 2.5). Spiegelmer NOX-A showed a significant reduction of tumor growth; FIG. 19 shows the statistical analysis of the data from the xenograft experiment; FIG. Inhibition of the
Tumorwachstums nach subkutaner Injektion von PSN-I Zellen durch 2mg/kg Spiegelmer- Mizellen (N/P 2,5); Endpunktanalyse und Darstellung als Box-andWhisker-plot. NOX-A bewirkte eine hoch signifikante Verringerung des Tumorwachstums (p=0,0098 gegenüber PBS und p=0,022 gegenüber inversem Kontroll-Spiegelmer);Tumor growth after subcutaneous injection of PSN-I cells by 2mg / kg spiegelmer micelles (N / P 2.5); Endpoint analysis and presentation as box and whisker plot. NOX-A produced a highly significant reduction in tumor growth (p = 0.0098 versus PBS and p = 0.022 versus inverse control spiegelmer);
Fig. 20: die Gewebeverteilung von Spiegeimer NOX-A im Xenograft-Versuch; quantitative Analyse der Verteilung von Spiegeimer NOX-A in Plasma und Geweben; Im Tumorgewebe war im Vergleich zu den anderen Geweben und Plasma eine hohe Konzentration an Spiegeimer NOX-A nachweisbar.FIG. 20: the tissue distribution of spiegelmer NOX-A in the xenograft experiment; FIG. quantitative analysis of the distribution of spiegelmer NOX-A in plasma and tissues; In the tumor tissue, a high concentration of spiegelmer NOX-A was detectable compared to the other tissues and plasma.
Fig. 21 : Gewebeverteilung von in Mizellen verpacktem und unverpacktem SpiegeimerFig. 21: Tissue distribution of micellar packaged and unpacked spiegelmer
24 und 96 Stunden nach der letzten Injektion im Xenograft-Versuch; quantitative Analyse der Verteilung eines unfunktionalen Spieglemers in Plasma und Geweben; im Tumorgewebe war im Falle eines in Mizellen verpackten Spiegeimers im Vergleich zu den anderen Geweben und Plasma eine deutlich erhöhte Konzentration an Spiegeimer sowohl nach 24 als auch nach 96 Stunden nachweisbar.24 and 96 hours after the last injection in the xenograft trial; quantitative analysis of the distribution of an unfunctional splitter in plasma and tissues; In tumor tissue, in the case of a micellar-packed spiegelmer, a significantly increased concentration of spiegelmer was detectable at both 24 and 96 hours compared to the other tissues and plasma.
Fig. 22: Verteilung von in Mizellen verpacktem und unverpacktem Spiegeimer imFig. 22: Distribution of micropacked and unpacked spiegelmer in
Plasma und im Tumor 24 und 96 Stunden nach der letzten Injektion im Xenograft-Versuch; quantitative Analyse der Verteilung eines unfunktionalen Spieglemers in Plasma und Tumor; Im Tumorgewebe war im Falle eines in Mizellen verpackten Spiegeimers im Vergleich zu unverpackten Spiegeimers eine deutlich erhöhte Konzentration an Spiegeimer sowohl nach 24 als auch nach 96 Stunden nachweisbar. Beispiel 1: HMGAl a/b-bindende SpiegelmerePlasma and in the tumor 24 and 96 hours after the last injection in the xenograft experiment; quantitative analysis of the distribution of a non functional Spieglemer in plasma and tumor; In the tumor tissue, in the case of a micellar packed spiegelmer, a significantly increased concentration of spiegelmer was detectable at both 24 and 96 hours compared to unpacked spiegelimers. Example 1: HMGA1 a / b-binding Spiegelmers
1.1 HMGAl a/b-bindende Sequenzen1.1 HMGA1 a / b-binding sequences
Die HMGAl a/b-bindenden RNA-Spiegelmere wurden durch in vitro Selektion gegen D-21 AS-HMGAl a/b und nachfolgende Verkürzungschritte generiert. Die erzeugten Aptame- re, die die 21 AS-HMGA la/b-Domäne binden, sind in Fig. IA dargestellt.The HMGAI a / b-binding RNA spiegelmers were generated by in vitro selection against D-21 AS-HMGAl a / b and subsequent truncation steps. The generated aptameres that bind the 21 AS-HMGA la / b domain are shown in FIG. 1A.
1.1.1 Ranking auf Aptamerebene1.1.1 Aptamer-level ranking
Die unterschiedlichen Klone (siehe Fig . IA) wurden als Aptamere (D-RNA) mittels Stan- dard-Phosphoramidit-Synthese hergestellt und am 5 '-Ende durch Kinasierung radioaktiv markiert (siehe unten). Die Klone wurden anschließend bei zwei Konzentrationen an D-bio-21aa HMGAl a/b mittels Gleichgewichtsanbindungsassay hinsichtlich Ihrer Affinität und Aktivität analysiert.The different clones (see FIG. 1A) were prepared as aptamers (D-RNA) by standard phosphoramidite synthesis and radioactively labeled at the 5 'end by kinasing (see below). The clones were then analyzed for their affinity and activity at two concentrations of D-bio-21aa HMGA1 a / b by equilibrium binding assay.
Radioaktive Markierung durch Kinasierung:Radioactive labeling by kinase:
Substanz [final]Substance [final]
RNA 5 μMRNA 5 μM
T4 Forward Reaction Buffer (Invi trogen) IxT4 Forward Reaction Buffer (Invitrogen) Ix
T4 Polynucleotide Kinase (Invi trogen) 10 U/ 10 μlReaktionsansatzT4 Polynucleotide Kinase (Invitrogen) 10 U / 10 μl Reaction Batch
[Y-32P]-ATP 1 μl/10 μlReaktionsansatz[Y- 32 P] -ATP 1 μl / 10 μl reaction
Die Reaktion lief für eine Stunde bei 370C und wurde dann durch Erhitzen (10 min bei 65°C) gestoppt. Die Abtrennung radioaktiver Nukleotide von markierten Oligonukleotiden erfolgte über eine analytische Polyacrylamid-Gelelektrophorese (PAGE) (siehe folgend). Danach erfolgte eine „Crush-and-Soak"-Gel-Elution mit Ammoniumacetat und eine Ethanolfällung (siehe folgend). Die Menge der aufgereinigten RNA wurde über die Radioaktivtät des Pellets (nach der Fällung) im Verhältnis zur Radiokativität der ausgeschnittenen Bande abgeschätzt.The reaction was carried out for one hour at 37 0 C and was then stopped by heating (10 min at 65 ° C). The separation of radioactive nucleotides from labeled oligonucleotides was carried out by analytical polyacrylamide gel electrophoresis (PAGE) (see below). Then a crush-and-soak gel elution with ammonium acetate and an ethanol precipitation (see below) .The amount of purified RNA was estimated by the radioactivity of the pellet (after precipitation) relative to the radioactivity of the excised band.
PolyacryΙamid-Gelelektrophorese (PAGE)Polyacrylamide gel electrophoresis (PAGE)
Zur präparativen Reinigung von Oligonukleotiden wurden den Reaktionsansätzen 14 bis 2 Volumina konzentrierten Probenpuffers für denaturierende PAGE hinzugefügt. Zusätzlich wurden bei Bedarf Größenstandards vorbereitet (je 250 pmol) und in Probenpuffer aufge- nommen. Die Ansätze wurden 5 min bei 950C denaturiert und auf Eis abgekühlt. Ein präpara- tives, denaturierendes 7 %iges oder 10 %iges PAA-GeI (20O x 20O x 1,5 mm) wurde durch Anlegen der Spannung von maximal 600 V bei 40-50 W vortemperiert (ca. 1 h). Nach Spülen der Taschen mit Ix TBE wurden die Proben aufgetragen. Nach Abschluß der Trennung (50 min bei 50 W) wurde das Gel auf eine durch Klarsichtfolie geschützte, fluoreszierende Dünnschicht-Chromatographie-Platte (Farbstoff 60F254) gelegt. Mittels UV-Licht (254 nm) konnten die Banden als Schatten visualisiert werden („UV-Shadowing") und mit einem Skalpell ausgeschnitten werden. Danach erfolgte eine „Crush-and-Soak"-Gel-Elution mit Ammo- niumacetat.For preparative purification of oligonucleotides, 14 to 2 volumes of denatured PAGE concentrated sample buffer were added to the reactions. In addition, size standards were prepared as needed (250 pmol each) and stored in sample buffers. accepted. The mixtures were denatured at 95 ° C. for 5 min and cooled on ice. A preparative, denaturing 7% or 10% PAA gel (20 × 20 × 1.5 mm) was pre-tempered by applying the voltage of maximum 600 V at 40-50 W (about 1 h). After rinsing the bags with Ix TBE, the samples were applied. After completion of the separation (50 minutes at 50 W), the gel was placed on a clear film-protected fluorescent thin-layer chromatography plate (Dye 60F 254 ). Using UV light (254 nm), the bands could be visualized as shadows ("UV shadowing") and cut out with a scalpel, followed by "crush-and-soak" gel elution with ammonium acetate.
„Crush-and-Soak"-Gel-Elution"Crush-and-soak" gel elution
Zur Elution von Oligonukleotiden aus PAA-Gelen wurde nach Zerkleinerung der ausgeschnittenen PAA-Gel-Banden mit einer Pipettenspitze oder einem Spatel 500 μl Ammoniumacetat (2 M) zugegeben. Die „Crush-and-Soak"-Elution wurde 2 x 1,5 h bei 680C in einem Thermo- schüttler (1000 U/min) durchgeführt. Die Überstände wurden durch „Ultrafree-MC-Säulchen (Millipore/Amicon, Schwalbach, Germany) in einer Tischzentrifuge (16.100 x g) von Gelresten befreit. Die so eluierte RNA wurde dann mittels einer Ethanolfällung entsalzt.For elution of oligonucleotides from PAA gels, 500 μl ammonium acetate (2 M) was added after chopping the excised PAA gel bands with a pipette tip or spatula. The "crush-and-soak" elution was 2 x 1.5 h at 68 0 C in a thermal shaker (1000 U / min) is performed. The supernatants were "Ultrafree-MC-small columns (Millipore / Amicon, Schwalbach , Germany) in a tabletop centrifuge (16,100 xg) of gel residues.The thus eluted RNA was then desalted by means of an ethanol precipitation.
Ethanolfällungethanol precipitation
Zur Ethanolfällung wurden 1-2 μl Glycogen als Fällungshilfsmittel eingesetzt. Nach Zugabe von 2,5 Volumen absoluten Ethanols und „Vortexen" wurden die Oligonukleotide 30 min bei -800C gefällt und 30 min bei 16.100 x g, 4°C abzentrifugiert. Das Pellet wurde Ix mit 70 %igem Ethanol gewaschen und 5 min bei 16.100 x g, 4°C zentrifugiert.For ethanol precipitation, 1-2 μl glycogen were used as precipitation aids. After addition of 2.5 volumes of absolute ethanol and "vortexing", the oligonucleotides were 30 min at -80 0 C and precipitated for 30 min at 16,100 xg, 4 ° C by centrifugation. The pellet was washed Ix with 70% ethanol and 5 min at 16,100 xg, 4 ° C centrifuged.
Aufnahme von Bindungsisothermen im Gleichgewichts-Anbindungs-AssayUptake of binding isotherms in the equilibrium binding assay
Je 2 ρmol der 5 '-radioaktiv markierten Aptamere wurden in Biotinyl-D-HMGAla/b-21mer (EPSEVPTPKRPRGRPKGSKNK [Seq. ID. 17]; siehe Fig. 2), wurde hergestellt von Bachern (Weil am Rhein, Deutschland). Lösungen im Konzentrationsbereich von 1 - 3000 nM (oder zur Zwei-Punkt-Mesung mit 30O nM und 3O nM oder 10O nM und 1O nM Peptid) für eine Stunde bei 37°C in Selektionspuffer (1OmM Tris HCl pH7,4, 5mM KCl, 0,8mM MgC12, 0,1% Tween) inkubiert. Als Hintergrundkontrolle diente eine Lösung ohne Biotinyliertes-D- HMGAl a/b-21mer. Peptid und Komplexe wurden anschließend mit 10 μl Streptavidin Ultra- Link Gel innerhalb von 30 min bei 37°C immobilisiert. Die Radioaktivität der Suspension wurde bestimmt. Der Überstand wurde abgenommen. Dann wurde die Matrix einmal mit 100 μl Selektionspuffer gewaschen und dann mit Selektionspuffer aufgefüllt. Durch Messung der Radioaktivität wurde für jede Peptidkonzentration der mit Biotinyl-D-HMGAla/b-21mer im Komplex vorliegende Aptamer- Anteil ermittelt. Durch grafische Auftragung und Fit (Gra- Fit, Version 4.0.10, Erithacus Software) konnten die Dissoziationskonstante der aktiven Spezies und der Anteil aktiver Moleküle ermittelt werden.2 μmol each of the 5 'radiolabeled aptamers were prepared in Biotinyl-D-HMGAla / b-21mer (EPSEVPTPKRPRGRPKGSKNK [SEQ ID: 17], see Figure 2), prepared by Bachern (Weil am Rhein, Germany). Solutions in the concentration range of 1 - 3000 nM (or for two-point measurement with 30O nM and 30 nM or 10O nM and 10 nM peptide) for one hour at 37 ° C in selection buffer (10 mM Tris HCl pH 7.4, 5 mM KCl, 0.8mM MgC12, 0.1% Tween). The background control was a solution without biotinylated D-HMGA1 a / b-21mer. Peptide and complexes were then immobilized with 10 μl Streptavidin Ultra-Link gel within 30 min at 37 ° C. The radioactivity of the suspension was decided. The supernatant was removed. Then the matrix was washed once with 100 μl of selection buffer and then filled up with selection buffer. By measuring the radioactivity, the aptamer content present in the complex with biotinyl-D-HMGAla / b-21mer was determined for each peptide concentration. Graphical application and Fit (Gra-Fit, version 4.0.10, Erithacus Software) were used to determine the dissociation constant of the active species and the proportion of active molecules.
ErgebnisseResults
Für alle als Aptamere (D-RNA) synthetisierten Klone wurde im Gleichgewichtsanbindungsas- say eine Dissoziationskonstante für die Bindung an das 21 Aminosäure lange D-Fragment von HMGAla/b (Biotinyl-D-HMGAla/b-21mer) von 8 - 22 nM ermittelt (Fig. IA).For all clones synthesized as aptamers (D-RNA), a dissociation constant for binding to the 21 amino acid D fragment of HMGAla / b (biotinyl-D-HMGAla / b-21mer) of 8-22 nM was determined in the equilibrium binding assay (Figure IA).
1.1.2 Verkürzung am Beispiel 132-B31.1.2 Shortening on the example 132-B3
Alle Kandidaten der Selektionen zeigten ein repetitiv auftretendes Sequenzmotiv GGGCG bzw. GGGUG bzw. GGGAG, welches am 5 'und am 3 '-Ende von einem Helix/ Stem-Motiv stabilisiert wird (Fig. 3).All candidates of the selections showed a repetitive sequence motif GGGCG or GGGUG or GGGAG, which is stabilized at the 5 'and at the 3' end by a helix / stem motif (FIG. 3).
Eine Analyse der voraussichtlichen Struktur und Faltung der RNA-Aptamere nach Zuker (Nucleic Acids Res. 2003 JuI l;31(13):3406-15) ergab, dass sich die vorgegebene Stern/ He- lix-Struktur in einigen verlängert hat (132-C3, 132-B3, 132-C4, 132-E2, 132-A2, 132-H1, 132-F1, 122-G2, 122-E2, siehe Fig. IA). Diese Stem-Helix-Struktur stellte die Grundlage für die weitere Verkürzung dieser Kandidaten dar. Diese weitere Verkürzung der Kandidaten erfolgte über die Identifizierung und Stabilisierung des minimalen Bindungsmotivs über FaI- tungs- und anschließende Deletionsanalyse der synthetischen D-RNAs im Hinblick auf die Bindung an das HMGAla/b Fragment. Die Bestimmung dieser Bindungseigenschaften erfolgte per Gleichgewichtsanbindungsassay. Fig. 3 zeigt exemplarisch am Kandidaten NOX-f (132-B3) die Verkürzung des Aptamers auf Grundlage der stabilisierenden Stem-Struktur, die in verlängerter Form bei den Kandidaten 132-C3, 132-B3, 132-C4, 132-E2, 132-A2, 132-H1, 132-F1, 122-G2, 122-E2 (siehe Fig. IA) zu finden ist. Eine Verkürzung auf eine 32 Nukleotide lange Aptamer- Variante von NOX-f mit einem 6 Nukleotide langen Stern (NOX-f 32nt) führte zu keinem Verlust der Bindungseigenschaften an das 21aa HMGAla/b Fragment (Fig. 3 und 4). Das artifϊzielle Einfügen eines Adenosins an der dritten Position des 5 '-ständigen Stern führte zu einer theoretischen Ausbildung eines 7 Nukleotid langen Sterns ohne ausgeloopten Bereich und diente zur Komplettierung des Sterns im 3 '-Bereich (NOX-f 33nt, Fig. 3 und 4). Die Messung der Bindungseigenschaften (Affinität und Aktivität) mittels Gleichgewichtsanbindungsassay an die 21 Aminosäure lange Domäne von HMGAl a/b wurde nicht von diesen Veränderungen beeinflusst.An analysis of the probable structure and folding of the RNA aptamers according to Zuker (Nucleic Acids Res. 2003 JuI, 31 (13): 3406-15) showed that the given star / helix structure has been extended in some cases (132 -C3, 132-B3, 132-C4, 132-E2, 132-A2, 132-H1, 132-F1, 122-G2, 122-E2, see Fig. IA). This stem-helix structure provided the basis for further shortening of these candidates. This further shortening of the candidates was achieved through the identification and stabilization of the minimal binding motif via precipitation and subsequent deletion analysis of synthetic D-RNAs with respect to binding to the HMGAla / b fragment. The determination of these binding properties was carried out by equilibrium binding assay. FIG. 3 shows by way of example on the candidate NOX-f (132-B3) the shortening of the aptamer based on the stabilizing Stem structure which is shown in an extended form in the candidates 132-C3, 132-B3, 132-C4, 132-E2, 132-A2, 132-H1, 132-F1, 122-G2, 122-E2 (see FIG. 1A). Shortening to a 32-nucleotide aptamer variant of NOX-f with a 6-nucleotide star (NOX-f 32nt) did not result in loss of binding properties to the 21aa HMGAla / b fragment (Figures 3 and 4). The artificially inserted adenosine at the third position of the 5'-stellar star resulted in a theoretical design of a 7 nucleotide long star with no lobed area and served to complete the star in the 3 'region (NOX-f 33nt, Figs. 3 and 4). The measurement of binding properties (affinity and activity) by means of an equilibrium binding assay to the 21 amino acid domain of HMGA1 a / b was not affected by these changes.
Die Sequenzen 132-G2, 122-A1, 122-C1, 122-B2 und 122-B4 weisen dagegen am 5'-Ende und 3'-Ende des repetitiv aufretenden Sequenzmotivs (GGGCG bzw. GGGUG bzw. GGGAG) eine deutlich kürzere Stem-Struktur auf. Eine Verkürzung derselben führte zu einem Verlust an Bindung. Eine mögliche Verkürzung des für diese Sequenzen längeren, zentralen Bereichs zwischen dem repetitiven Sequenzmotivs (GGGCG bzw. GGGUG bzw. GGGAG) wurde nicht vorgenommen.The sequences 132-G2, 122-A1, 122-C1, 122-B2 and 122-B4, on the other hand, have a markedly shorter stem at the 5'-end and 3'-end of the repetitive sequence motif (GGGCG and GGGAG, respectively) Structure on. Shortening them led to a loss of binding. A possible shortening of the longer for these sequences, central region between the repetitive sequence motif (GGGCG or GGGUG or GGGAG) was not made.
Die Seq.-ID's der Aptamersequenzen der hierin offenbarten HMGA-bindenden Nukleinsäuren sind wie folgt:The SEQ IDs of the aptamer sequences of the HMGA-binding nucleic acids disclosed herein are as follows:
Wie hierin bereits dargelegt und den Fachleuten auf dem Gebiet bekannt, bindet das aus L- Nukleotiden bestehende Enantiomer eines Aptamers, d.h. einer D-Nukleinsäure, das gegen ein D-Peptid erzeugt wurde, an das spiegelbildliche Enantiomer des D-Peptids, d.h. das L- Peptid, wie es natürlicherweise vorkommt. Diese L-Nukleinsäure wird hierin auch als Spiegeimer bezeichnet und weist ansonsten grundsätzlich die gleichen Bindungseigenschaften wie das Aptamer auf. As set forth herein and known to those skilled in the art, the L-nucleotide enantiomer of an aptamer, ie, a D-nucleic acid generated against a D-peptide, binds to the mirror-image enantiomer of the D-peptide, ie, the L - Peptide, as it occurs naturally. This L-nucleic acid is also referred to herein as a spiegelmer and otherwise has basically the same binding properties as the aptamer.
1.2 Charakteristische Eigenschaften von HMGAl a/b-bindenden Spigegelmeren1.2 Characteristic Properties of HMGAl a / b-binding Spigegelmeren
1.2.1 Repetitive Sequenzelemente: Box Al und Box A21.2.1 Repetitive sequence elements: Box Al and Box A2
Charakteristisch für alle Spiegelmere, die gegen HMGA la/b binden, ist ein repetitives Sequenzelement der Sequenz GGGCG bzw. GGGUG bzw. GGGAG. Dieses Sequenzelement taucht zweimal in HMGAl a/b-bindenden Spiegelmeren auf (Fig. IA und IB). Das dem 5'- Ende der Spiegelmere näher liegende Sequenzelement wird hierin als Box Al bezeichnet. Das dem 3 '-Ende der Spiegelmere näher liegende Sequenzelement wird dagegen hierin als Box A2 bezeichnet. Box Al und Box A2 und ihre Anordnung zueinander stellen wahrscheinlich das entscheidende Merkmal HMGAl a/b-bindender Spiegelmere dar.Characteristic of all Spiegelmers that bind to HMGA la / b is a repetitive sequence element of the sequence GGGCG or GGGUG or GGGAG. This sequence element appears twice in HMGA1 a / b-binding Spiegelmers (Figures IA and IB). The sequence element closer to the 5 'end of the spiegelmer is referred to herein as Box Al. In contrast, the sequence element closer to the 3 'end of the spiegelmer is referred to herein as box A2. Box Al and Box A2 and their arrangement to each other probably represent the decisive feature of HMGAl a / b-binding Spiegelmers.
1.2.2 Sequenzabschnitt zwischen Box Al und Box A21.2.2 Sequence section between Box Al and Box A2
Zwischen Box Al und Box A2 liegt entweder ein Sequenzabschnitt mit einer Länge von sechs bis sieben Nukleotiden oder 12 bis 22 Nukleotiden (Fig. IA und IB). Da sich diese Sequenzabschnitte nicht nur in ihrer Länge unterscheiden, werden sie getrennt abgehandelt.Between box A1 and box A2 is either a sequence section of six to seven nucleotides in length or 12 to 22 nucleotides in length (Figures IA and IB). Since these sequence sections differ not only in their length, they are dealt with separately.
Fall 1 : Sequenzabschnitt umfasst sechs bis sieben NukleotideCase 1: Sequence section comprises six to seven nucleotides
Hat der zwischen Box Al und Box A2 liegende Sequenzabschnitt eine Länge von sechs Nukleotiden, so weist der Sequenzabschnitt die Sequenz UGGUUG, UGGCUG, CGGUUG, AGGUUG oder GUGUAA auf. Ein Einschub von einem Nukleotid (Uracil) in die Sequenz CGGUUG, was zu der Sequenz CGGUUUG führt, hat weder einen negativen noch einen positiven Einfluß auf die Bindungseigenschaften der Spiegelmere.If the sequence section lying between box A1 and box A2 has a length of six nucleotides, then the sequence section has the sequence UGGUUG, UGGCUG, CGGUUG, AGGUUG or GUGUAA. Insertion of one nucleotide (uracil) into the sequence CGGUUG, resulting in the sequence CGGUUUG, has neither a negative nor a positive influence on the binding properties of the Spiegelmers.
Fall 2: Sequenzabschnitt umfasst 12-22 NukleotideCase 2: Sequence section comprises 12-22 nucleotides
Hat der zwischen Box Al und Box A2 liegende Sequenzabschnitt eine Länge von 12 bis 22The sequence section lying between box Al and box A2 has a length of 12 to 22
Nukleotiden, so weist dieser Sequenzabschnitt zwei Sequenzbereiche gleicher Länge auf, die miteinander ggf. hybridisieren können (Helix C). Die Hybidisierung wird dabei von jeweils drei bis sechs Nukleotiden bewerkstelligt. Zwischen den die Helix C ausbildenden Nukleotiden liegen drei bis fünf ungepaarte Nukleotide vor. Zwischen dem 3'-Ende von Box Al und dem 5 '-Ende von Helix C liegen eins bis drei Nukleotide ungepaart vor. Zwischem dem 3'- Ende von Helix C und dem 5 '-Ende von Box A2 können eins bis fünf Nukleotide ungepaart vorliegen.Nucleotides, this sequence section has two sequence regions of equal length, the optionally hybridize with each other (Helix C). The Hybidisierung is accomplished thereby in each case three to six nucleotides. Between the nucleotides forming the helix C are three to five unpaired nucleotides. Between the 3 'end of Box Al and the 5' end of Helix C, one to three nucleotides are unpaired. Between the 3 'end of Helix C and the 5' end of Box A2, one to five nucleotides can be unpaired.
1.2.3 Helikale Struktur am 5'- und am 3'-Ende der Spiegelmere1.2.3 Helical structure at the 5'- and at the 3'-end of the spiegelmer
Alle HMGAl a/b-bindenden Spigelmere zeichnen an ihren 5'- und 3 '-Enden durch Sequenzabschnitte aus, die miteinander hybridisieren können (Helix Al und Helix A2, (Fig. IA und IB). Die Anzahl der jeweils der miteinander hybridisierenden Nukleotide kann dabei von vier bis acht variieren. Dabei kann dieser vermeintlich doppelsträngige Bereich an das 5 '-Ende von Box Al und das 3 '-Ende von Box A2 heranreichen. Sollte dies nicht der Fall sein, so können Box Al und Box A2 von zusätzlich miteinander hybridisierenden Nukleotiden (Helix Bl und Helix B2) flankiert sein. Dabei kann es sich um Bereiche von jeweils vier bis acht Nukleotiden handeln (Fig. IA und IB).All HMGA1a / b-binding Spigelmers excel at their 5 'and 3' ends by sequence segments which can hybridize to each other (Helix A1 and Helix A2, (Figures IA and IB).) The number of nucleotides hybridizing to each other can vary from four to eight, and this supposedly double-stranded area may come close to the 5 'end of Box Al and the 3' end of Box A2 If this is not the case, then Box Al and Box A2 may be additional flanking nucleotides (Helix Bl and Helix B2), which may be regions of four to eight nucleotides each (Figures 1A and 1B).
Im Rahmen der der vorliegenden Anmeldung zugrundeliegenden Erfindung wurden verschiedenen Klassen von Nukleinsäuren und insbesondere L-Nukleinsäuren identifiziert, die an das Zielmolekül binden. Die folgende Darstellung und Beschreibung dieser Klassen, die hierin auch als Fälle bezeichnet werden, stellt insoweit einen integralen Bestandteil der vorliegenden Anmeldung dar. Im folgenden werden für eine jede Klasse deren prinzipieller Aufbau und beispielhafte L-Nukleinsäuren für diese Klasse unter Verwendung der jeweiligen Kurzbezeichnungen der L-Nukleinsäuren angegeben.Within the scope of the invention underlying the present invention, various classes of nucleic acids and in particular L-nucleic acids have been identified which bind to the target molecule. The following description and description of these classes, which are also referred to herein as cases, represents an integral part of the present application in this respect. In the following, for each class, their basic structure and exemplary L-nucleic acids for this class using the respective abbreviations of L-nucleic acids indicated.
Fall 1: 132-C3, 132-B3, 132-C4, 132-E2, 132-A2, 132-H1, 132-F1, 122-G2, 132-B3 32nt, 132-B3 33ntCase 1: 132-C3, 132-B3, 132-C4, 132-E2, 132-A2, 132-H1, 132-F1, 122-G2, 132-B3 32nt, 132-B3 33nt
HeH2C Ai-Nx-HeIiX Bl-N6Nτ|Box A1|N,N2GN8N3N4N5|BOX A2|G-Nγ-Helix B2-N,-Hglix A2_(FaIl IA)HeH 2 C Ai-N x -HeIiX Bl-N 6 N τ | Box A1 | N, N 2 GN 8 N 3 N 4 N 5 | BOX A2 | GN γ -Helix B2-N, -Hglix A2_ (Example IA)
bzw.respectively.
HeHx AI-Nx-HeIiX Bl-N6NτtBox AIlN1N2GN8N3N4N5IBOX A2|HeIix B2-N,-Helix A2 (Fall IB) N1 = U5 C5 A5 G;HeHx AI-N x -HeIiX Bl-N 6 NttBox AIlN 1 N 2 GN 8 N 3 N 4 N 5 IBOX A2 | HeIix B2-N, -Helix A2 (Case IB) N 1 = U 5 C 5 A 5 G;
N2 = G5 U;N 2 = G 5 U;
N3 = U5 C;N 3 = U 5 C;
N4 = U5 A;N 4 = U 5 A;
N5 = G5 A;N 5 = G 5 A;
N6 = G, A, U;N 6 = G, A, U;
N7 = G5 U;N 7 = G 5 U;
N8 = U oder kein Nukleotid;N 8 = U or no nucleotide;
Nx = null bis fünf Nukleotide;N x = zero to five nucleotides;
Ny = null oder sechs Nukleotide;Ny = zero or six nucleotides;
Nz = null bis sechs Nukleotide;N z = zero to six nucleotides;
|Box Al| = |Box A2l = GGGCG oder GGGUG oder GGGAG;| Box Al | = | Box A2l = GGGCG or GGGUG or GGGAG;
Helix Al und Helix A2 = jeweils vier bis acht Nukleotide, die vollständig oder teilweise miteinander hybridisieren, wobei die Summe der jeweils miteinander hybridisierenden Nukleotide aus Helix Al und Helix A2 und Helix Bl und Helix B2 10 bis 12 Nukleotide beträgt;Helix Al and Helix A2 = in each case four to eight nucleotides which hybridize completely or partially with one another, the sum of the mutually hybridizing nucleotides composed of helix A1 and helix A2 and helix B1 and helix B2 being 10 to 12 nucleotides;
Helix Bl und Helix B2 = jeweils vier bis acht Nukleotide, die miteinander hybridisieren, wobei die Summe der jeweils miteinander hybridisierenden Nukleotide aus Helix Al und Helix A2 und Helix Bl und Helix B2 10 bis 12 Nukleotide beträgt.Helix Bl and Helix B2 = in each case four to eight nucleotides which hybridize to one another, the sum of the mutually hybridizing nucleotides composed of Helix Al and Helix A2 and Helix Bl and Helix B2 being 10 to 12 nucleotides.
Die Moleküle sind auch nach der Verkürzung am 5'- und am 3 '-Ende aktiv. Nach der Entfernung der Helix Al und A2 sowie sowie der Bereiche N6N7 und GNy behalten die verkürzten Moleküle ihre Bindungseigenschaften bei. Gezeigt wurde dies für die verkürzten Varianten 132-B3 32nt (NOX-f 32nt) und 132-B3 33nt (NOX-f 33nt) (siehe Fig. 3 und 4). Fall 2A: 132-G2, 122-A1, 122-C1, 122-B2, 122-B4The molecules are also active after shortening at the 5'- and at the 3'-end. After removal of the helices Al and A2 as well as the regions N 6 N7 and GNy, the shortened molecules retain their binding properties. This was shown for the shortened variants 132-B3 32nt (NOX-f 32nt) and 132-B3 33nt (NOX-f 33nt) (see FIGS. 3 and 4). Case 2A: 132-G2, 122-A1, 122-C1, 122-B2, 122-B4
Hehx Al-Na-tBox Alj-Nb-lHehx C lj-Nc-jHelϊx C2J-Nd-)Box Äl|-G-Ne-Helix A2Hehx Al-N a -tBox Alj-N b -lHehx C lj-N c -jHelϊx C2J-N d -) Box Äl | -GN e -Helix A2
Na = ein bis fünf NukleotideN a = one to five nucleotides
Nb = drei NukleotideN b = three nucleotides
Nc = drei bis fünf NukleotideN c = three to five nucleotides
Nd = zwei bis fünf NukleotideN d = two to five nucleotides
Ne = eins bis zwei Nukleotide, bevorzugterweise A oder UUN e = one to two nucleotides, preferably A or UU
|Box Al| = |Box A2| = GGGCG oder GGGUG oder GGGAG| Box Al | = | Box A2 | = GGGCG or GGGUG or GGGAG
Hehx Al und Hehχ A2 = jeweils fünf bis sechs Nukleotide, die vollständig oder teilweise miteinander hybridisieren, ΪHehx Cl und Hehx C2!= jeweils fünf bis sechs Nukleotide, die miteinander hybridisieren,Hehx Al and Hehχ A2 = each five to six nucleotides that hybridize fully or partially with each other, ΪHehx Cl and Hehx C2! = Each five to six nucleotides that hybridize with each other,
Fall 2B: 122-E2Case 2B: 122-E2
HehxAl-N.-Helix Bl-N|-JBox ÄΪ|-A-ΗeTix'ci'-Nc-'Heiϊx CJl-G-tBox Ä2|-G-Helix B2-A-Hehx A2HehxAl-N.-Helix Bl-N | -JBox ÄΪ | -A-ΗeTix ' ci'-N c -'Heiϊx CJl-G-tBox Ä2 | -G-Helix B2-A-Hehx A2
N, = zwei Nukleotide, bevorzugterweise CA Nj = zwei Nukleotide, bevorzugterweise AG Nc = vier Nukleotide, bevorzugterweise GAUGN, = two nucleotides, preferably CA N j = two nucleotides, preferably AG N c = four nucleotides, preferably GAUG
iBox Alj = JBox A2| = GGGCG oder GGGUG oder GGGAG Hehx Al und Hehx A2 = jeweils sechs Nukleotide, die miteinander hybridisieren, Helix Bl und Helix B2 = jeweils fünf Nukleotide, die miteinander hybridisieren iHeϊix CΪ und Helix C2ι = jeweils drei Nukleotide, die miteinander hybridisieren Beispiel 2: Domain-ApproachiBox Alj = JBox A2 | = GGGCG or GGGUG or GGGAG Hehx Al and Hehx A2 = each six nucleotides that hybridize to each other, Helix Bl and Helix B2 = each five nucleotides that hybridize with each other iHeϊix CΪ and Helix C2ι = each three nucleotides that hybridize with each other Example 2: Domain Approach
2.1 Bestimmung der Interaktion von HMGAl a/b-Spiegelmeren und rekombinantem HMGAIb im Kompetitionsassay2.1 Determination of the Interaction of HMGAI a / b Spiegelmers and Recombinant HMGAIb in the Competition Assay
Durchfuhrung/MethodeImplementation / method
Klonierung von His6-markiertem HMGAIbCloning of His6-labeled HMGAIb
Der BD-Freedom™ ORF Klon GH00552L1.0 (high mobility group AT hookl) mit der für HMGAIb kodierenden Sequenz wurde von BioCat, Heidelberg gekauft. Die Sequenz ist darin bereits so verändert, dass das Stop-Codon in ein für Leucin kodierendes Codon umgewandelt ist, um C-terminale Fusionen zu ermöglichen. Die Sequenz des Klons entspricht am meisten der in der RefSeq-Datenbank mit der Nummer NM002131 gespeicherten Sequenz. Mit den primern HMGJwdl (TCGACACCATGGGTGAGTC, Seq.ID 34) und HMGjrevl (GTCTAGAAAGCTTCCCAACTG, Seq.ID 35) wurde mit Hilfe einer Standard-PCR die für HMGAIb kodierende Sequenz amplifϊziert. Dabei wurde die Base nach dem ATG von A nach G verändert, um damit eine Ncol-Schnittstelle einzuführen. Das PCR-Produkt wurde entsprechend der Herstellerangaben mit den Restriktionsenzymen Ncol und Hindlll Beide von NEB, Frankfurt am Main; Deutschland) geschnitten und über ein Agarosegel gereinigt. Der Vektor pHO2d (Fasshauer et al. (1997) J.Biol.Chem. 272:28036 - 28041) ) wurde ebenfalls mit Ncol und Hindill geschnitten und über ein Agarosegel gereinigt. Der Vektor pHO2d erlaubt die Expression eines am C-terminalen Ende mit einer Sequenz aus 6 Histidinresten (His6-tag) fusionierten Proteins unter Kontrolle eines T7-Promotors (Fasshauer et al., 1997, JBC 272:28036).The BD-Freedom ™ ORF clone GH00552L1.0 (high mobility group AT hookl) with the HMGAIb coding sequence was purchased from BioCat, Heidelberg. The sequence is already altered to convert the stop codon to a leucine-encoding codon to allow C-terminal fusions. The sequence of the clone most closely matches the sequence stored in the RefSeq database numbered NM002131. With the primers HMGJwdl (TCGACACCATGGGTGAGTC, Seq.ID 34) and HMGjrevl (GTCTAGAAAGCTTCCCAACTG, Seq.ID 35), the sequence coding for HMGAIb was amplified by means of a standard PCR. The base was changed from A to G after the ATG to introduce an NcoI site. The PCR product was used according to the manufacturer's instructions with the restriction enzymes Ncol and HindIII both from NEB, Frankfurt am Main; Germany) cut and cleaned over an agarose gel. The vector pHO2d (Fasshauer et al., (1997) J. Biol. Chem. 272: 28036-28041) was also cut with NcoI and HindIII and purified on an agarose gel. The vector pHO2d allows expression of a protein fused at the C-terminal end to a sequence of 6 histidine residues (His6-tag) under the control of a T7 promoter (Fasshauer et al., 1997, JBC 272: 28036).
Das gereinigte und geschnittene PCR-Produkt wurde über Nacht bei 150C mit Hilfe einer T4- Ligase entsprechend der Herstellerangaben (MBI Fermentas, St. Leon-Roth, Deustchland) in den vorbereiteten Vektor ligiert. Mit dem Ligationsprodukt wurden Bakterien vom Stamm DH5 transformiert. Die Korrektheit der Plasmide aus erhaltenen Kolonien wurde durch Sequenzierung sichergestellt. Das von pHO2d/HMGAlb kodierte Fusionsprotein HMGAIb- His6 hat gegenüber dem natürlichen HMGAlb-Protein ein Glycin (G) statt Serin (S) an Position 2 und nach dem C-terminalen Glutamin (Q) ein Leucin (L) (s.o.), gefolgt von 5 weiteren Aminosäuren (G S L N S) (vom Vektor kodiert), an die sich die sechs Histidine (H) anschließen. Expression und Reinigung von HMGlb-His6The purified and cut PCR product was ligated overnight at 15 0 C with the aid of a T4 ligase according to the manufacturer's specifications (MBI Fermentas, St. Leon-Roth, Deustchland) into the prepared vector. With the ligation product bacteria were transformed from the strain DH5. Correctness of the plasmids from obtained colonies was ensured by sequencing. The fusion protein HMGAIb-His6 encoded by pHO2d / HMGA1b has followed a glycine (G) instead of serine (S) at position 2 and after the C-terminal glutamine (Q) a leucine (L) (see above) compared to the natural HMGA1b protein of 5 additional amino acids (GSLNS) (encoded by vector) followed by the six histidines (H). Expression and purification of HMGlb-His6
Für die Expression des Fusionsproteins wurden Bakterien vom Stamm BL21 mit dem Plasmid pHO2d/HMGAlb transformiert. Die Expression des Fusionsproteins wurde mit Isopro- pylthio-ß-D-Galaktosid (IPTG) induziert. Nach 4 h wurden die Bakterien für 15 min bei 10.000 x g abzentrifugiert und das Pellet bis zur weiteren Verwendung bei -20°C aufbewahrt.For the expression of the fusion protein, bacteria of strain BL21 were transformed with the plasmid pHO2d / HMGA1b. Expression of the fusion protein was induced with isopropylthio-β-D-galactoside (IPTG). After 4 h, the bacteria were centrifuged off for 15 min at 10,000 × g and the pellet was stored at -20 ° C. until further use.
Für die Extraktion des Fusionsproteins wurden zu einem gefrorenem Bakterienpellet von 500 ml Kultur 25 ml Extraktionspuffer (1% n-Octyl-ß,D-Thioglucoρyranosid (OTG) in 50 mM NaxPO4-Puffer, pH 8.0, 250 mM NaCl, 10 mM Imidazol und MiniProteaselnhibitoren- Tabletten (Roche, Mannheim, Deutschland) (5 St/50 ml)) gegeben, mit 5 μl Benzonase (gra- del ; MERCK, Darmstadt, Deutschland) versetzt, durch Auf- und Abpipettieren homogenisiert und 5 min bei RT inkubiert. Danach wurde 15 min bei 10.000 x g (RT) zentrifugiert. Der Ü- berstand wurde durch einen Faltenfilter geklärt und dann auf eine mit Waschpuffer (50 mM NaxPO4-Puffer, pH 8.0, 250 mM NaCl, 10 mM Imidazol, alle MERCK, Darmstadt, Deutschland) äquilibrierte HIS-Select-Säule (HIS-SELECT Cartridge, Sigma, Deisenhofen, Deutschland) aufgetragen. Nach Waschen der Säule mit 10 - 15 ml Waschpuffer wurde das Fusionsprotein mit Elutionspuffer (250 mM Imidazol in Waschpuffer) in 0,5 - 1 ml großen Fraktionen eluiert. Proteinhaltige Fraktionen wurden mittels Gelelektrophorese (16% Polyacrylamid- gel nach Schäger & Jagow, 1987, Anal.Biochem. 166:368-379) auf Reinheit überprüft. Fraktionen mit Fusionsprotein wurden vereinigt, ggf. gegen einen geeigneten Puffer dialysiert und nach Proteinbestimmung nochmals auf Reinheit überprüft. Das gereinigte Fusionsprotein wurde in Aliquots bei -200C gelagert.For the extraction of the fusion protein to a frozen bacterial pellet of 500 ml of culture was added 25 ml of extraction buffer (1% n-octyl-β, D-thiogluco-pyranoside (OTG) in 50 mM Na x PO 4 buffer, pH 8.0, 250 mM NaCl, 10 mM Imidazole and MiniProteaselnhibitoren- tablets (Roche, Mannheim, Germany) (5 St / 50 ml)), mixed with 5 .mu.l Benzonase (grael, MERCK, Darmstadt, Germany), homogenized by pipetting up and down and 5 min at RT incubated. It was then centrifuged for 15 min at 10,000 xg (RT). The Ü supernatant liquid was clarified by a fluted filter and then a with wash buffer (50 mM Na x PO 4 buffer, pH 8.0, 250 mM NaCl, 10 mM imidazole, all Merck, Darmstadt, Germany) equilibrated HIS-Select column ( HIS SELECT Cartridge, Sigma, Deisenhofen, Germany). After washing the column with 10 - 15 ml wash buffer, the fusion protein was eluted with elution buffer (250 mM imidazole in wash buffer) in 0.5 - 1 ml fractions. Protein-containing fractions were checked for purity by gel electrophoresis (16% polyacrylamide gel according to Schäger & Jagow, 1987, Anal.Biochem. 166: 368-379). Fractions with fusion protein were combined, optionally dialyzed against a suitable buffer and again checked for purity after protein determination. The purified fusion protein was stored in aliquots at -20 0 C.
Bestimmung der Interaktion von HMGAl a/b-Spiegelmeren und HMGAlb-His6Determination of the interaction of HMGA1 a / b Spiegelmers and HMGAlb-His6
Zur genaueren Analyse der Affinität der HMGAl a/b-Spiegelmere zu HMGAIb wurde ein auf dem 96-well Format basierender Test verwendet. In diesem Test verhindert die Bindung der HMGAla/b-Spiegelmere an HMGAlb-His6 dessen Interaktion mit einem DNA- Oligonukleotid, das eine Bindungsstelle für HMGAl a/b besitzt. Dieses DNA-Oligonukleotid (dsDNA AT-Hook) (Fashena et al., 1992) ist an einem Strang mit einem Biotin-Molekül markiert, über das es an mit Streptavidin beschichtete Platten gebunden werden kann. Der Nachweis von an DNA gebundenem HMGAl b-His6 erfolgt über mit Nickel modifizierter Meerret- tichperoxidase (Nickel-HRP), welche ein fluorogenes Substrat umsetzt. Das Spiegeimer ver- drängt in diesem Assay das rekombinante HMGAIb von seinem natürlichen Bindungspartner. Auf Grund der 1 :1 :1 Stöchometrie von Spiegeimer/ rHMGAlb/ dsDNA AT-Hook lassen sich direkt Aussagen über die Affinität der Spiegelmere gegenüber HMGAIb treffen. Das Prinzip des Assays ist inFig. 5 dargestellt.For a more detailed analysis of the affinity of HMGA1 a / b spiegelmers for HMGAIb, a test based on the 96-well format was used. In this assay, binding of the HMGAla / b spiegelmers to HMGAlb-His6 prevents its interaction with a DNA oligonucleotide having a binding site for HMGA1 a / b. This DNA oligonucleotide (dsDNA AT-Hook) (Fashena et al., 1992) is labeled on a strand with a biotin molecule through which it can be attached to streptavidin-coated plates. The detection of DNA bound to HMGAl b-His6 via nickel-modified horseradish peroxidase (nickel-HRP), which reacts a fluorogenic substrate. The mirror bin in this assay urges the recombinant HMGAIb from its natural binding partner. Based on the 1: 1: 1 stoichiometry of the spiegelmer / rHMGAlb / dsDNA AT-Hook, it is possible to make direct statements about the affinity of the spiegelmer for HMGAIb. The principle of the assay is in the art. 5 is shown.
Zur Durchführung dieses Tests werden in einer Spitzbodenplatte Spiegelmere in verschiedenen Konzentrationen und HMGAlb-His6 (0,36μg/ml; ca. 30 nM) in einem Gesamtvolumen von 100 μl 10 min bei Raumtemperatur unter Schütteln inkubiert. Die Inkubationslösung enthält ausserdem: 25 mM Tris/HCl, pH 7.0 (Ambion, Austin, TX, USA), 140 mM KCl (Ambion, Austin, TX, USA), 12 mM NaCl (Ambion, Austin, TX, USA), 0,8 mM MgC12 (Ambion, Austin, TX, USA), 0,25 mg/ml BSA (Roche, Mannheim, Deutschland), 1 mM DTT (Invitro- gen, Karlsruhe, Deutschland), 18 - 20 μg/ml poly(dGdC) (Sigma, Deisenhofen, Deutschland)), 0,05 % Tween 20 (Roche, Mannheim, Deutschland). Dann werden 2 μl biotinyliertes DNA-Oligonukleotid dsDNA AT-Hook (äquimolare Mischung von 5'biotin- TCGAAAAAAGCAAAAAAAAAAAAAAAAAACTGGC (34nt) undTo perform this assay, spiegelmers at various concentrations and HMGAlb-His6 (0.36 μg / ml, about 30 nM) are incubated in a shallow bottom plate in a total volume of 100 μl for 10 min at room temperature with shaking. The incubation solution also contains: 25 mM Tris / HCl, pH 7.0 (Ambion, Austin, TX, USA), 140 mM KCl (Ambion, Austin, Tex., USA), 12 mM NaCl (Ambion, Austin, TX, USA), 0 , 8 mM MgC12 (Ambion, Austin, Tex., USA), 0.25 mg / ml BSA (Roche, Mannheim, Germany), 1 mM DTT (Invitrogen, Karlsruhe, Germany), 18-20 μg / ml poly ( dGdC) (Sigma, Deisenhofen, Germany)), 0.05% Tween 20 (Roche, Mannheim, Germany). Then 2 μl of biotinylated DNA oligonucleotide dsDNA AT-Hook (equimolar mixture of 5'biotin-TCGAAAAAAGCAAAAAAAAAAAAAACTGGC (34nt) and
5'GCCAGTTTTTTTTTTTTTTTTTTGCTTTTTT (31 nt); 75 μM in 150 mM NaCl (Ambion, Austin, TX, USA)) zugegeben und weitere 10 min unter Schütteln bei RT inkubiert. Anschließend werden die Ansätze in eine mit Streptavidin beschichtete schwarze 96-well Platte (ReactiBind v. Pierce, Bonn, Deustchland)) überführt und 30 min unter leichtem Schütteln bei RT inkubiert. Danach werden die Vertiefungen der Platte drei mal mit je 200 μl TBSTCM (20 mM Tris/HCl, pH 7,6 (Ambion, Austin, TX, USA); 137 mM NaCl (Ambion, Austin, TX, USA), 1 mM MgC12 (Ambion, Austin, TX, USA), 1 mM CaC12 (Sigma, Deisenhofen, Deustchland), 0,05% Tween20 (Roche, Mannheim, Deustchland)) gewaschen. In jede Vertiefung werden 50 μl einer verdünnten Nickel-HRP-Lösung gegeben (ExpressDe- tector Nickel-HRP, (Medac, Hamburg, Deutschland) 1:1000 in 10 mg/ml BSA (Roche, Mannheim, Deustchland)in TBSTCM) und 1 h unter leichtem Schütteln bei RT inkubiert. Danach werden die Vertiefungen wieder drei mal mit je 200 μl TBSTCM gewaschen. Zu jeder Vertiefung werden dann 100 μl des fluorogenen HRP Substrats (QuantaBlue, Pierce, Bonn, Deutschland) gegeben und nach 15 min die Fluoreszenz gemessen (ex: 340/em: 405 nm). Ergebnis5'GCCAGTTTTTTTTTTTTTTTTTGCTTTTTT (31 nt); 75 μM in 150 mM NaCl (Ambion, Austin, TX, USA)) and incubated for a further 10 min with shaking at RT. Subsequently, the mixtures are transferred to a streptavidin-coated black 96-well plate (ReactiBind v. Pierce, Bonn, Germany) and incubated for 30 min with gentle shaking at RT. Thereafter, the wells of the plate are washed three times with 200 μl each of TBSTCM (20 mM Tris / HCl, pH 7.6 (Ambion, Austin, TX); 137 mM NaCl (Ambion, Austin, Tex., USA), 1 mM MgC12 (Ambion, Austin, TX, USA), 1 mM CaCl 2 (Sigma, Deisenhofen, Germany), 0.05% Tween20 (Roche, Mannheim, Germany). 50 μl of a dilute nickel-HRP solution are added to each well (ExpressDetector Nickel-HRP, (Medac, Hamburg, Germany) 1: 1000 in 10 mg / ml BSA (Roche, Mannheim, Germany) in TBSTCM) and 1 h incubated with gentle shaking at RT. Thereafter, the wells are again washed three times with 200 ul TBSTCM each. 100 μl of the fluorogenic HRP substrate (Quanta Blue, Pierce, Bonn, Germany) are then added to each well and the fluorescence is measured after 15 min (ex: 340 / em: 405 nm). Result
Es konnte gezeigt werden, dass die Spiegelmere NOX-A (50nt), NOX-f (33nt) und NOX-fIt was shown that the spiegelmers NOX-A (50nt), NOX-f (33nt) and NOX-f
(48nt) konzentrationsabhängig mit der Bindung von HMGAlb-His6 an das biotinylierte(48nt) concentration-dependent with the binding of HMGAlb-His6 to the biotinylated
DNA-Oligonukleotid kompetieren (Fig. 6). Für Spiegeimer NOX-A ergibt sich eine IC50 von ca. 15 nM.Compete DNA oligonucleotide (Figure 6). For mirror bucket NOX-A results in an IC50 of about 15 nM.
Im Gegensatz zu dem aktiven Spiegeimer zeigte ein Kontrollspiegelmer mit zu NOX-A inver- ser Sequenz bis zu einer Konzentration von 0,5 μM keinen Effekt auf die Bindung vonIn contrast to the active spiegelmer, a control mirror with NOX-A inverse sequence up to a concentration of 0.5 μM had no effect on the binding of
HMGAlb-His6 an das DNA-Oligonukleotid hat und erst bei Konzentrationen über 1 μM un- spezifische Interaktionen mit HMGAlb-His6 auftreten (Fig. 7).HMGAlb-His6 on the DNA oligonucleotide and only at concentrations above 1 uM nonspecific interactions with HMGAlb-His6 occur (Fig. 7).
2.2 Verwendung von Spiegelmeren zum Nachweis von HMGAIb durch Western Blot2.2 Use of Spiegelmers to Detect HMGAIb by Western Blot
Durchführung/MethodenImplementation / Methods
Das rekombinant exprimierte HMGAIb wurde über Gelelektrophorese auf einem 16% PAA- Tricin-Gel aufgetrennt und mittels Elektroblottings auf Nitrozellulosemembranen transferiert. Die Membran wurde nachfolgend mit 5% Magermilch und 10OnM unspezifischen Spiegeimer in IxTBST (20 mM Tris/HCl ph 7.6, 137 raM NaCl, 0.1% Tween) für 1 Stunde geblockt und 3mal für 10 Minuten mit IxTBST gewaschen. Die Detektion des rekombinaten HMGAIb erfolgte mit am 5 '-Ende biotinyliertem Spiegeimer NOX-A (5'bioNOX-A). 5'bioNOX-A wurde in IxTBST mit je ImM Kalzium und Magnesium (TBST+Ca/Mg)und 10OnM unspezifischem Spiegeimer verdünnt und für 1,5 Stunden inkubiert. Der Blot wurde anschließend 3mal für 10 Minuten mit Ix TBST+ Ca/ Mg gewaschen und das gebundene biotinylierte Spiegeimer mit einem anti-Biotin-Antikörper in TBST+ Ca/Mg für 45 Minuten inkubiert. Anschließend wurde der Blot 5mal für 10 Minuten mit lxTBST+Ca/Mg gewaschen und der mit gekoppelter Meerrettichperoxidase (HRP) Sekündarantikörper mittels LumiGLO Nachweisreagens (Cell Signaling Technology) detektiert.The recombinantly expressed HMGAIb was separated by gel electrophoresis on a 16% PAA Tricin gel and transferred by electroblotting onto nitrocellulose membranes. The membrane was subsequently blocked with 5% skimmed milk and 10 nM unspecific spiegelmer in IxTBST (20 mM Tris / HCl pH 7.6, 137 mM NaCl, 0.1% Tween) for 1 h and washed 3 times for 10 min with IxTBST. Detection of the recombinant HMGAIb was carried out with 5'-end biotinylated spiegelmer NOX-A (5'bioNOX-A). 5'bioNOX-A was diluted in IxTBST with ImM calcium and magnesium (TBST + Ca / Mg) and 10OnM unspecific spiegelmer and incubated for 1.5 hours. The blot was then washed 3 times for 10 minutes with Ix TBST + Ca / Mg and the bound biotinylated spiegelmer incubated with an anti-biotin antibody in TBST + Ca / Mg for 45 minutes. Subsequently, the blot was washed 5 times for 10 minutes with lxTBST + Ca / Mg and the coupled horseradish peroxidase (HRP) secondary antibody was detected by means of LumiGLO detection reagent (Cell Signaling Technology).
ErgebnisResult
Mit Hilfe des beschriebenen Verfahrens konnte die Bindung eines 5 '-terminal biotinylierten Spiegeimers an das rekombinant exprimierte HMGAIb gezeigt werden. Ähnlich einer auf Antikörper basierenden Detektion wurden 5μg HMGAIb nach Transfer auf eine Blot- membran mit 3nM bio-NOX-A detektiert. Das inverse Spiegeimer von NOX-A konnte HMGAIb nicht erkennen, was die spezifische Bindung von NOX-A belegt (Fig. 8).Using the method described, the binding of a 5 ' terminal biotinylated spiegelmer to the recombinantly expressed HMGAIb could be demonstrated. Similar to antibody-based detection, 5 μg of HMGAIb were transferred to a blot membrane detected with 3nM bio-NOX-A. The inverse spiegelmer of NOX-A could not recognize HMGAIb, demonstrating the specific binding of NOX-A (Figure 8).
Beispiel 3: PEI-Spieglmer-FormulierungExample 3: PEI-Spiegler formulation
3.1 Prinzip der Polyethylenimine vermittelten Transfektion von Spiegelmeren3.1 principle of polyethyleneimine-mediated transfection of Spiegelmeren
Das Zielmolekül HMGAl a/b wird im Zytosol exprimiert und findet als Transkriptionsfaktor seinen natürlichen Bindungspartner, die doppelsträngige DNA im Zellkern. Durch Bindung des Spiegeimers an HMGAl a/b im Zytosol und Kompetition des durch die AT-Hooks auf der DNA gebundenen HMGAl a/b im Zellkern der Zelle sollen die HMGAl a/b- vermittelten zellulären Antworten antagonisiert werden. Aufgrund der negativen Ladung der Plasmamembran werden DNA- und RNA-Moleküle schlecht durch passiven Transport von einer Zelle aufgenommen. Einer der Ansätze des intrazellulären Transports vom Nukleinsäuren ist die Kondensation bzw. Verpackung mit geladenen Partikeln oder Reagenzien und damit verbundene Änderung der Ladung des Gesamtkomplexes. Dieser Komplex wird leicht über Endozytose aufgenommen und gelangt somit in das Zytosol der Zelle. Nachteile dieser Methode ist die Stabilität der DNA/ RNA bzw. das Freisetzen der Nukleinsäure aus dem endosomalen Kom- partementen. Im Zytosol der Zelle entsteht aus dem eingeschnürten Endosom durch das Einbringen von Proteasen bzw. Nukleasen und durch Protonierung des Kompartiments schnell ein Lysosom. Nukleasen verdauen dort die Nukleinsäuren und zudem ist die Nukleinsäure im saurem Milieu nicht stabil. Über Exozytose bzw. Abbau im Golgi Apparat wird der gesamte Komplex schnell wieder aus der Zelle transportiert und somit gelangen nur wenige Nukleinsäuren in die Zelle. Eine der Herausforderung an ein geeignetes Transfektionssystem ist somit die Stabilisierung, sowie die Freisetzung der Nukleinsäure aus den Endosomen in das Zytosol. Hinsichtlich der Stabilität haben RNA-Spiegelmere ideale Eigenschaften für eine Transfektion von eukaryotischen Zellen, da sie als unnatürliche Enantiomere nicht von Enzymen gespalten werden.The target molecule HMGAl a / b is expressed in the cytosol and finds as its transcription factor its natural binding partner, the double-stranded DNA in the cell nucleus. By binding of the spiegelmer to HMGA1 a / b in the cytosol and competition of HMGA1 a / b bound to the DNA by the AT hook in the cell nucleus, the HMGA1a / b-mediated cellular responses are to be antagonized. Due to the negative charge of the plasma membrane, DNA and RNA molecules are poorly absorbed by passive transport from a cell. One of the approaches of intracellular transport of nucleic acids is the condensation or packaging with charged particles or reagents and associated change in the charge of the entire complex. This complex is easily absorbed via endocytosis and thus enters the cytosol of the cell. Disadvantages of this method are the stability of the DNA / RNA or the release of the nucleic acid from the endosomal compartments. In the cytosol of the cell, a lysosome develops rapidly from the constricted endosome by the introduction of proteases or nucleases and by protonation of the compartment. Nucleases digest the nucleic acids there and, moreover, the nucleic acid is not stable in an acidic environment. Through exocytosis or degradation in the Golgi apparatus, the entire complex is quickly transported back out of the cell and thus only a few nucleic acids enter the cell. One of the challenges for a suitable transfection system is thus the stabilization, as well as the release of the nucleic acid from the endosomes into the cytosol. In terms of stability, RNA spiegelmers have ideal properties for transfection of eukaryotic cells because they are not cleaved by enzymes as unnatural enantiomers.
Das ausgewählte Transfektionssystem basisiert auf der Bildung von Mizellen von Nukleinsäuren mit verzweigtem Polyethylenimin (PEI). Das Phosphatrückrat der Nukleinsäuren in- teragiert mit den freien Stickstoff-Positionen des PEI und bildet über Querverzweigung kleine Mizellen, welche aufgrund des PEI eine positive Ladung haben. Dabei wird PEI mit einem Molekulargewicht von 3 bis 800 kDa verwendet. Je kleiner das PEI gewählt wird desto kleiner sind die gebildeten Mizellen. Die Verwendung von 25 kDa querverzweigtem PEI (Sigma- Aldrich Cat. No. 40;872-7) fuhrt bei der Zugabe von Nukleinsäuren zu Polyplexen von einer Größe von 100 bis zu 500nm, typischerweise jedoch zu Polyplexen einer Größe von 100- 200nm. In der Regel wird eine Stickstoff/ Phosphat-ratio von 2:1 bis 5:1 verwendet; teilweise sogar bis zu 20:1. Die Verpackung der Nukleinsäure in Mizellen hat eine Änderung des zeta- Potential des Komplexes auf - (+)21mV bei einer N/P 3 zur Folge. Es ist bekannt, dass mit zunehmenden, positiven zeta-Potential von Komplexen die Toxizität für kultivierte Zellen steigt. Diese Mizellen werden jedoch leicht durch Einschnürung der Plasmamembran als En- dosomen von einer Zelle aufgenommen. Das PEI puffert nun einströmende Protonen ab, woraufhin viele Chlorid-Ionen im Inneren des Endosoms zu einem Anschwellen des Komparti- ments aufgrund des osmotischen Drucks führen. Dieser Effekt des PEI wird als Protonen- Schwamm-Effekt in der Literatur beschrieben (Sonawane et al., JBC, 2003, Vol.278; No.45(7) pp.44826-44831) und führt letztlich zum Platzen des Endosoms und zur Freisetzung der Spiegelmere in das Zytosol.The selected transfection system is based on the formation of micelles of branched polyethylenimine (PEI) nucleic acids. The phosphate backbone of the nucleic acids interacts with the free nitrogen positions of the PEI and forms small micelles via transverse branching, which have a positive charge due to the PEI. This is PEI with a Molecular weight of 3 to 800 kDa used. The smaller the PEI chosen, the smaller the micelles formed. The use of 25 kDa branched PEI (Sigma-Aldrich Cat No. 40, 872-7) results in addition of nucleic acids to polyplexes of size of 100 to 500 nm, but typically to polyplexes of size 100-200 nm. As a rule, a nitrogen / phosphate ratio of 2: 1 to 5: 1 is used; sometimes even up to 20: 1. The packaging of the nucleic acid in micelles results in a change of the zeta potential of the complex to - (+) 21mV with an N / P 3. It is known that with increasing positive zeta potential of complexes, toxicity for cultured cells increases. However, these micelles are easily taken up by constricting the plasma membrane as endosomes from a cell. The PEI now buffers incoming protons, whereupon many chloride ions in the interior of the endosome lead to a swelling of the compartment due to the osmotic pressure. This effect of PEI is described as a proton sponge effect in the literature (Sonawane et al., JBC, 2003, Vol.278; No.45 (7) pp.44826-44831) and ultimately leads to the bursting of the endosome and to the Release of spiegelmers into the cytosol.
Der Nukleinsäure-PEI Komplex neigt aufgrund einer stark positiven Ladung zur Interaktion und Aggregation mit Serumproteinen, sowie zur bereits beschriebenen Zelltoxizität. So wurde in der Literatur beschrieben, dass hohe Dosen an Nukleinsäure-PEI Mizellen nach subkutaner und intravenöser Injektion in Ratten schnell zu einer Akkumulation in der Lunge und somit zu Embolien/ Infarkten führen kann. Die Lösung für das Problem stellt die Derivatisierung der Nukleinsäure mit 2kDa Polyethylenglycol (PEG) dar. Diese Reste legen sich wie ein Schild um die Mizellen und verhindern die Bindung an Serumproteine ( Ogris et al., Gene Therapy, 1999, 6(595-605). Des Weiteren wird das zeta-Potential auf +/- OmV abgesenkt, was zu einer geringeren Zelltoxizität bei gleichbleibender Pufferkapazität des PEI hinsichtlich des proton- sponge-effect führt.The nucleic acid-PEI complex, due to a strong positive charge, tends to interact and aggregate with serum proteins as well as to the cell toxicity already described. Thus, it has been reported in the literature that high doses of nucleic acid PEI micelles after subcutaneous and intravenous injection into rats can rapidly lead to accumulation in the lungs and thus to emboli / infarcts. The solution to the problem is the derivatization of the nucleic acid with 2kDa polyethylene glycol (PEG). These residues attach around the micelles like a shield and prevent binding to serum proteins (Ogris et al., Gene Therapy, 1999, 6 (595-605 Furthermore, the zeta potential is lowered to +/- OmV, resulting in lower cell toxicity with constant buffer capacity of the PEI with respect to the proton sponge effect.
3.2 Aktivität Spiegeimer mit PEG20003.2 Activity Spiegelmer with PEG2000
Die Leitkandidaten NOX-A und NOX-f wurden synthetisch als Aptamer und Spiegeimer mit 3 '-terminaler Aminogruppe hergestellt und anschließend über den Amino-Rest PEGyliert. Mittels Gleichgewichtsanbindungsassays konnte gezeigt werden, dass die PEGylierung keinen Einfluss auf die Bindungseigenschaften der Aptamere an das HMGAl a/b Fragment hat. Des Weiteren konnte mittels Kompetitionsassays mit rekombinantem Volllänge- HMGAl a/b gezeigt werden, dass auch die Bindung von Spiegelmeren an das Volllänge- HMGAl a/b unabhängig von der 3 '-terminalen PEGylierung ist (Fig. 9).Lead candidates NOX-A and NOX-f were prepared synthetically as aptamer and spiegelmer with a 3'-terminal amino group and subsequently PEGylated via the amino residue. By means of equilibrium binding assays it could be shown that the PEGylation has no influence on the binding properties of the aptamers to the HMGA1 a / b fragment. Furthermore, by means of competition assays with recombinant full-length HMGA1 a / b also show that the binding of Spiegelmeren to the full-length HMGA1 a / b is independent of the 3 '-terminal PEGylation (Figure 9).
3.3 Verpackung Spiegeimer3.3 Packaging of the spiegelmer
Die Verpackung von sterilem, PEGyliertem Spiegeimer erfolgte in PBS durch Zugabe von 25kDa querverzweigtem Polyethylenimine (PEI) (ALDRICH, Cat: 40,872-7) in einem Verhältnis von 2,5:1 des absoluten Stickstoffanteils des PEI zum absoluten Phosphat des Ribonukleinsäurerückgrats (N/P 2,5). Die sterile, autoklavierte PEI Lösung hatte eine Konzentration von 20OmM freien Stickstoffgruppen und wurde mit 1 M Salzsäure auf einen pH von 7,4 eingestellt. Das sterile filtrierte Spiegeimer wurde dabei mit einer Konzentration von bis zu 700 μM in IxPBS mit Ca/Mg vorgelegt und nach der Zugabe von steril filtriertem PEI für 30- 60 Minuten bei Raumtemperatur inkubiert. Idealerweise läuft die Komplexbildung bei möglichst geringer vorgelegter Konzentration an Spiegeimer ab, da hohe Konzentration an Spiegeimer zu unspezifisch großen Aggregaten fuhren. Die Bildung von Spiegelmer-Mizellen wurde mittels eines Farbstoff-Ausschluss-Assays gemessen. Dabei wurde bestimmt, wie viel Spiegeimer sich per Farbstoff vor und nach Verpackung in Mizellen nachweisen lässt. Als Farbstoff wurde RiboGreen (M. Probes) verwendet und die Fluoreszenz mit einem ELISA- Reader bestimmt. Je lμM Spiegeimer wurde in lOOμl IxPBS vorlegt und steigende Mengen an PEI zugegeben. In einer fluoreszenz-geeigneten 96-well Mikrotiterplatte wurden lOOμl 0,2μg/μl RiboGreen vorgelegt und nach einer Inkubationzeit des Mizellenansatzes von 30 Minuten bei Raumtemperatur je lOμl in die Mikrotiterplatte pipettiert. Ab einem N/P Verhältnis von 2 lagen mehr als 90% der Spiegelmere als Mizellen vor (Fig.10). PEI allein hatte dabei keinen Einfluss auf die Fluoreszenz des FarbstoffsSterile, PEGylated spiegelmer was packed in PBS by adding 25kDa branched-chain polyethylenimines (PEI) (ALDRICH, Cat: 40,872-7) in a ratio of 2.5: 1 absolute PEI to the absolute ribonucleic acid backbone phosphate (N / P 2,5). The sterile, autoclaved PEI solution had a concentration of 20 mM free nitrogen groups and was adjusted to pH 7.4 with 1 M hydrochloric acid. The sterile filtered Spiegeimer was introduced at a concentration of up to 700 uM in IxPBS with Ca / Mg and incubated after the addition of sterile-filtered PEI for 30- 60 minutes at room temperature. Ideally, the complex formation takes place with the lowest possible concentration of spiegelmer present, since high concentrations of spiegelmer lead to nonspecifically large aggregates. The formation of spiegelmer micelles was measured by a dye exclusion assay. It was determined how much Spiegeimer can be detected by dye before and after packaging in micelles. The dye used was RiboGreen (M. Probes) and the fluorescence was determined with an ELISA reader. 1 μl of spiegelmer was initially introduced in 100 μl of IxPBS and increasing amounts of PEI were added. In a 96-well microtiter plate suitable for fluorescence, 100 μl of 0.2 μg / μl RiboGreen were initially introduced and after an incubation period of the micelle batch of 30 minutes at room temperature, pipetted per 10 μl into the microtiter plate. From an N / P ratio of 2, more than 90% of the spiegelmers were in the form of micelles (FIG. 10). PEI alone had no influence on the fluorescence of the dye
3.4 Stabilität Spiegelmer-Micellen lμM Spiegeimermizellen wurden unter in Fig. 11 aufgeführten Bedingungen gelagert. Die Stabilität von Spiegelmer-Mizellen wurde mit unter Absatz 3.3 beschriebenen Farbstoff- Ausschluss-Assays gemessen. Eine Stabilitätsstudie der Mizellen zeigte, dass die Lagerung von Mizellen in unterschiedlichen Medien, sowie bei verschiedenen Temperaturen keinen Einfluss auf die Spiegelmer-Mizellen hat. In der Literatur beschieben ist auch die Gefriertrocknung von Ribozym/ PEI-Komplexen ohne Verlust der Eigenschaften des Ribozyms (Brus-C et al„ J. Control Release, 2004, Feb, 20, 95(1), 199-31) 3.5 Aufnahme von Spiegelmer-Micellen3.4 Stability of Spiegelmer Micelles lμM of Spikeimermicelles were stored under conditions listed in FIG. The stability of spiegelmer micelles was measured by dye exclusion assays as described in section 3.3. A stability study of the micelles showed that the storage of micelles in different media, as well as at different temperatures has no influence on the Spiegelmer micelles. The freeze-drying of ribozyme / PEI complexes without loss of the properties of the ribozyme (Brus-C et al. J. Control Release, 2004, Feb, 20, 95 (1), 199-31) is also described in the literature. 3.5 Recording spiegelmer micelles
Die intrazelluläre Aufnahme von Spiegeimer Mizellen wurde am Zellkultursystem von HS578T Zellen etabliert. IxIO4 HS578T Zellen wurden auf sterile 20mm Deckgläschenwur- den bis zu einer Konfluenz von 30-40% wachsen gelassen. 5 '-markiertes Spiegeimer NOX-A- 3'-PEG wurde mit einer N/P Ratio von 2,5:1 in Mizellen verpackt, in einer Konzentration von lμM zu den Zellen gegeben und für 16 Stunden bei 370C inkubiert. Als Kontrolle für die passive Aufnahme von Spiegelmeren wurde je lμM reines Fluoreszenz-markiertes Spiegeimer mit den Zellen inkubiert. Die Zellen wurden anschließend 3xlml IxPBS gewaschen und für 30 Minuten mit 3% Paraformaldehyd fixiert. Die Präparate wurden wiederum mit 3xlml IxPBS gewaschen, zur Färbung des Chromatins im Zellkern für weitere 10-20 Sekunden mit einer DAPI-Lösung (lμl Stock auf 10ml IxPBS) inkubiert, nochmals gewaschen und mit einer Paramountlösung eingedeckt. Die so vorbereiten Präparate wurden an einem Fluoreszenzmikroskop analysiert (Emission 488nm/ Extinktion 514-522nm).The intracellular uptake of spiegelmer micelles was established on the cell culture system of HS578T cells. Ixio 4 HS578T cells were grown on sterile 20mm Deckgläschenwur- the left to a confluency of 30-40% grow. 5 '-labeled Spiegeimer NOX-A-3'-PEG was treated with a N / P ratio of 2.5: 1 packaged in micelles added to a concentration of lμM to the cells and incubated for 16 hours at 37 0 C. As a control for the passive uptake of Spiegelmeren, 1 μl of pure fluorescence-labeled spiegelmer was incubated with the cells. The cells were then washed 3xlml IxPBS and fixed for 30 minutes with 3% paraformaldehyde. The preparations were again washed with 3xlml IxPBS, incubated for chromatin in the cell nucleus for a further 10-20 seconds with a DAPI solution (1 microlitre on 10 ml of IxPBS), washed again and covered with a Paramount solution. The prepared preparations were analyzed on a fluorescence microscope (emission 488nm / extinction 514-522nm).
Es konnte gezeigt werden, dass Spiegelmer-Mizellen eine erhöhte Transfektionsquantität gegenüber „nackten", nicht verpacktem Spiegeimer haben (Fig. 12)It has been shown that spiegelmer micelles have an increased transfection quantity compared to "naked", unpacked spiegelmer (FIG. 12).
Die Transfektionseffizienz lag dabei >95% der Gesamtzellen und zeigte keinen Einfluss auf die Morphologie der Zellen. Das 5 '-FITC-gekoppelte Spiegeimer war hauptsächlich im Zyto- sol und assoziiert an die Plasmamembran zu finden. Das punktuelle Verteilungsmuster weist auf einen Einschluss in Kompartimenten und das diffuse Muster auf freigesetztes Spiegeimer hin. Im Zellkern konnten nur ein geringes Signal an Spiegeimer detektiert werden.The transfection efficiency was> 95% of the total cells and showed no influence on the morphology of the cells. The 5'-FITC-coupled spiegelmer was mainly found in the cytosol and associated to the plasma membrane. The punctiform distribution pattern indicates inclusion in compartments and the diffuse pattern on liberated spiegelmer. In the cell nucleus, only a small signal could be detected at the spiegelmer.
3.6 Freisetzung von Spiegeimer3.6 Release of spiegelmer
Die punktuelle Verteilung des Spiegelmere im Zytosol und perinukleären Raum der H578T Zellen deutet auf eine Anreicherung in Kompartementen der Zellen, z.B. Endosomen hin. Zur Überprüfung der Freisetzung der Spiegelmere aus diesen Kompartementen wurde das Verteilungsmuster einzelner stark vergrößerter Zellen analysiert (Fig.13). Es konnte zusätzlich zu der punktuellen Lokalisation der Spiegelmere ein diffuses Verteilungsmuster im Zytosol und an der Plasmamembran festgestellt werden, was ein Hinweis auf die endosomale Freisetzung der Spiegelmeren ist. Dieses Muster konnte bei „nackten" Spiegeimer nicht festgestellt werden. Beispiel 4: Bioaktivität in vivoThe selective distribution of the spiegelmere in the cytosol and perinuclear space of the H578T cells indicates an accumulation in compartments of the cells, eg endosomes. To check the release of the spiegelmers from these compartments, the distribution pattern of single strongly enlarged cells was analyzed (Fig.13). In addition to the selective localization of the spiegelmers, a diffuse distribution pattern in the cytosol and at the plasma membrane could be detected, which is an indication of the endosomal release of spiegelmers. This pattern could not be determined with "naked" Spiegeimer. Example 4: Bioactivity in vivo
4.1 Proliferationsassay ohne PEI4.1 Proliferation Assay without PEI
Wirkung auf die Proliferation von MCF-7 ZellenEffect on the proliferation of MCF-7 cells
Die potentielle Rolle von HMGAl a/b bei der Zellteilung wurde mittels Proliferations- Assays untersucht. Zunächst wurde Spiegeimer in einer hohen Dosis als „nackte" Nukleinsäure in das Zellkulturmedium gegeben und das Wachstum der Zellen über die Zeit verfolgt. Die Brustkrebszelllinie MCF-7 wurde als Modell ausgesucht, da in diesen Zellen eine geringe(zu anta- gonisierende) Expression von HMGAl a/b gefunden, bzw. die Rolle von HMGAl a/b in der Proliferation dieser Zellen bereits in der Literatur beschrieben wurde. Reeves et al. (Reeves-R et al., Molecular and Cellular Biology, Jan 2001, p575-594) konnten zeigen, dass die Überexpression von HMGAl a/b in MCF-7 Zellen zu einer verstärkten Proliferation führt und die Inhibition von HMGAl a/b mittels exprimierter antisense-Konstrukte die Proliferation von MCF-7 Zellen inhibiert.The potential role of HMGA1 a / b in cell division was examined by proliferation assays. First, spiegelmer was added to the cell culture medium as a "naked" nucleic acid in a high dose and the growth of the cells was monitored over time.The breast cancer cell line MCF-7 was selected as a model, since in these cells a low (to be antagonized) expression of Or the role of HMGA1 a / b in the proliferation of these cells has already been described in the literature Reeves et al (Reeves-R et al., Molecular and Cellular Biology, Jan 2001, p575-594 ) were able to show that overexpression of HMGA1 a / b in MCF-7 cells leads to an increased proliferation and inhibition of HMGA1 a / b by expressed antisense constructs inhibits the proliferation of MCF-7 cells.
Durchführung/ MethodeImplementation / method
0,5 x 104 MCF-7 Zellen (ATCC) wurden in 96- well Platten (Costar) mit planem, durchsichtigem Boden ausgesät und für 16-24 Stunden in 100 μl RPMI 1640-Medium mit 10% fötalem Kälberserum (FCS) kultiviert. Anschließend wurden die Zellen mit PBS gewaschen und für weitere 48 Stunden mit Standardzellkulturmedium unter direkter Zugabe von steril filtriertem Spiegeimer kultiviert. Es folgte die Zugabe von lOμl einer Resazurin-Lösung (0,44 mM in PBS) zu den jeweiligen Ansätzen und die weitere Inkubation für 2 Stunden bei 37°C. Die Umsetzung von Resazurin durch den Stoffwechsel der Zelle korreliert direkt mit der Zellzahl. Die Farbänderung wurde in einem Fluostar Optima Multidetektions-Plattenlesegerät (BMG) gemessen (Emission 544 ran, Extinktion 590 ran). Jeder Wert wurde pro Experiment als Dreifachansatz bestimmt und auf die Werte von unbehandelten Kontrollzellen bezogen.0.5 × 10 4 MCF-7 cells (ATCC) were seeded in 96-well plates (Costar) with flat, transparent soil and cultured for 16-24 hours in 100 μl RPMI 1640 medium with 10% fetal calf serum (FCS) , Subsequently, the cells were washed with PBS and cultured for a further 48 hours with standard cell culture medium with the direct addition of sterile filtered spiegelmer. This was followed by the addition of 10 μl of a resazurin solution (0.44 mM in PBS) to the respective batches and further incubation for 2 hours at 37 ° C. The conversion of resazurin through the metabolism of the cell correlates directly with the cell number. The color change was measured in a Fluostar Optima multidetection plate reader (BMG) (emission 544 ran, extinction 590 ran). Each value was determined as a triplicate per experiment and related to the values of untreated control cells.
ErgebnisResult
NOX-A inhibierte nach 2 Tagen Dosis-abhängig die Proliferation von MCF-7 Zellen (n=12)NOX-A inhibited dose-dependent proliferation of MCF-7 cells after 2 days (n = 12)
(Fig. 14). Die maximale Hemmung der Proliferation auf ca. 30% des Wertes von unbehandel- ten Zellen wurde bei 40 μM gemessen. Bei Konzentrationen bis 40 μM konnte kein unspezifischer Effekt des inversen Kontroll-Spiegelmer festgestellt werden.(Fig. 14). The maximum inhibition of proliferation to about 30% of the value of untreated The cells were measured at 40 μM. At concentrations up to 40 μM, no nonspecific effect of the inverse control spiegelmer could be detected.
4.2 Proliferationsassay mit PEI4.2 Proliferation Assay with PEI
Wirkung von Spiegelmer-Mizellen auf die Proliferation von H- 1299 ZellenEffect of Spiegelmer micelles on the proliferation of H-1299 cells
Durchfuhrung/ MethodeExecution / method
IxIO4 NCI-H-1299 Zellen (Lungenkarzinomzellen; ATCC) wurden in 24-well Platten (Costar) mit planem, durchsichtigem Boden ausgesät und für 16-24 Stunden in ImI RPMI 1640 Medium mit 10% FCS kultiviert. Anschließend wurden die Zellen 2x mit PBS gewaschen und für weitere 3 Tage mit Zellkulturmedium mit 1% FCS und Spiegelmer-Mizellen kultiviert. Die Verpackung von sterilem, PEGyliertem Spiegeimer erfolgte zuvor in PBS durch Zugabe von 25kDa querverzweigtem Polyethylenimine (PEI) (Sigma) in einem Verhältnis von 2,5:1 des absoluten Stickstoffanteils des PEI zum absoluten Phosphat des Ribonukleinsäurerückgrats (N/P 2,5). Das sterile Spiegeimer wurde dabei mit einer Konzentration von 30 μM vorgelegt und nach der Zugabe des PEI für 30-60 Minuten bei Raumtemperatur inkubiert. Anschließend wurden die Spiegelmer-Mizellen mit Zellkulturmedium mit 1% FCS auf lμM verdünnt, direkt zu den gewaschenen Zellen gegeben und für 3 Tage bei 370C inkubiertIxIO 4 NCI-H-1299 cells (lung carcinoma cells, ATCC) were seeded in 24-well plates (Costar) with flat, transparent soil and cultured for 16-24 hours in ImI RPMI 1640 medium with 10% FCS. Subsequently, the cells were washed 2x with PBS and cultured for a further 3 days with cell culture medium containing 1% FCS and spiegelmer micelles. Sterile PEGylated spiegelmer was previously packed in PBS by addition of 25 kDa branched-chain polyethylenimine (PEI) (Sigma) in a ratio of 2.5: 1 of the absolute nitrogen content of the PEI to the absolute phosphate of the ribonucleic acid backbone (N / P2.5). , The sterile spiegelmer was introduced at a concentration of 30 uM and incubated after the addition of the PEI for 30-60 minutes at room temperature. Subsequently, the Spiegelmer micelles were diluted with cell culture medium containing 1% FCS on lμM, added directly to the washed cells and incubated for 3 days at 37 0 C.
Es folgte die Zugabe von 100 μl Resazurin-Lösung zu den jeweiligen Ansätzen und die weitere Inkubation für 2 Stunden bei 370C Die Umsetzung von Resazurin durch den Stoffwechsel der Zelle korreliert direkt mit der Zellzahl. lOOμl wurden den Ansätzen entnommen, in eine 96-well Platte überführt und die Farbänderung in einem Fluostar Optima Multidetektions- Plattenlesegerät (BMG) gemessen (Emission 544 nm, Extinktion 590 nm). Jeder Wert wurde pro Experiment als Doppelansatz bestimmt und auf die Werte von unbehandelten Kontrollzellen bezogen.This was followed by the addition of 100 μl of resazurin solution to the respective batches and the further incubation for 2 hours at 37 ° C. The conversion of resazurin by the metabolism of the cell correlates directly with the cell number. 100 μl was taken from the batches, transferred to a 96-well plate and the color change measured in a Fluostar Optima Multidetektions plate reader (BMG) (emission 544 nm, extinction 590 nm). Each value was determined as a double batch per experiment and related to the values of untreated control cells.
ErgebnisResult
Die Verwendung von PEI (N/P 2,5) bei 1 μM Spiegeimer zeigte zunächst keine Wirkung auf die Proliferation von Zellen. Durch Reduktion der Menge an FKS im Zellkulturmedium unter 1 % konnte gezeigt werde, dass die Transfektion mit Spiegelmer-Mizellen einen Einfluss auf die Proliferation von H- 1299 Zellen hat, welcher bei 10% FKS zuvor nicht sichtbar war (Fig 15). Möglicherweise stimuliert FKS die Proliferation so stark, dass der geringe Effekt nicht beobachtet werden konnte. Die Reduktion der FKS-Konzentration bei MCF-7 Zellen führte zum Absterben der Zellen über einem Zeitraum von 3 Tagen.The use of PEI (N / P 2.5) with 1 μM spiegelmer initially showed no effect on the proliferation of cells. By reducing the amount of FCS in the cell culture medium below 1% it was shown that transfection with Spiegelmer micelles has an influence on the proliferation of H-1299 cells, which was not previously visible in 10% FCS (FIG 15). FKS may stimulate proliferation so strongly that the low effect could not be observed. The reduction of the FCS concentration in MCF-7 cells resulted in the death of the cells over a period of 3 days.
4.3 Inhibition Tumormarker cdc25a (mit PEI)4.3 Inhibition Tumor Marker cdc25a (with PEI)
Wirkung auf die HMGA la/b vermittelte Regulation von Zellzyklusfaktoren am Beispiel des potentiellen Onkogens cdc25aEffect on the HMGA la / b-mediated regulation of cell cycle factors using the example of the potential oncogene cdc25a
Reeves et al. (Molecular and Cellular Biology, Jan 2001, p575-594) konnten mittels cDNA Arrays durch Überexpression von HMGAl a/b in MCF-7 Zellen zeigen, dass HMGAl a/b die Expression einer Vielzahl von Genen induziert. Bis zu 100-fach überexprimiert werden dabei auch Zellzyklus- und Wachstumsfaktoren, wie etwa das als potentielles Onkogen identifizierte cdc25a (cell-division-cycle 25a-Phosphatase), welches für die Kontrolle des Übergangs von der Gl zur S-Phase des Zellzyklus eine entscheidende Rolle spielt. Die Aktivierung von solchen Kontrollpunkten führt nach Hemmung der Zellzyklus-Progression entweder zur Transkription von Genen, die an der DNA-Reparatur beteiligt sind oder, falls die DNA- Schäden irreparabel sind, zur Induktion der Apoptose. Als Zellkultur-Testsystem wurden hierfür die H- 1299 Zellen ausgewählt, da diese bereits eine erhöhte Expression von HMGAl a/b zeigten.Reeves et al. (Molecular and Cellular Biology, Jan 2001, p575-594) could show by means of cDNA arrays by overexpression of HMGAl a / b in MCF-7 cells that HMGAl a / b induces the expression of a variety of genes. Cell-overexpression and growth factors, such as the cdc25a (cell-division-cycle 25a-phosphatase) identified as a potential oncogene, are also up to 100-fold overexpressed, which is crucial for controlling the transition from Gl to S-phase of the cell cycle Role play. Activation of such control points, following inhibition of cell cycle progression, either leads to the transcription of genes involved in DNA repair or, if the DNA damage is irreparable, to the induction of apoptosis. As a cell culture test system, the H-1299 cells were selected for this, since they already showed an increased expression of HMGA1 a / b.
Durchführung/ MethodeImplementation / method
1x104 H- 1299 Zellen wurden in 24-well Platten Platten (Costar) mit planem, durchsichtigem Boden ausgesät und für 16-24 Stunden in RPMI 1640-Medium mit 10% FCS kultiviert (Volumen 1 ml). Anschließend wurden die Zellen 2x mit PBS gewaschen und die Zellen für weitere 3 Tage mit Zellkulturmedium mit Spiegeimer-Mizellen mit 10% FCS kultiviert. Die Verpackung von sterilem, PEGyliertem Spiegeimer erfolgte zuvor in IxPBS durch Zugabe von 25kDa querverzweigten Polyethylenimine (PEI) (Sigma) in einem Verhältnis von 2,5:1 des absoluten Stickstoffanteils des PEI zum absoluten Phosphat des Ribonukleinsäurerückgrats (N/P 2,5). Das sterile Spiegeimer wurde dabei mit einer Konzentration von 30μM vorgelegt und nach der Zugabe des PEI für 30-60 Minuten bei Raumtemperatur inkubiert. Anschließend wurden die Spiegelmer-Mizellen mit Zellkulturmedium mit 1%FCS auf die jeweilige Konzentration verdünnt, direkt zu den gewaschenen Zellen gegeben und für 3 Tage bei 37°C inkubiert. Die Zellen wurden 2mal mit PBS gewaschen und mittels eines Zellschabers geerntet. Anschließend wurde die mRNA der Zellen mittels Roti-Quick-Kits (Roth, Cat.No.979.1) aus den Zellen isoliert und 0,2-1 μg Gesamt-RNA als Template für die PCR von cdc25a und GAPDH einsetzt.1x10 4 H-1299 cells were seeded in 24-well plates (Costar) with flat, transparent bottom and cultured for 16-24 hours in RPMI 1640 medium with 10% FCS (volume 1 ml). Subsequently, the cells were washed 2x with PBS and the cells cultured for a further 3 days with cell culture medium with 10 ml FCS spiegelmer micelles. The packaging of sterile, PEGylated spiegelmer was carried out beforehand in IxPBS by addition of 25 kDa cross-branched polyethyleneimines (PEI) (Sigma) in a ratio of 2.5: 1 of the absolute nitrogen content of the PEI to the absolute phosphate of the ribonucleic acid backbone (N / P 2.5). , The sterile spiegelmer was initially introduced at a concentration of 30 .mu.M and incubated after addition of the PEI for 30-60 minutes at room temperature. Subsequently, the spiegelmer micelles were diluted to the respective concentration with cell culture medium containing 1% FCS, added directly to the washed cells and incubated for 3 days at 37 ° C. The cells were washed twice with PBS and harvested by a cell scraper. Subsequently, the mRNA of the cells was isolated from the cells by means of Roti-Quick kits (Roth, Cat.No.979.1) and 0.2-1 μg total RNA was used as template for the PCR of cdc25a and GAPDH.
Die Primer für die Amplifikation von GAPDH waren: forward primer: 5'- ACATGTTCCAAT ATGATTCC-3' und reverse primer: 5-The primers for the amplification of GAPDH were: forward primer: 5'-ACATGTTCCAAT ATGATTCC-3 'and reverse primer: 5-
TGGACTCCACGACGTACTCAG-3' bei einer Annealingtemperatur von 510C , sowie für die Amplifikation von cdc25a : forward primer: 5 '-GAGGAGTCTCACCTGGAAGTACA-S ' und reverse primer 5 '-GCCATTCAAAACCAGATGCCATAA-3 ' bei einer Annelaingtempe- ratur von 59°C Die PCR Bedingungen waren wie folgt: 0,2-0,75μM Primer, l,5mM MgC12 und 0,2mM dNTPs. Alle 2 PCR Zyklen wurde je ein Aliquot von 5μl über PicoGreen quantifiziert und in Korrelation zu GAPDH als Beladungskontrolle ausgewertet: dabei wird im ersten Schritt für jede untersuchte Probe der s.g. „crossing-point"-Wert (CP) des Referenzgens vom CP Wertdes zu untersuchenden Gens subtrahiert (dCP=CPZielgen-CP Referenzgen). Als CP ist die Anzahl der PCR Zyklen definiert, die nötig sind um ein konstant definiertes Fluoreszenzniveau zu erreichen. Am CP befindet sich in allen Reaktionsgefäßen die gleiche Menge an neu synthetisierter DNA. Nach dieser Normierung wird vom dCP Wert der experimentell behandelten Proben der dCP Wert einer Kontrolle (in diesem Fall GAPDH) abgezogen; man kommt zum s.g. „delta-delta CT" Berechnungsmodell. Der relative Expressionsunterschied einer Probe zwischen Behandlung und der Kontrolle (Ratio), normalisiert zum Referenzgen und bezogen auf eine Standardprobe, ergibt sich aus der arithmetischen Formel 2" ddCPTGGACTCCACGACGTACTCAG-3 'at an annealing temperature of 51 0 C, and for the amplification of Cdc25A: forward primer: 5' -GAGGAGTCTCACCTGGAAGTACA-S 'and reverse primer 5' -GCCATTCAAAACCAGATGCCATAA-3 'at a Annelaingtempe- temperature of 59 ° C The PCR Conditions were as follows: 0.2-0.75μM primer, 1.5mM MgC12 and 0.2mM dNTPs. For each 2 PCR cycles, an aliquot of 5 μl was quantified over PicoGreen and evaluated in correlation to GAPDH as loading control: in the first step, the sg crossing point value (CP) of the reference gene is to be investigated by CP Wertdes for each sample examined Subtract gene (dCP = CP target CP reference gene) The CP defines the number of PCR cycles needed to achieve a constant defined fluorescence level, and the same amount of newly synthesized DNA is present on all CPs after normalization From the dCP value of the experimentally treated samples, the dCP value of a control (in this case GAPDH) is subtracted to arrive at the so-called "delta-delta CT" calculation model. The relative difference in expression of a sample between treatment and the control (ratio), normalized to the reference gene and relative to a standard sample, is given by the arithmetic formula 2 " ddCP
dCP=CP (cdc25a)- CP (GAPDH) ddCP= dCP (Behandlung Spiegeimer NOX-A)- dCP( Kontrolle: PBS oder NOX-A invers)dCP = CP (cdc25a) - CP (GAPDH) ddCP = dCP (treatment of spiegelmer NOX-A) - dCP (control: PBS or NOX-A inverse)
Ratio=2-ddCP Ratio = 2 ddCP
ErgebnisResult
Mittels RT-PCR konnten cdc25a und HMGA^ in MCF-7 und H- 1299 Zellen nachwiesen werden. MCF-7 Zellen zeigten bei einer geringen Expression von HMGAl a/b auch eine geringe Expression von cdc25a, wohingegen in H- 1299 Zellen HMGAl a/b und cdc25a stark exprimiert wurden. Die Transfektion von H- 1299 Zellen für 2 Tage mit HMGAl a/b bindenden Spiegelmeren führte zu einer deutlichen, dosisabhängigen Reduktion der Expression von cdc25a mRNA (Fig. 16 und Fig.17). Ein Kontroll-Spiegelmer zeigte bis 4μM keinen unspezifischen Effekt, weder auf die GAPDH noch auf die cdc25a mRNA Expression. Daraus kann geschlussfolgert werden, dass mittels Spiegelmeren die HMGA la/b induzierte Überexpression des potentiellen Onkogen cdc25a inhibiert werden kann.By means of RT-PCR cdc25a and HMGA1 could be detected in MCF-7 and H-1299 cells. MCF-7 cells also showed low expression of cdc25a with low expression of HMGA1 a / b, whereas in H-1299 cells HMGA1 a / b and cdc25a were strongly expressed. Transfection of H-1299 cells for 2 days with HMGAI a / b-binding Spiegelmeren resulted in a significant, dose-dependent reduction of the expression of cdc25a mRNA (Fig. 16 and Fig. 17). A control spiegelmer showed up to 4μM no nonspecific effect, neither on the GAPDH nor on the cdc25a mRNA expression. It can be concluded that the HMGA la / b induced overexpression of the potential oncogene cdc25a can be inhibited by means of spiegelmers.
Beispiel 5 Wirksamkeitsstudie Xenograft-ModellExample 5 Efficacy Study Xenograft Model
Wirkung von Spiegelmeren auf das Tumorwachstum in vivoEffect of Spiegelmers on tumor growth in vivo
Um die Hypothese zu überprüfen, dass HMGAl a/b bindende Spiegelmere das Wachstum von Tumoren in-vivo hemmen, wurden für die stark HMGAl a/b exprimierenden pankreaskarzi- nom Zellen PSN-I ein Xenograft Modell entwickelt. Auf Grundlage dieses Modells wurde ein Therapieversuch mit 2mg/kg NOX-A Spiegelmer-Mizellen bei einer N/P 2,5 durchgeführt (siehe Beispiel 3, Absatz 3.3).To test the hypothesis that HMGAI a / b-binding Spiegelmers inhibit the growth of tumors in vivo, a xenograft model was developed for the pancreatic carcinoma cells PSN-I expressing HMGA1 a / b. Based on this model, a treatment trial with 2mg / kg NOX-A Spiegelmer micelles was performed on an N / P 2.5 (see Example 3, Section 3.3).
Durchfuhrung/ MethodeExecution / method
Männlichen Nacktmäusen (NMRI: nu/nu) (Gruppengröße n = 8) wurden jeweils 107 PSN-I Zellen (ECACC) subkutan in die Flanke injiziert und das Tumorwachstum über 22 Tage verfolgt. Die Tiere hatten ein mittleres Gewicht von 25-27 g und waren 6-8 Wochen alt. Das aktive Spiegeimer NOX- A-3 'PEG und das inverse Kontroll-Spiegelmers INV-3'PEG wurden wie oben beschrieben durch Zugabe von PEI in einem Verhältnis von N/P 2,5 in Mizellen verpackt. lOOμl der Spiegeimer-Mizellen-Suspension (entsprechend 3,46 nmol/Tier bzw 2 mg/kg) wurden jeweils täglich in Tumornähe subkutan injiziert. Die Messung des Tumorvolumens und Körpergewichts erfolgte 3x die Woche. Die Tiere wurden am Tag 22 getötet und die Verteilung von NOX-A im Plasma, Leber, Niere und Tumor quantifiziert.Male nude mice (NMRI: nu / nu) (group size n = 8) were each injected subcutaneously with 10 7 PSN-I cells (ECACC) into the flank and tumor growth was monitored for 22 days. The animals had a mean weight of 25-27 g and were 6-8 weeks old. The active spiegelmer NOX-A-3'PEG and the inverse control spiegelmer INV-3'PEG were packed into micelles as described above by adding PEI in a ratio of N / P 2.5. 100 μl of the spiegelmer-micellar suspension (corresponding to 3.46 nmol / animal or 2 mg / kg) were injected subcutaneously each day near the tumor. The measurement of tumor volume and body weight took place 3 times a week. The animals were killed on day 22 and the distribution of NOX-A in the plasma, liver, kidney and tumor was quantified.
Dazu wurden die Gewebe in Hybridisierungspuffer (0,5x SSC pH 7,0; 0,5% (w/v) SDSarco- sinat) homogenisiert und 10 min bei 4000χ g zentrifugiert. Die gewonnenen Überstände wurden bis zur weiteren Benutzung bei -200C gelagert.For this purpose, the tissues were homogenized in hybridization buffer (0.5 × SSC pH 7.0, 0.5% (w / v) SDSaccharide) and centrifuged at 4000 × g for 10 minutes. The supernatants obtained were stored until further use at -20 0 C.
Die Menge an Spiegeimer in den Plasmaproben und in den Gewebhomogenaten wurde mittels eines Hybridisierungsassays untersucht (Drolet et al. (2000) Pharm.Res. 17:1503). Der Hybri- disierungsassay basiert auf folgendem Prinzip: das nachzuweisende Spiegeimer (L-RNA- Molekül) wird an eine immobilisierte L-DNA-Oligonukleotidsonde ( = Capture-Sonde NOX- A; hier: 51- CCCATATCCACCCACGTATCAGCCTTTTTTTT-NH2 -3"; komplementär zum 5 '-Ende von HMGAla/b-NOX-A) hybridisiert und mit einer biotinylierten Nachweis-L-DNA- Sonde (= Detektor-Sonde NOX-A; hier: S'-Biotin-The amount of spiegelmer in the plasma samples and in the tissue homogenates was examined by a hybridization assay (Drolet et al (2000) Pharm. Res. 17: 1503). The hybridization assay is based on the following principle: the spiegelmer (L-RNA molecule) to be detected is bound to an immobilized L-DNA oligonucleotide probe (= capture probe NOX-). A; here: 5 1 - CCCATATCCACCCACGTATCAGCCTTTTTTT-NH2 -3 "; complementary to the 5 'end of HMGAla / b-NOX-A) and hybridized with a biotinylated detection L-DNA probe (= detector probe NOX-A, here: S'-biotin
TTTTTTTTGGCTGAAACCACCCACATGG-3'; komplementär zum 3'-Ende von HMGAla/b-NOX-A) detektiert. Dazu wird ein Streptavidin-Alkalische-Phosphatase- Konjugat in einem weiteren Schritt an den Komplex gebunden. Nach Zugabe eines Chemilu- mineszenz-Substrats wird Licht generiert und in einem Luminometer gemessen.TTTTTTTTGGCTGAAACCACCCACATGG-3 '; complementary to the 3 'end of HMGAla / b-NOX-A). For this purpose, a streptavidin-alkaline phosphatase conjugate is bound in a further step to the complex. After addition of a chemiluminescent substrate, light is generated and measured in a luminometer.
Immobilisierung der Oligonukleotid-Sonde: 100 μl der Capture-Sonde (0,75 pmol/ml in Kopplungspuffer: 500 mM Na2HPO4 pH 8,5, 0,5 mM EDTA) wurden pro well (Vertiefung einer Platte) in DNA BIND Platten (Corning Costar) überfuhrt und über Nacht bei 4°C inkubiert. Anschließend wurde 3 x mit je 200 μl Kopplungspuffer gewaschen und für 1 h bei 37°C mit je 200 μl Blockierungspuffer (0,5% (w/v) BSA in Kopplungspuffer) inkubiert. Nach nochmaligem Waschen mit 200 μl Kopplungspuffer und 3χ 200 μl Hybridisierungspuffer können die Platten zum Nachweis verwendet werden.Immobilization of the oligonucleotide probe: 100 μl of capture probe (0.75 pmol / ml in coupling buffer: 500 mM Na 2 HPO 4 pH 8.5, 0.5 mM EDTA) was added per well (well of a plate) in DNA BIND Plates (Corning Costar) and incubated overnight at 4 ° C. The mixture was then washed 3 × with 200 μl of coupling buffer and incubated for 1 h at 37 ° C. with 200 μl each of blocking buffer (0.5% (w / v) BSA in coupling buffer). After washing again with 200 μl of coupling buffer and 3 × 200 μl hybridization buffer, the plates can be used for detection.
Hybridisierung und Nachweis: 10 μl EDTA Plasma oder Gewebehomogenat wurden mit 90 μl Detektionspuffer (2 pmol/μl Detektor-Sonde in Hybridisierungspuffer) gemischt und zentrifugiert. Je nach Bedarf erfolgten weitere Verdünnungen. Anschliessend wurden die Ansätze bei 950C für 10 min denaturiert, in die entsprechend vorbereiteten DNA-BIND wells (s.o.) transferiert und für 45 min bei ca. 400C inkubiert. Danach folgten Waschschritte: 2χ 200 μl Hybridisierungspuffer und 3χ 200 μl Ix TBS/Tween20 (20 mM Tris-Cl pH 7,6, 137 mM NaCl, 0,1 % (v/v) Tween 20). 1 μl Streptavidin-Alkalische-Phosphatase-Konjugat (Promega) wurden mit 5 ml Ix TBS/Tween 20 verdünnt. 100 μl des verdünnten Konjugats wurden pro well zugegeben und für eine Stunde bei Raumtemperatur inkubiert. Es folgten Waschschritte: 2χ 200 μl Ix TBS/Tween 20 und 2χ 200 μl Ix Assay-Puffer (20 mM Tris-Cl pH 9,8, 1 mM MgCl2). Abschließend wurden 100 μl CSPD „Ready-To-Use Substrate" (Applied Biosystems) zugegeben, 30 min bei Raumtemperatur inkubiert und die Chemilumines- zenz in einem Fluostar Optima Multidetektions-Plattenlesegerät (BMG) gemessen. ErgebnisHybridization and detection: 10 μl EDTA plasma or tissue homogenate were mixed with 90 μl detection buffer (2 pmol / μl detector probe in hybridization buffer) and centrifuged. Depending on requirements, further dilutions were made. Subsequently, the batches were denatured at 95 ° C. for 10 minutes, transferred to the appropriately prepared DNA BIND wells (see above) and incubated at 40 ° C. for 45 minutes. This was followed by washing steps: 2 × 200 μl hybridization buffer and 3 × 200 μl Ix TBS / Tween20 (20 mM Tris-Cl pH 7.6, 137 mM NaCl, 0.1% (v / v) Tween 20). 1 μl of streptavidin-alkaline phosphatase conjugate (Promega) was diluted with 5 ml of Ix TBS / Tween 20. 100 μl of the diluted conjugate was added per well and incubated for one hour at room temperature. Washing steps followed: 2 × 200 μl of Ix TBS / Tween 20 and 2 × 200 μl of Ix assay buffer (20 mM Tris-Cl pH 9.8, 1 mM MgCl 2 ). Finally, 100 μl CSPD "Ready-To-Use Substrates" (Applied Biosystems) were added, incubated for 30 min at room temperature and the chemiluminescence measured in a Fluostar Optima Multidetection Plate Reader (BMG). Result
In einem Vorversuch hatte sich gezeigt, dass H- 1299 Zellen nach Transplantation als Tumor deutlich langsamer wuchsen als PSN-I und bei Vergleich der einzelnen Tiere ein inhomogenes Tumorwachstum zeigten und daher nicht als Xenograft-Modell für eine Therapiestudie geeignet erschienen. PSN-I Zellen zeigten innerhalb von 22 Tagen ein aggressives Tumorwachstum. Es konnte gezeigt werden, dass NOX-A-Mizellen bei einer Dosis von 2mg/kg das Wachstum von PSN-I Tumoren deutlich gegenüber der PBS Kontrolle verringern (Fig. 18 ). Das Gewicht der Tiere war von der Behandlung mit Spiegelmer-Mizellen unbeeinflusst. Das Kontroll-Spiegelmer zeigte keine unspezifische Inhibition des Tumorwachstums und hatte ebenfalls keine Wirkung auf das Gewicht der Tiere. Die Unterschiede der Tumorgrößen waren ab Tag 10 der Behandlung mit NOX- A3 'PEG Mizellen gegenüber nicht behandelten Tieren (PBS Kontrolle) signifikant bzw. hoch signifikant (student's t-Test). Die Endpunkt- Analyse nach 22 Tagen zeigte eine hoch signifikante, spezifische Verringerung des Tumorwachstums (p=0,0098 gegenüber PBS und p=0,022 gegenüber inversem Kontroll-Spiegelmer) (Fig. 19). PBS behandelte Mäuse zeigten einen durchschnittliches Tumorwachstum von 2,5 cm3, Tiere behandelt mit Kontroll-Spiegelmer ein durchschnittliches Tumorvolumen von 2,6 cm3 und NOX-A behandelte Tiere ein durchschnittliches Tumorvolumen von 1 ,2 cm3 nach 22 Tagen. (Box-andWhisker-Analyse). Dies entspricht einer Reduktion des Tumorwachstums um mehr als 50%.In a preliminary experiment, it had been shown that H-1299 cells after tumor transplantation grew much slower than PSN-I and showed inhomogeneous tumor growth when comparing the individual animals and therefore did not appear suitable as a xenograft model for a therapeutic study. PSN-I cells showed aggressive tumor growth within 22 days. It could be shown that NOX-A micelles at a dose of 2 mg / kg significantly reduce the growth of PSN-I tumors compared to the PBS control (FIG. 18). The weight of the animals was unaffected by treatment with spiegelmer micelles. The control spiegelmer showed no nonspecific inhibition of tumor growth and also had no effect on the weight of the animals. Tumor size differences were significantly or highly significant from day 10 of treatment with NOX-A3 'PEG micelles over untreated animals (PBS control) (student's t-test). Endpoint analysis at 22 days demonstrated a highly significant, specific reduction in tumor growth (p = 0.0098 versus PBS and p = 0.022 versus inverse control spiegelmer) (Figure 19). Mice treated with PBS showed an average tumor growth of 2.5 cm 3 , animals treated with control spiegelmer an average tumor volume of 2.6 cm 3 and NOX-A treated animals an average tumor volume of 1.2 cm 3 after 22 days. (Box andWhisker analysis). This corresponds to a reduction of tumor growth by more than 50%.
Die Analyse der Gewebeverteilung von NOX-A zeigte eine hohe Konzentration im Tumor (Fig. 20).Analysis of the tissue distribution of NOX-A showed a high concentration in the tumor (Figure 20).
Beispiel 6: Vergleich der in vivo Gewebeverteilung von verpackten und unverpackten SpiegeimerExample 6: Comparison of in vivo tissue distribution of packaged and unpacked spiegelmer
Zur Überprüfung der effizienten Einschleusung von Spiegeimer Mizellen wurde ein nicht funktionelles Spiegeimer (Proof Of Concept = POC) am 3 '-Ende mit PEG 2kDa PEGyliert und mit einer Stickstoff/ Phosphat Ratio (N/P) von 2,5 in Mizellen verpackt (siehe Beispiel 3, Absatz 3.3). Analog zu dem in Beispiel 5 beschriebenen Versuchsaufbau wurde dieser Ansatz mit in Mizellen verpackten Spiegeimer sowie freiem, unverpackten Spiegeimer durchgeführt. Durchführung/ MethodeTo verify the efficient incorporation of spiegelmer micelles, a non-functional Proof Of Concept (POC) was PEGylated at the 3 'end with PEG 2kDa and packaged in micelles at a nitrogen / phosphate ratio (N / P) of 2.5 (see Example 3, paragraph 3.3). Analogously to the experimental set-up described in Example 5, this approach was carried out with micellar-packed spiegelmer and free, unpacked spiegelmer. Implementation / method
Männlichen Nacktmäusen (NMRI: nu/nu) (Gruppengröße n = 8) wurden jeweils 107 PSN-I Zellen (ECACC) subkutan in die Flanke injiziert und das Tumorwachstum über 25 Tage verfolgt. Die Tiere hatten ein mittleres Gewicht von 25-27 g und waren 6-8 Wochen alt. Das nicht funktionelles Spiegeimer POC-3 'PEG wurde wie oben beschrieben durch Zugabe von PEI in einem Verhältnis von N/P 2,5 in Mizellen verpackt. Als Kontrolle für die nicht PEI vermittelte Einschleusung von Spiegeimer diente nicht in Mizellen verpacktes Spiegeimer POC-3'PEG. lOOμl der Spiegelmer-Mizellen-Suspension bzw. Spiegeimer Lösung (entsprechend 1500 nmol/kg bzw. 2000 nmol/kg) wurden jeweils täglich in Tumornähe subkutan injiziert. Die Messung des Tumorvolumens und Körpergewichts erfolgte 3x die Woche. 24 bzw. 96 Stunden nach der letzten Injektion wurden je zwei Tiere pro Gruppe getötet und die Verteilung von POC-3TEG (verpackt/unverpackt) im Plasma, Gehirn, Herz, Lunge, Leber, Niere, Gallenblase, Bauchspeicheldrüse und Tumor quantifiziert.Male nude mice (NMRI: nu / nu) (group size n = 8) were each injected subcutaneously with 10 7 PSN-I cells (ECACC) into the flank and tumor growth was monitored for 25 days. The animals had a mean weight of 25-27 g and were 6-8 weeks old. The non-functional spiegelmer POC-3 'PEG was packed in micelles as described above by the addition of PEI in a ratio of N / P 2.5. As a control for the non-PEI mediated injection of Spiegeimer served not micellar packed Spiegeimer POC-3'PEG. 100 μl of the spiegelmer-micellar suspension or spiegelmer solution (corresponding to 1500 nmol / kg or 2000 nmol / kg) were injected subcutaneously each day near the tumor. The measurement of tumor volume and body weight took place 3 times a week. Two animals per group were sacrificed 24 and 96 hours after the last injection and the distribution of POC-3TEG (packed / unpacked) in the plasma, brain, heart, lung, liver, kidney, gall bladder, pancreas and tumor was quantified.
Dazu wurden die Gewebe in Hybridisierungspuffer (0,5χ SSC pH 7,0; 0,5% (w/v) SDSarco- sinat) homogenisiert und 10 min bei 4000χ g zentrifugiert. Die gewonnenen Überstände wurden bis zur weiteren Benutzung bei -2O0C gelagert.For this purpose, the tissues were homogenized in hybridization buffer (0.5% SSC pH 7.0, 0.5% (w / v) SDSaccharide) and centrifuged for 10 min at 4000 g. The supernatants were stored at -2O 0 C until further use.
Die Menge an Spiegeimer in den Plasmaproben und in den Gewebhomogenaten wurde mittels eines Hybridisierungsassays untersucht (Drolet et al. (2000) Pharm.Res. 17:1503). Der Hybri- disierungsassay basiert auf folgendem Prinzip: das nachzuweisende Spiegeimer (L-RNA- Molekül) wird an eine immobilisierte L-DNA-Oligonukleotidsonde ( = Capture-Sonde POC ; hier: 5'- NH2(C7)-TTTTTTTTTAGCTCTGCACAGCGCT-3'; komplementär zum 3'-Ende von POC) hybridisiert und mit einer biotinylierten Nachweis-L-DNA-Sonde (= Detektor- Sonde POC; hier: 5'-CCGCATCAGACCGAGTTTCCTTATTTTTTTT-Biotin-3'; komplementär zum 5'-Ende von POC) detektiert. Dazu wird ein Streptavidin-Alkalische- Phosphatase-Konjugat in einem weiteren Schritt an den Komplex gebunden. Nach Zugabe eines Chemilumineszenz-Substrats wird Licht generiert und in einem Luminometer gemessen.The amount of spiegelmer in the plasma samples and in the tissue homogenates was examined by a hybridization assay (Drolet et al (2000) Pharm. Res. 17: 1503). The hybridization assay is based on the following principle: the spiegelmer (L-RNA molecule) to be detected is bound to an immobilized L-DNA oligonucleotide probe (= capture probe POC, here: 5'-NH 2 (C7) -TTTTTTTTAGCTCTGCACAGCGCT-3 '; complementary to the 3 'end of POC) and detected with a biotinylated detection L-DNA probe (= detector probe POC, here: 5'-CCGCATCAGACCGAGTTTCCTTATTTTTTTT-biotin-3', complementary to the 5 'end of POC) , For this purpose, a streptavidin-alkaline phosphatase conjugate is bound in a further step to the complex. After adding a chemiluminescent substrate, light is generated and measured in a luminometer.
Immobilisierung der Oligonukleotid-Sonde: 100 μl der POC-Capture-Sonde (0,75 pmol/ml in Kopplungspuffer: 500 mM Na2HPO4 pH 8,5, 0,5 mM EDTA) wurden pro well (Vertiefung einer Platte) in DNA BIND Platten (Corning Costar) überführt und über Nacht bei 4°C inku- biert. Anschließend wurde 3 x mit je 200 μl Kopplungspuffer gewaschen und für 1 h bei 37°C mit je 200 μl Blockierungspuffer (0,5% (w/v) BSA in Kopplungspuffer) inkubiert. Nach nochmaligem Waschen mit 200 μl Kopplungspuffer und 3χ 200 μl Hybridisierungspuffer können die Platten zum Nachweis verwendet werden.Immobilization of the oligonucleotide probe: 100 μl of the POC capture probe (0.75 pmol / ml in coupling buffer: 500 mM Na 2 HPO 4 pH 8.5, 0.5 mM EDTA) were incubated per well (well of a plate) in DNA BIND plates (Corning Costar) and incubated overnight at 4 ° C. biert. The mixture was then washed 3 × with 200 μl of coupling buffer and incubated for 1 h at 37 ° C. with 200 μl each of blocking buffer (0.5% (w / v) BSA in coupling buffer). After washing again with 200 μl of coupling buffer and 3 × 200 μl hybridization buffer, the plates can be used for detection.
Hybridisierung und Nachweis: 10 μl EDTA Plasma oder Gewebehomogenat wurden mit 90 μl Detektionspuffer (2 pmol/μl POC-Detektor-Sonde in Hybridisierungspuffer) gemischt und zentrifügiert. Je nach Bedarf erfolgten weitere Verdünnungen. Anschliessend wurden die Ansätze bei 950C für 10 min denaturiert, in die entsprechend vorbereiteten DNA-BIND wells (s.o.) transferiert und für 45 min bei ca. 40°C inkubiert. Danach folgten Waschschritte: 2χ 200 μl Hybridisierungspuffer und 3χ 200 μl Ix TBS/Tween20 (20 mM Tris-Cl pH 7,6, 137 mM NaCl, 0,1 % (v/v) Tween 20). 1 μl Streptavidin-Alkalische-Phosphatase-Konjugat (Promega) wurden mit 5 ml Ix TBS/Tween 20 verdünnt. 100 μl des verdünnten Koηjugats wurden pro well zugegeben und für eine Stunde bei Raumtemperatur inkubiert. Es folgten Waschschritte: 2x 200 μl Ix TBS/Tween 20 und 2χ 200 μl Ix Assay-Puffer (20 mM Tris-Cl pH 9,8, 1 mM MgCl2). Abschließend wurden 100 μl CSPD „Ready-To-Use Substrate" (Applied Biosystems) zugegeben, 30 min bei Raumtemperatur inkubiert und die Chemilumines- zenz in einem Fluostar Optima Multidetektions-Plattenlesegerät (BMG) gemessen.Hybridization and detection: 10 μl EDTA plasma or tissue homogenate were mixed with 90 μl detection buffer (2 pmol / μl POC detector probe in hybridization buffer) and centrifuged. Depending on requirements, further dilutions were made. Subsequently, the batches at 95 0 C for 10 min were denatured, (so) is transferred into the prepared corresponding to DNA-BIND wells and incubated for 45 min at 40 ° C. This was followed by washing steps: 2 × 200 μl hybridization buffer and 3 × 200 μl Ix TBS / Tween20 (20 mM Tris-Cl pH 7.6, 137 mM NaCl, 0.1% (v / v) Tween 20). 1 μl of streptavidin-alkaline phosphatase conjugate (Promega) was diluted with 5 ml of Ix TBS / Tween 20. 100 μl of the diluted co-conjugate was added per well and incubated for one hour at room temperature. Washing steps followed: 2 × 200 μl Ix TBS / Tween 20 and 2 × 200 μl Ix assay buffer (20 mM Tris-Cl pH 9.8, 1 mM MgCl 2 ). Finally, 100 μl CSPD "Ready-To-Use Substrates" (Applied Biosystems) were added, incubated for 30 min at room temperature and the chemiluminescence measured in a Fluostar Optima Multidetection Plate Reader (BMG).
ErgebnisResult
Die Analyse der Gewebeverteilung des nicht funktionellen Spiegeimers POC-3 'PEG, welches in Mizellen verpackt wurde, zeigte nach 24 Stunden eine signifikant höhere Konzentration im Tumorgewebe (24,925 +/- 13,301 pmol/mg) als nicht verpacktes Spiegeimer (0,840 +/- 0,255 pmol/mg) (Fig. 21 A). Während die Konzentration des verpackten Spiegeimers sich nach weiteren drei Tagen (96 Stunden) halbiert hatte (11,325 +/- 7,050 pmol/mg), konnte vom unverpackten Spiegeimer nur noch eine sehr geringe Menge (0,120 +/- 0,057 pmol/mg) nachgewiesen werden.Analysis of the tissue distribution of the non-functional spiegelmer POC-3 'PEG packaged in micelles showed a significantly higher tumor tissue concentration (24.925 +/- 13.301 pmol / mg) at 24 hours than unpackaged spiegelmer (0.840 +/- 0.255 pmol / mg) (Figure 21A). While the concentration of the packaged spiegelmer was halved after another three days (96 hours) (11.325 +/- 7.050 pmol / mg), only a very small amount (0.120 +/- 0.057 pmol / mg) could be detected from the unpacked spiegelmer ,
Der Plasmaspiegel von nicht verpacktem Spiegeimer (2,950 +/- 0,438 pmol/ml) nach 24 Stunden war vergleichbar mit dem von PEI verpacktem Spiegeimer (1,930 +/- 2,729 pmol/ml). Nach 96 Stunden zeigten sich deutliche Unterschiede, wobei etwa die vierfache Menge des verpackten gegenüber dem unverpackten Spiegeimer nachgewiesen werden konnte.The plasma level of unpacked spiegelmer (2,950 +/- 0,438 pmol / ml) after 24 hours was comparable to the PEI-packed spiegelmer (1,930 +/- 2,729 pmol / ml). After 96 hours, there were clear differences, with about four times Quantity of the packaged compared to the unpacked Spiegeimer could be detected.
Eine leichte Anreicherung in der Niere nach 24 Stunden konnte für beide Formulierungen beobachtet werden, wohingegen nur für nicht verpacktes Spiegeimer eine geringe Anreicherung in der Leber und Gallenblasen gefunden wurde. Nach 96 Stunden konnten in Leber und Niere für beide Formulierungen nur noch geringe Mengen an Spiegeimer nachgewiesen werden. Dahingegen konnte für verpacktes im Vergleich zum unverpacktem Spiegeimer leicht erhöhte Werte in der Gallenblase und Bauchspeicheldrüse (jedoch hohe Standardabweichung) beobachtet werden.A slight accumulation in the kidney after 24 hours could be observed for both formulations, whereas only a small accumulation in the liver and gall bladder was found for unpackaged spiegelmer. After 96 hours, only small amounts of spiegelmer could be detected in liver and kidney for both formulations. On the other hand, slightly increased levels in the gallbladder and pancreas (but high standard deviation) could be observed for packaged spiegelmer compared to unpacked spiegelmer.
Zusammenfassend, konnte im Vergleich der Gewebeverteilung (24 bzw. 96 Stunden nach letzter Injektion) von Spiegelmeren in An- und Abwesenheit von PEI gezeigt werden, dass Spiegelmer-Mizellen eine deutlich verlängerte Verweildauer im Plasma und Tumor im Vergleich zu nicht verpacktem Material aufweisen (Abb. 21B) und somit einen vielversprechenden Ansatz zur Verwendung von Spiegelmeren gegen intrazelluläre Zielmoleküle darstellen.In summary, comparing the tissue distribution (24 and 96 hours after the last injection) of spiegelmers in the presence and absence of PEI showed that spiegelmer micelles have a significantly longer residence time in plasma and tumor compared to unpackaged material (Fig 21B) and thus represent a promising approach for the use of spiegelmers against intracellular target molecules.
Die folgenden Literaturstellen werden hierin durch Bezugnahme aufgenommen.The following references are incorporated herein by reference.
Abe et al. J Gastroenterol. 2003 ; 38, 1144-9 Abe N et al (1999). Cancer Res 59:1169-1174 Abe N et al (2000). Cancer Res 60:3117-3122 Abe N et al (2002). Pancreas 25:198-204 Anand A & Chada K (2000). Nat Genet 24 :377-380 Balcercak et al, Postepy Biochem, 2005; 51(3):261-9 Balcerczak et al Pathol Res Pract 2003; 199, 641-6 Baldassarre G et al (2003). Mol Cell Biol 23:2225-2238 Bandiera S et al (1998). Cancer Res 58:426-431 Battista S et al (1998) Oncogene 17:377-385 Beige G et al (1992). Cell Biol Int Rep 16 :339-347 Berlingieri MT et al. (1995). Mol Cell Biol 15:1545-1553 Birdsal SH et al (1992). Cancer Gen Cytogen 60:74-77 Bridge JA et al (1992). Cancer Detect Prevent 16:215-219 Bliese et al. Int. J Gynevol Pathol 2006 Jan, 65-9 Bullerdiek J et al (1987). Cytogenet Cell Genet 45 : 187-190 Bussemakers MJG et al (1991). Cancer Res 51 :606-611 Chada K et al (2004). US Patent 6,756,355 Chang et al. Dig Dis Sei, 2005 Oct, 1764-70 Chau KY et al (2000). J Neurosci 20 :7317-7324 Chau KY et al (2003). Mol Med 9 : 154-165Abe et al. J Gastroenterol. 2003; 38, 1144-9 Abe N et al (1999). Cancer Res 59: 1169-1174 Abe N et al (2000). Cancer Res 60: 3117-3122 Abe N et al (2002). Pancreas 25: 198-204 Anand A & Chada K (2000). Nat Genet 24: 377-380 Balcercak et al, Postepy Biochem, 2005; 51 (3): 261-9 Balcerczak et al Pathol Res Pract 2003; 199, 641-6 Baldassarre G et al (2003). Mol Cell Biol 23: 2225-2238 Bandiera S et al (1998). Cancer Res 58: 426-431 Battista S et al (1998) Oncogene 17: 377-385 Beige G et al (1992). Cell Biol Int Rep. 16: 339-347 Berlingieri MT et al. (1995). Mol Cell Biol 15: 1545-1553 Birdsal SH et al (1992). Cancer Gene Cytogen 60: 74-77 Bridge JA et al (1992). Cancer Detect Prevent 16: 215-219 Bliese et al. Int. J Gynevol Pathol 2006 Jan, 65-9 Bullerdiek J et al (1987). Cytogenet Cell Genet 45: 187-190 Bussemakers MJG et al (1991). Cancer Res 51: 606-611 Chada K et al (2004). U.S. Patent 6,756,355 Chang et al. Dig Dis Sei, 2005 Oct, 1764-70 Chau KY et al (2000). J Neurosci 20: 7317-7324 Chau KY et al (2003). Mol Med 9: 154-165
Chen et al. Cancer Epidemiol Biomarkers Prev 2004 Jan, 30-3Chen et al. Cancer Epidemiol Biomarkers Prev 2004 Jan, 30-3
Chiappetta et al. Clin Cancer Res. 2004 Nov, 7634-44Chiappetta et al. Clin Cancer Res. 2004 Nov, 7634-44
Chiappetta G et al (1995). Oncogene 10:1307-1314Chiappetta G et al (1995). Oncogene 10: 1307-1314
Chiappetta G et al (1996). Oncogene 13:2439-2446Chiappetta G et al (1996). Oncogene 13: 2439-2446
Chiappetta G et al (1998). Cancer Res 58:4193-4198Chiappetta G et al (1998). Cancer Res 58: 4193-4198
Chiappetta G et al (2001). Int J Cancer 91 :147-151Chiappetta G et al (2001). Int J Cancer 91: 147-151
Chin MT et al (1999). J Mol Cell Cardiol 31 :2199-2205Chin MT et al (1999). J Mol Cell Cardiol 31: 2199-2205
Chuma et al, Keio J Med 2004 Jun, 90-7Chuma et al, Keio J Med 2004 Jun, 90-7
Cuff CA et al (2001). J Clin Invest 108 .1031-1040Cuff CA et al (2001). J Clin Invest 108.1031-1040
Czyz et al. Langenbecks Arch Surg 2004, Jun, 193-7Czyz et al. Langenbeck's Arch Surg 2004, Jun, 193-7
Dal Cin P et al (1993). Genes Chromosomes Cancer 8:131-133Dal Cin P et al (1993). Genes Chromosome Cancer 8: 131-133
Dal Cin P et al (1995). Cancer Res 55:1565-1568Dal Cin P et al (1995). Cancer Res 55: 1565-1568
Diana F et al (2001). J Biol Chem 276 :11354-11361Diana F et al (2001). J Biol Chem 276: 11354-11361
Dolde CE et al (2002). Breast Cancer Res Treat 71 : 181 -191Dolde CE et al (2002). Breast Cancer Res Treat 71: 181-191
Donato et al. Oncol Rep 2004 Jun, 1209-13Donato et al. Oncol Rep 2004 Jun, 1209-13
Du W et al (1993). Cell 74 :887-898Du W et al (1993). Cell 74: 887-898
Evans A et al (2004). J Surg Oncol 88 :86-99Evans A et al (2004). J Surg Oncol 88: 86-99
Fedele M et al (1996). Cancer Res 56:1896-1901Fedele M et al (1996). Cancer Res 56: 1896-1901
Fletcher AJ et al (1991). Am J Pathol 138:1199-1207Fletcher AJ et al. (1991). At J Pathol 138: 1199-1207
Fletcher AJ et al (1992). Cancer Res 52 :6224-6228Fletcher AJ et al (1992). Cancer Res 52: 6224-6228
Fletcher AJ et al (1995). Genes Chromosomes Cancer 12:220-223Fletcher AJ et al (1995). Genes Chromosome Cancer 12: 220-223
Flohr et al. Histol Histopathol 2003 Oct, 999-1004Flohr et al. Histol Histopathol 2003 Oct, 999-1004
Foster LC et al (1998). J Biol Chem 273 :20341-20346Foster LC et al. (1998). J Biol Chem 273: 20341-20346
Foster LC et al (2000). FASEB J 14 :368-378Foster LC et al (2000). FASEB J 14: 368-378
French et al. Mol Cell Biol 1996, 5393-9French et al. Mol Cell Biol 1996, 5393-9
Friedman M et al (1993). Nucleic Acids Res 21 :4259-4267Friedman M et al. (1993). Nucleic Acids Res 21: 4259-4267
Giancotti V et al (1987). EMBO J 6:1981-1987Giancotti V et al (1987). EMBO J 6: 1981-1987
Giancotti V et al (1989). Exp Cell Res 184:538-545Giancotti V et al (1989). Exp Cell Res 184: 538-545
Giancotti V et al. (1993). Eur J Biochem 213:825-832Giancotti V et al. (1993). Eur J Biochem 213: 825-832
Giannini G et al (1999). Cancer Res 59:2484-2492Giannini G et al. (1999). Cancer Res 59: 2484-2492
Giannini G et al (2000). Br J Cancer 83:1503-1509Giannini G et al (2000). Br J Cancer 83: 1503-1509
Grosschedl R et al (1994). Trends Genet 10 :94-100Grosschedl R et al (1994). Trends Genet 10: 94-100
Heim S et al (1988). Cancer Genet Cytogenet 32: 13-17Heim S et al (1988). Cancer Genet Cytogenet 32: 13-17
Henderson et al J Viral 2000, 10523-34Henderson et al J Viral 2000, 10523-34
Hindmarsh et al. J. Viral 1999, 2994-3003Hindmarsh et al. J. Viral 1999, 2994-3003
Holth LT et al (1997). DNA Cell Biol 16:1299-1309Holth LT et al. (1997). DNA Cell Biol 16: 1299-1309
Huth JR et al (1997). Nat Struct Biol 4:657-665Huth JR et al (1997). Nat Struct Biol 4: 657-665
Jain M et al (1996). J Clin Invest 97 :596-603Jain M et al. (1996). J Clin Invest 97: 596-603
Johansson M et al (1992). Cancer Genet Cytogenet 60 :219-220Johansson M et al (1992). Cancer Genet Cytogenet 60: 219-220
Johansson M et al (1993). Br J Cancer 67 :1236-1241Johansson M et al (1993). Br J Cancer 67: 1236-1241
Johnson KR et al (1990). Exp Cell Res 187:69-76Johnson KR et al (1990). Exp Cell Res 187: 69-76
Kazmierczak B et al (1995). Cancer Res 55 :2497-2499Kazmierczak B et al (1995). Cancer Res 55: 2497-2499
Kettunen et al. Cancer Genet Cytogenet 2004 Mar, 98-106Kettunen et al. Cancer Genet Cytogenet 2004 Mar, 98-106
Kim DH et al (1999). Int J Cancer 84 :376-380Kim DH et al. (1999). Int J Cancer 84: 376-380
Klotzbücher M et al (1999). Am J Pathol 155:1535-1542Block books M et al (1999). At J Pathol 155: 1535-1542
Kottickal LV et al (1998). Biochem Biophys Res Commun 242 :452-456Kottickal LV et al (1998). Biochem Biophys Res Commun 242: 452-456
Lee et al. Int J Oncol 2004, Apr, 847-51Lee et al. Int J Oncol 2004, Apr, 847-51
Leger et al. Mol Cell Biol 1995, 3738-47 Leman ES et al (2003). J Cell Biochem 88 :599-608Leger et al. Mol Cell Biol 1995, 3738-47 Leman ES et al (2003). J Cell Biochem 88: 599-608
Li et al J. Virol 1998, 2125-31Li et al J. Virol 1998, 2125-31
Li et al, Am J Dermatopathol 2004 Aug, 267-72Li et al, Am J Dermatopathol 2004 Aug, 267-72
Mandahl N et al (1987). Int J Cancer 39 :685-688Mandahl N et al (1987). Int J Cancer 39: 685-688
Mandahl N et al (1989). Cancer 65 :242-248Mandahl N et al (1989). Cancer 65: 242-248
Mandahl N et al (1993). Cancer 71 : 3009-3013Mandahl N et al (1993). Cancer 71: 3009-3013
Mark J & Dahlenfors R (1986). Anticancer Res 6:299-308Mark J & Dahlenfors R (1986). Anticancer Res 6: 299-308
Mark J et al (1980). Cancer Genet Cytogenet 2 :231-241Mark J et al (1980). Cancer Genet Cytogenet 2: 231-241
Mark J et al (1988). Anticancer Res 8:621-626Mark J et al. (1988). Anticancer Res 8: 621-626
Masciullo et al Carcinogenesis 2003 JuI, 1191-8Masciullo et al Carcinogenesis 2003, p. 1191-8
Masciullo V et al (2003). Carcinogenesis 24:1191-1198Masciullo V et al (2003). Carcinogenesis 24: 1191-1198
Melillo RM et al (2001). Mol Cell Biol 21:2485-2495Melillo RM et al (2001). Mol Cell Biol 21: 2485-2495
Nam et al Histopathology 2003 May, 466-71Nam et al Histopathology 2003 May, 466-71
Nestl A et al (2001). Cancer Res 61:1569-1577Nestl A et al (2001). Cancer Res 61: 1569-1577
Noguera R et al (1989). Virchows Arch A Pathol Anat Histopathol 415:377-382Noguera R et al (1989). Virchows Arch A Pathol Anat Histopathol 415: 377-382
Ogram SA et al (1997). J Biol Chem 270:14235-14242Ogram SA et al (1997). J Biol Chem 270: 14235-14242
Ozisik YY et al (1993). Cancer Genet Cytogenet 79 :136-138Ozisik YY et al (1993). Cancer Genet Cytogenet 79: 136-138
Panagiotidis et al Virology 1999, 64-74Panagiotidis et al Virology 1999, 64-74
Pellacani A et al (1999). J Biol Chem 274:1525-1532Pellacani A et al (1999). J Biol Chem 274: 1525-1532
Peters et al. Cancer Epidemiol Biomarkers Prev 2005, JuI 17, 17-23Peters et al. Cancer Epidemiol Biomarkers Prev 2005, Jul 17, 17-23
Pierantoni et al. Biochem J 2003 May, 145-50Pierantoni et al. Biochem J 2003 May, 145-50
Ram TG et al (1993). Cancer Res 53 .2655-2660Ram TG et al (1993). Cancer Res 53 .2655-2660
Reeves R & Beckerbauer K (2002). Progr Cell Cycle Res 5:279-286Reeves R & Beckerbauer K (2002). Progr Cell Cycle Res 5: 279-286
Reeves R & Beckerbauer L (2001). Biochim Biophys Acta 1519:13-29Reeves R & Beckerbauer L (2001). Biochim Biophys Acta 1519: 13-29
Reeves R & Nissen MS (1990). J Biol Chem 265:8573-8582Reeves R & Nissen MS (1990). J Biol Chem 265: 8573-8582
Reeves R et al (2001). Mol Cell Biol 21 :575-594Reeves R et al (2001). Mol Cell Biol 21: 575-594
Rogalla P et al (1996). Am J Pathol 149:775-779Rogalla P et al (1996). At J Pathol 149: 775-779
Rohen C et al (1995). Cancer Genet Cytogenet 84:82-84Rohen C et al (1995). Cancer Genet Cytogenet 84: 82-84
Sarhadi et al. J Pathol Mar 6 2006, Epup ahead of printSarhadi et al. J Pathol Mar 6 2006, Epup ahead of print
Sato et al. Pathol Res Pract, 2005; 201, 333-9Sato et al. Pathol Res Pract, 2005; 201, 333-9
Scala S et al (2000). Proc Natl Acad Sei USA 97 :4256-4261Scala S et al (2000). Proc Natl Acad USA 97: 4256-4261
Schaefer et al. Mol Cell Biol. 1997, 873-86Schaefer et al. Mol Cell Biol. 1997, 873-86
Schlueter et al. Pathol Res Pract, 2005; 201, 101-7Schlueter et al. Pathol Res Pract, 2005; 201, 101-7
Schoenmakers EFPM et al. (1995). Nat Genet 10:436-444Schoenmakers EFPM et al. (1995). Nat Genet 10: 436-444
Sgarra R et al (2003). Biochemistry 42 :3575-3585Sgarra R et al (2003). Biochemistry 42: 3575-3585
Sgarra R et al (2004). FEBS Lett 574 :l-8Sgarra R et al (2004). FEBS Lett 574: 1-8
Sreekantaiah C et al (1990). Cancer Genet Cytogenet 45 :81-84Sreekantaiah C et al (1990). Cancer Genet Cytogenet 45: 81-84
Sreekantaiah C et al (1991). Cancer Res 5 :422-433Sreekantaiah C et al (1991). Cancer Res 5: 422-433
Staats B et al (1996). Breast Cancer Res Treat 38 :299-303Staats B et al. (1996). Breast Cancer Res Treat 38: 299-303
Tamimi Y et al (1996). Br J Cancer 74 :573-578Tamimi Y et al (1996). Br J Cancer 74: 573-578
Tapasso F et al (2004). Cancer Gene Ther 11 :633-641Tapasso F et al (2004). Cancer Gene Ther 11: 633-641
Tarbe N et al (2001). Anticancer Res 21:3221-3228Tarbe N et al (2001). Anticancer Res 21: 3221-3228
Thanos D & Maniatis T (1992). Cell 71:777-789Thanos D & Maniatis T (1992). Cell 71: 777-789
Turc-Carel C et al (1986). Cancer Genet Cytogenet 23 :283-289Turc-Carel C et al. (1986). Cancer Genet Cytogenet 23: 283-289
Vallone D et al (1997). EMBO J 16:5310-5321Vallone D et al (1997). EMBO J 16: 5310-5321
Van Maele et al. , Trends Biochem Sei 2006, 98-105Van Maele et al. , Trends Biochem Bey 2006, 98-105
Vanni R et al (1988). Cancer Genet Cytogenet 32:33-34Vanni R et al (1988). Cancer Genet Cytogenet 32: 33-34
Vanni R et al (1993). Cancer Genet Cytogenet 68:32-33Vanni R et al. (1993). Cancer Genet Cytogenet 68: 32-33
Walter TA et al (1989). Cancer Genet Cytogenet 41 :99-103 Wolffe AP (1994). Science 264:1100-1101 Wood LJ et al (2000a). Cancer Res 60:4256-4261 Wood LJ et al (2000b). Mol Cell Biol 20 .5490-5502 Xiang YY et al (1997). Int J Cancer 74 : 1-6 Zhou X et al (1995). Nature 376 :771-774Walter TA et al (1989). Cancer Genet Cytogenet 41: 99-103 Wolff AP (1994). Science 264: 1100-1101 Wood LJ et al (2000a). Cancer Res 60: 4256-4261 Wood LJ et al (2000b). Mol Cell Biol 20 .5490-5502 Xiang YY et al (1997). Int J Cancer 74: 1-6 Zhou X et al (1995). Nature 376: 771-774
Die in der vorangehenden Beschreibung, den Ansprüchen und den Zeichnungen offenbarten Merkmale der Erfindung können sowohl einzeln als auch in beliebiger Kombination zur Verwirklichung der Erfindung in ihren verschiedenen Ausführungsformen wesentlich sein. The features of the invention disclosed in the foregoing description, claims and drawings may be essential both individually and in any combination for practicing the invention in its various embodiments.

Claims

Ansprüche claims
1. Verwendung einer L-Nukleinsäure als intrazellulär aktives Agens.1. Use of an L-nucleic acid as an intracellularly active agent.
2. Verwendung nach Anspruch 1, dadurch gekennzeichnet, dass die L-Nukleinsäure ein Spiegeimer ist.2. Use according to claim 1, characterized in that the L-nucleic acid is a Spiegeimer.
3. Verwendung nach einem der Ansprüche 1 bis 2, dadurch gekennzeichnet, dass die L- Nukleinsäure in Wechselwirkung mit einem intrazellulären Rezeptor tritt.3. Use according to any one of claims 1 to 2, characterized in that the L-nucleic acid interacts with an intracellular receptor.
4. Verwendung nach Anspruch 3, dadurch gekennzeichnet, dass der intrazelluläre Rezeptor ausgewählt ist aus der Gruppe umfassend molekulare Rezeptoren, Enzyme, Chape- ron-Moleküle, Signalpeptide, intrazelluläre Strukturen und Stoffwechselintermediate.4. Use according to claim 3, characterized in that the intracellular receptor is selected from the group comprising molecular receptors, enzymes, chaperone molecules, signal peptides, intracellular structures and metabolic intermediates.
5. Verwendung nach Anspruch 3, dadurch gekennzeichnet, dass der intrazelluläre Rezeptor ausgewählt ist aus der Gruppe umfassend Polypeptide, Kohlenhydrate, Nukleinsäuren, Lipide und Kombinationen davon.5. Use according to claim 3, characterized in that the intracellular receptor is selected from the group comprising polypeptides, carbohydrates, nucleic acids, lipids and combinations thereof.
6. Verwendung nach einem der Ansprüche 3 bis 5, dadurch gekennzeichnet, dass die L- Nukleinsäure mit einem intrazellulären Rezeptor innerhalb einer Zelle in Wechselwirkung tritt.6. Use according to any one of claims 3 to 5, characterized in that the L-nucleic acid interacts with an intracellular receptor within a cell.
7. Verwendung nach einem der Ansprüche 3 bis 6, dadurch gekennzeichnet, dass der intrazelluläre Rezeptor ausgewählt ist aus der Gruppe umfassend Transkriptionsfaktoren und einen AT-Haken bindende DNA-bindende Proteine.7. Use according to one of claims 3 to 6, characterized in that the intracellular receptor is selected from the group comprising transcription factors and an AT hook-binding DNA-binding proteins.
8. Verwendung nach Anspruch 7, dadurch gekennzeichnet, dass der intrazelluläre Rezeptor aus der Gruppe umfassend die HMG-Proteine ausgewählt ist, bevorzugterweise aus der Gruppe umfassend HMGAl, HMGAIa, HMGAIb und HMGA2 ausgewählt ist.8. Use according to claim 7, characterized in that the intracellular receptor is selected from the group comprising the HMG proteins, preferably selected from the group comprising HMGA1, HMGAIa, HMGAIb and HMGA2.
9. Verfahren zum Binden eines intrazellulären Rezeptor umfassend: Bereitstellen einer Zelle enthaltend mindestens den einen intrazellulären Rezeptor,9. A method for binding an intracellular receptor comprising: Providing a cell containing at least the one intracellular receptor,
Bereitstellen einer L-Nukleinsäure, undProviding an L-nucleic acid, and
Inkubieren der Zelle mit der L-Nukleinsäure.Incubate the cell with the L-nucleic acid.
10. Verfahren nach Anspruch 9, dadurch gekennzeichnet, dass das Inkubieren unter Bedingungen erfolgt, so dass die L-Nukleinsäure an den intrazellulären Rezeptor in der Zelle bindet.10. The method according to claim 9, characterized in that the incubation is carried out under conditions such that the L-nucleic acid binds to the intracellular receptor in the cell.
11. Verfahren nach Anspruch 9 und 10, dadurch gekennzeichnet, dass die L-Nukleinsäure ein Spiegeimer ist.11. The method according to claim 9 and 10, characterized in that the L-nucleic acid is a Spiegeimer.
12. Verfahren nach einem der Ansprüche 9 bis 11, dadurch gekennzeichnet, dass nach der Inkubation der Zelle mit der L-Nukleinsäure bestimmt wird, ob eine Bindung, insbesondere eine intrazelluläre Bindung, der L-Nukleinsäure an dem intrazellulären Rezeptor erfolgt ist.12. The method according to any one of claims 9 to 11, characterized in that it is determined after incubation of the cell with the L-nucleic acid, whether a binding, in particular an intracellular binding, the L-nucleic acid is carried out at the intracellular receptor.
13. Verfahren nach einem der Ansprüche 9 bis 12, dadurch gekennzeichnet, dass der intrazelluläre Rezeptor ausgewählt ist aus der Gruppe umfassend molekulare Rezeptoren, Stoffwechselintermediate und Enzyme.13. The method according to any one of claims 9 to 12, characterized in that the intracellular receptor is selected from the group comprising molecular receptors, metabolic intermediates and enzymes.
14. Verfahren nach einem der Ansprüche 9 bis 13, dadurch gekennzeichnet, dass der intrazelluläre Rezeptor ausgewählt ist aus der Gruppe umfassend Polypeptide, Kohlenhydrate, Nukleinsäure, Lipide und Kombinationen davon.14. The method according to any one of claims 9 to 13, characterized in that the intracellular receptor is selected from the group comprising polypeptides, carbohydrates, nucleic acid, lipids and combinations thereof.
15. Verfahren nach einem der Ansprüche 9 bis 14, dadurch gekennzeichnet, dass der intrazelluläre Rezeptor ausgewählt ist aus der Gruppe umfassend Transkriptionsfaktoren und einen AT-Haken bindende DNA-bindende Proteine. 15. The method according to any one of claims 9 to 14, characterized in that the intracellular receptor is selected from the group comprising transcription factors and an AT hook-binding DNA-binding proteins.
16. Verfahren nach Anspruch 15, dadurch gekennzeichnet, dass der intrazelluläre Rezeptor ausgewählt ist aus der Gruppe umfassend HMG-Proteine, bevorzugterweise ausgewählt ist aus der Gruppe umfassend HMGAl, HMGAIa, HMGAIb und HMGA2.16. The method according to claim 15, characterized in that the intracellular receptor is selected from the group comprising HMG proteins, preferably selected from the group comprising HMGAl, HMGAIa, HMGAIb and HMGA2.
17. Verwendung einer L-Nukleinsäure zur Herstellung eines Medikamentes zur Behandlung und/oder Prävention einer Erkrankung, wobei das Zielmolekül des Medikamentes ein intrazelluläres Zielmolekül ist.17. Use of an L-nucleic acid for the manufacture of a medicament for the treatment and / or prevention of a disease, wherein the target molecule of the medicament is an intracellular target molecule.
18. Verwendung nach Anspruch 17, dadurch gekennzeichnet, dass der intrazelluläre Rezeptor ausgewählt ist aus der Gruppe umfassend molekulare Rezeptoren, Enzyme, Chaperon-Moleküle, Signalpeptide, intrazelluläre Strukturen und Stoffwechselinter- mediate.18. Use according to claim 17, characterized in that the intracellular receptor is selected from the group comprising molecular receptors, enzymes, chaperone molecules, signal peptides, intracellular structures and metabolic intermediates.
19. Verwendung nach Anspruch 17, dadurch gekennzeichnet, dass der intrazelluläre Rezeptor ausgewählt ist aus der Gruppe umfassend Polypeptide, Kohlenhydrate, Nukleinsäuren, Lipide und Kombinationen davon.19. Use according to claim 17, characterized in that the intracellular receptor is selected from the group comprising polypeptides, carbohydrates, nucleic acids, lipids and combinations thereof.
20. Verwendung nach einem der Ansprüche 17 bis 19, dadurch gekennzeichnet, dass das Zielmolekül ausgewählt ist aus der Gruppe, die Transkriptionsfaktoren und einen AT- Haken bindende DNA-bindende Proteine umfasst.20. Use according to any one of claims 17 to 19, characterized in that the target molecule is selected from the group comprising transcription factors and an AT hook-binding DNA-binding proteins.
21. Verwendung nach Anspruch 20, dadurch gekennzeichnet, dass das Zielmolekül ausgewählt ist aus der Gruppe umfassend HMG-Proteine, bevorzugterweise ausgewählt ist aus der Gruppe umfassend HMGAl, HMGAIa, HMGAIb und HMGA2.21. Use according to claim 20, characterized in that the target molecule is selected from the group comprising HMG proteins, preferably selected from the group comprising HMGAl, HMGAIa, HMGAIb and HMGA2.
22. Verwendung nach einem der Ansprüche 20 bis 21, dadurch gekennzeichnet, dass die Erkrankung ausgewählt ist aus der Gruppe umfassend Tumorerkrankungen, Virusinfektionen und Arteriosklerose.22. Use according to any one of claims 20 to 21, characterized in that the disease is selected from the group comprising tumor diseases, viral infections and arteriosclerosis.
23. Verwendung nach Anspruch 22, dadurch gekennzeichnet, dass die Tumorerkrankung ausgewählt ist aus der Gruppe umfassend mesenchymale Tumoren, epitheliale Tumoren, benigne Tumoren, maligne Tumoren und metastasierende Tumoren. 23. Use according to claim 22, characterized in that the tumor disease is selected from the group comprising mesenchymal tumors, epithelial tumors, benign tumors, malignant tumors and metastatic tumors.
24. Verwendung nach einem der Ansprüche 20 bis 23, dadurch gekennzeichnet, dass das Zielmolekül HMGA ist und die Erkrankung ausgewählt ist aus der Gruppe umfassend Karzinome von Prostata, Pankreas, Schilddrüse, Cervix, Magen, Brust, Colon/Rektum, Ovarien; Neuroblastome; Lymphome, Uterusleiomyome; Lipome; Endometriumpoly- pen; chondroide Hamartome der Lunge; pleomorphe Adenome der Kopfspeicheldrüsen; Hämangiopericytome; chondromatöse Tumore; aggressive Angiomyxome; diffuse Astrocytome; Osteoklastome; Hautkrebs; Burkitts Lymphom; Lewis-Lungenkrebs; Leukämie; nicht-kleinzelliges Lungenkarzinom; sowie jeweils Metastasen und/oder metastasierende Formen davon.24. Use according to any one of claims 20 to 23, characterized in that the target molecule is HMGA and the disease is selected from the group comprising carcinomas of the prostate, pancreas, thyroid, cervix, stomach, breast, colon / rectum, ovaries; neuroblastomas; Lymphomas, uterine leiomyomas; lipomas; Endometrial polyps; chondroid hamartomas of the lung; pleomorphic adenomas of the salivary glands; Hämangiopericytome; chondromatous tumors; aggressive angiomyomas; diffuse astrocytomas; osteoclastomas; Skin cancer; Burkitts lymphoma; Lewis lung cancer; Leukemia; non-small cell lung carcinoma; and in each case metastases and / or metastatic forms thereof.
25. Verwendung nach Anspruch 22, dadurch gekennzeichnet, dass die Arteriosklerose durch HMGAl, HMGAIa, HMGIb und/oder HMGA2 vermittelte Bildung von artie- rosklerotischen Plaques ausgelöst oder bedingt ist.25. Use according to claim 22, characterized in that the atherosclerosis is triggered or conditioned by HMGA1, HMGAIa, HMGIb and / or HMGA2-mediated formation of artioclerotic plaques.
26. Verwendung nach einem der Ansprüche 17 bis 25, dadurch gekennzeichnet, dass das intrazelluläre Zielmolekül intrazellulär vorliegt.26. Use according to any one of claims 17 to 25, characterized in that the intracellular target molecule is present intracellularly.
27. Verwendung einer L-Nukleinsäure zur Herstellung eines diagnostischen Mittels zur Diagnose, wobei das Zielmolekül des diagnostischen Mittels ein intrazelluläres Zielmolekül ist.27. Use of an L-nucleic acid for the production of a diagnostic agent for diagnosis, wherein the target molecule of the diagnostic agent is an intracellular target molecule.
28. Verwendung nach Anspruch 27, dadurch gekennzeichnet, dass der intrazelluläre Rezeptor ausgewählt ist aus der Gruppe umfassend molekulare Rezeptoren, Enzyme, Chaperon-Moleküle, Signalpeptide, intrazelluläre Strukturen und Stoffwechselinter- mediate.28. Use according to claim 27, characterized in that the intracellular receptor is selected from the group comprising molecular receptors, enzymes, chaperone molecules, signal peptides, intracellular structures and metabolic intermediates.
29. Verwendung nach Anspruch 27, dadurch gekennzeichnet, dass der intrazelluläre Rezeptor ausgewählt ist aus der Gruppe umfassend Polypeptide, Kohlenhydrate, Nukleinsäuren, Lipide und Kombinationen davon.29. Use according to claim 27, characterized in that the intracellular receptor is selected from the group comprising polypeptides, carbohydrates, nucleic acids, lipids and combinations thereof.
30. Verwendung nach einem der Ansprüche 27 bis 29, dadurch gekennzeichnet, dass das Zielmolekül ausgewählt ist aus der Gruppe, die Transkriptionsfaktoren und einen AT- Haken bindende DNA-bindende Proteine umfasst. 30. Use according to any one of claims 27 to 29, characterized in that the target molecule is selected from the group comprising transcription factors and an AT hook-binding DNA-binding proteins.
31. Verwendung nach Anspruch 30, dadurch gekennzeichnet, dass das Zielmolekül ausgewählt ist aus der Gruppe umfassend HMG-Proteine, bevorzugterweise ausgewählt ist aus der Gruppe umfassend HMGA, HMGAIa, HMGAIb und HMGA2.31. Use according to claim 30, characterized in that the target molecule is selected from the group comprising HMG proteins, preferably selected from the group comprising HMGA, HMGAIa, HMGAIb and HMGA2.
32. Verwendung nach einem der Ansprüche 30 bis 31, dadurch gekennzeichnet, dass die Erkrankung ausgewählt ist aus der Gruppe umfassend Tumorerkrankungen, Virusinfektionen und Arteriosklerose.32. Use according to any one of claims 30 to 31, characterized in that the disease is selected from the group comprising tumor diseases, viral infections and arteriosclerosis.
33. Verwendung nach Anspruch 32, dadurch gekennzeichnet, dass die Tumorerkrankung ausgewählt ist aus der Gruppe umfassend mesenchymale Tumoren, epitheliale Tumoren, benigne Tumoren, maligne Tumoren und metastatisierende Tumoren.33. Use according to claim 32, characterized in that the tumor disease is selected from the group comprising mesenchymal tumors, epithelial tumors, benign tumors, malignant tumors and metastatic tumors.
34. Verwendung nach einem der Ansprüche 30 bis 33, dadurch gekennzeichnet, dass das Zielmolekül HMGA ist und die Erkrankung ausgewählt ist aus der Gruppe umfassend Karzinome von Prostata, Pankreas, Schilddrüse, Cervix, Magen, Brust, Colon/Rektum, Ovarien; Neuroblastome; Lymphome, Uterusleiomyome; Lipome; Endometriumpoly- pen; chondroide Hamartome der Lunge; pleomorphe Adenome der Kopfspeicheldrüsen; Hämangiopericytome; chondromatöse Tumore; aggressive Angiomyxome; diffuse Astrocytome; Osteoklastome; Hautkrebs; Burkitts Lymphom; Lewis-Lungenkrebs; Leukämie; nicht-kleinzelliges Lungenkarzinom; sowie jeweils Metastasen und/oder metastasierende Formen davon.34. Use according to any one of claims 30 to 33, characterized in that the target molecule is HMGA and the disease is selected from the group comprising carcinomas of the prostate, pancreas, thyroid, cervix, stomach, breast, colon / rectum, ovaries; neuroblastomas; Lymphomas, uterine leiomyomas; lipomas; Endometrial polyps; chondroid hamartomas of the lung; pleomorphic adenomas of the salivary glands; Hämangiopericytome; chondromatous tumors; aggressive angiomyomas; diffuse astrocytomas; osteoclastomas; Skin cancer; Burkitts lymphoma; Lewis lung cancer; Leukemia; non-small cell lung carcinoma; and in each case metastases and / or metastatic forms thereof.
35. Verwendung nach Anspruch 32, dadurch gekennzeichnet, dass die Arteriosklerose durch HMGAl, HMGAIa, HMGIb und/oder HMGA2 vermittelte Bildung von artie- rosklerotischen Plaques ausgelöst wird.--.,,.35. Use according to claim 32, characterized in that the arteriosclerosis is triggered by HMGAl, HMGAIa, HMGIb and / or HMGA2-mediated formation of artikelklerotic plaques .--. ,,.
36. Verwendung nach einem der Ansprüche 27 bis 34, dadurch gekennzeichnet, dass das intrazelluläre Zielmolekül intrazellulär vorliegt.36. Use according to any one of claims 27 to 34, characterized in that the intracellular target molecule is present intracellularly.
37. Zusammensetzung umfassend eine an ein intrazelluläres Zielmolekül bindende L- Nukleinsäure und ein Abgabevehikel. 37. A composition comprising an L-nucleic acid binding to an intracellular target molecule and a delivery vehicle.
38. Zusammensetzung nach Anspruch 37, dadurch gekennzeichnet, dass das Abgabevehikel ein für die intrazelluläre Abgabe der L-Nukleinsäure geeignetes Abgabevehikel ist.38. Composition according to claim 37, characterized in that the delivery vehicle is a delivery vehicle suitable for intracellular delivery of the L-nucleic acid.
39. Zusammensetzung nach Anspruch 37 oder 38, dadurch gekennzeichnet, dass das Abgabevehikel ausgewählt ist aus der Gruppe umfassend Vehikel, Konjugate und physikalische Maßnahmen.39. Composition according to claim 37 or 38, characterized in that the delivery vehicle is selected from the group comprising vehicles, conjugates and physical measures.
40. Zusammensetzung nach Anspruch 39, dadurch gekennzeichnet, dass das Abgabevehikel ein Vehikel ist, wobei das Vehikel ausgewählt ist aus der Gruppe umfassend Liposome, Nanopartikel, Mikropartikel, Cyclodextrine oder Dendrimere, oder ein Vesikel ist, das aus Polypeptiden, Polyethylenimin und/oder amphipathischen Molekülen besteht.A composition according to claim 39, characterized in that the delivery vehicle is a vehicle, wherein the vehicle is selected from the group comprising liposomes, nanoparticles, microparticles, cyclodextrins or dendrimers, or is a vesicle consisting of polypeptides, polyethylenimine and / or amphipathic Molecules exists.
41. Zusammensetzung nach Anspruch 39, dadurch gekennzeichnet, dass das Abgabevehikel ein Konjugat ist, wobei das Konjugat ein Konjugat für die Rezeptor-vermittelte Endozytose, ein Konjugat mit einem fusogenen Peptid, ein Konjugat mit einem Sig- nalpeptid, ein Konjugat mit einer Nukleinsäure, bevorzugterweise ein Konjugat mit einem Spiegeimer oder ein lipophiles Konjugat ist.41. The composition of claim 39, wherein the delivery vehicle is a conjugate, wherein the conjugate is a receptor-mediated endocytosis conjugate, a fusogenic peptide conjugate, a conjugate with a signal peptide, a conjugate with a nucleic acid, preferably a conjugate with a spiegelmer or a lipophilic conjugate.
42. Zusammensetzung nach Anspruch 39, dadurch gekennzeichnet, dass das Abgabevehikel eine physikalische Maßnahme ist, wobei die Maßnahme bevorzugterweise ausgewählt ist aus der Gruppe umfassend Elektroporation, Iontophorese, Druck, Ultraschall und Schockwellen.42. The composition according to claim 39, characterized in that the delivery vehicle is a physical measure, the measure being preferably selected from the group comprising electroporation, iontophoresis, pressure, ultrasound and shock waves.
43. Zusammensetzung nach Anspruch 40, dadurch gekennzeichnet, dass das Abgabevehikel Polyethylenimin umfasst.43. A composition according to claim 40, characterized in that the delivery vehicle comprises polyethylenimine.
44. Zusammensetzung nach Anspruch 43, dadurch gekennzeichnet, dass das Polyethylenimin ein verzweigtes Polyethylenimin mit einem Molekulargewicht von etwa 25 kDa ist.44. A composition according to claim 43, characterized in that the polyethyleneimine is a branched polyethyleneimine having a molecular weight of about 25 kDa.
45. Zusammensetzung nach Anspruch 43 oder 44, dadurch gekennzeichnet, dass das Polyethylenimin eine Mizelle oder eine mizellenartige Struktur ausbildet. 45. A composition according to claim 43 or 44, characterized in that the polyethyleneimine forms a micelle or a micelle-like structure.
46. Zusammensetzung nach einem der Ansprüche 37 bis 45, dadurch gekennzeichnet, dass die L-Nukleinsäure ein Spiegeimer ist.46. A composition according to any one of claims 37 to 45, characterized in that the L-nucleic acid is a Spiegeimer.
47. Zusammensetzung nach Anspruch 46, dadurch gekennzeichnet, dass das Spiegeimer eine Modifikation trägt, wobei die Modifikation ausgewählt ist aus der Gruppe umfassend PEG-Reste.47. The composition according to claim 46, characterized in that the spiegelmer carries a modification, wherein the modification is selected from the group comprising PEG residues.
48. Zusammensetzung nach Anspruch 47, dadurch gekennzeichnet, dass der PEG-Rest ein Molekulargewicht von etwa 1.000 bis 10.000 Da aufweist, bevorzugterweise ein Molekulargewicht von etwa 1.500 bis 2.500 Da und am bevorzugtesten ein Molekulargewicht von etwa 2.000 Da aufweist.48. The composition of claim 47, wherein the PEG moiety has a molecular weight of about 1,000 to 10,000 Da, preferably has a molecular weight of about 1,500 to 2,500 Da, and most preferably has a molecular weight of about 2,000 Da.
49. Zusammensetzung nach einem der Ansprüche 47 oder 48, dadurch gekennzeichnet, dass die Modifikation am 5 '-Terminus oder am 3 '-Terminus der L-Nukleinsäure gebunden ist.49. The composition according to any one of claims 47 or 48, characterized in that the modification is bound to the 5 '-terminus or to the 3' -terminus of the L-nucleic acid.
50. Zusammensetzung nach einem der Ansprüche 46 bis 49, dadurch gekennzeichnet, dass in der Zusammensetzung das Verhältnis aus Gesamtanzahl der Stickstoffgruppen des Polyethylenimins und Gesamtanzahl der Phosphatgruppen der in der Zusammensetzung enthaltenen Nukleinsäure etwa 1 bis 20, bevorzugterweise etwa 1,5 bis 10, bevorzugtererweise etwa 2 bis 5 und am bevorzugtesten etwa 2 bis 3 beträgt.Composition according to any one of Claims 46 to 49, characterized in that, in the composition, the ratio of the total number of nitrogen groups of the polyethyleneimine and the total number of phosphate groups of the nucleic acid contained in the composition is about 1 to 20, preferably about 1.5 to 10, more preferably about 2 to 5, and most preferably about 2 to 3.
51. Zusammensetzung nach einem der Ansprüche 37 bis 50, dadurch gekennzeichnet, dass die Zusammensetzung die L-Nukleinsäure intrazellulär bereitstellt.51. The composition according to any one of claims 37 to 50, characterized in that the composition provides the L-nucleic acid intracellularly.
52. Pharmazeutische Zusammensetzung umfassend eine Zusammensetzung nach einem der Ansprüche 37 bis 51 , und einen pharmazeutisch akzeptablen Träger.52. A pharmaceutical composition comprising a composition according to any one of claims 37 to 51, and a pharmaceutically acceptable carrier.
53. Verwendung nach einem der Ansprüche 1 bis 8, wobei die L-Nukleinsäure eine Zusammensetzung nach einem der Ansprüche 37 bis 52 ist. 53. Use according to any one of claims 1 to 8, wherein the L-nucleic acid is a composition according to any one of claims 37 to 52.
54. Verfahren nach einem der Ansprüche 9 bis 16, wobei die L-Nukleinsäure eine Zusammensetzung nach einem der Ansprüche 37 bis 52 ist.54. The method according to any one of claims 9 to 16, wherein the L-nucleic acid is a composition according to any one of claims 37 to 52.
55. Verwendung nach einem der Ansprüche 17 bis 26, wobei die L-Nukleinsäure eine Zusammensetzung nach einem der Ansprüche 37 bis 52 ist.55. Use according to any one of claims 17 to 26, wherein the L-nucleic acid is a composition according to any one of claims 37 to 52.
56. Verwendung nach einem der Ansprüche 27 bis 36, wobei die L-Nukleinsäure eine Zusammensetzung nach einem der Ansprüche 37 bis 52 ist.56. Use according to any one of claims 27 to 36, wherein the L-nucleic acid is a composition according to any one of claims 37 to 52.
57. HMGA bindende Nukleinsäure, dadurch gekennzeichnet, dass die Nukleinsäure einen Abschnitt Box Al und einen Abschnitt Box A2 umfasst, wobei der Abschnitt Box Al und der Abschnitt Box A2 durch einen Zwischenabschnitt miteinander verbunden sind und wobei Box Al und Box A2 einzeln und unabhängig voneinander aus der Gruppe ausgewählt sind, die GGGCG, GGGUG und GGGAG umfasst.57. HMGA-binding nucleic acid, characterized in that the nucleic acid comprises a section box Al and a section box A2, wherein the section box Al and the section box A2 are interconnected by an intermediate section and wherein box Al and box A2 individually and independently are selected from the group comprising GGGCG, GGGUG and GGGAG.
58. HMGA bindende Nukleinsäure nach Anspruch 57, dadurch gekennzeichnet, dass der Zwischenabschnitt entweder aus einem Zwischenabschnitt Zl umfassend sechs oder sieben Nukleotide oder aus einem Zwischenabschnitt Z2 umfassend 12 bis 25 Nukleotide besteht.58. HMGA-binding nucleic acid according to claim 57, characterized in that the intermediate section consists either of an intermediate section Z1 comprising six or seven nucleotides or of an intermediate section Z2 comprising 12 to 25 nucleotides.
59. HMGA bindende Nukleinsäure nach Anspruch 57 bis 58, dadurch gekennzeichnet, dass die Nukleinsäure am 5 '-Ende des Abschnittes Box Al einen ersten Abschnitt aufweist und am 3 '-Ende des Abschnittes Box A2 einen zweiten Abschnitt aufweist, wobei bevorzugterweise beide Abschnitte unabhängig voneinander je vier bis acht Nukleotide umfassen.59. HMGA-binding nucleic acid according to claim 57 to 58, characterized in that the nucleic acid at the 5 'end of the section box Al has a first portion and at the 3' end of the section box A2 has a second portion, preferably both sections independently each comprise four to eight nucleotides each.
60. HMGA bindende Nukleinsäure nach Anspruch 59, dadurch gekennzeichnet, dass die beiden Abschnitte wenigstens teilweise oder vollständig miteinander hybridisiert sind, wobei sich die Hybridisierung über vier bis acht Nukleotidpaare erstreckt.60. HMGA-binding nucleic acid according to claim 59, characterized in that the two sections are at least partially or completely hybridized with each other, wherein the hybridization extends over four to eight nucleotide pairs.
61. HMGA bindende Nukleinsäure nach Anspruch 59 oder 60, dadurch gekennzeichnet, dass die Nukleinsäure am 5 '-Ende des Abschnittes Box Al einen Abschnitt Helix Al und am 3 '-Ende des Abschnittes Box A2 einen Abschnitt Helix A2 aufweist, wobei bevorzugterweise der Abschnitt Helix Al vier bis acht Nukleotide umfasst und bevorzugterweise der Abschnitt Helix A2 vier bis acht Nukleotide umfasst, und wobei bevorzugterweise der Abschnitt Helix Al den ersten Abschnitt am 5 '-Ende des Abschnittes Box Al oder einen Teil davon darstellt, und wobei bevorzugterweise der Abschnitt Helix A2 den zweiten Abschnitt am 3 '-Ende des Abschnittes Box A2 oder einen Teil davon darstellt, wobei die Länge des Abschnittes Helix Al unabhängig von der Länge des Abschnittes Helix A2 ist.61. HMGA-binding nucleic acid according to claim 59 or 60, characterized in that the nucleic acid at the 5 'end of the section Box Al a section Helix Al and at the 3' end of the section Box A2 has a section Helix A2, wherein Preferably, the portion Helix Al comprises four to eight nucleotides, and preferably the portion Helix A2 comprises four to eight nucleotides, and wherein preferably the portion helix Al represents the first portion at the 5 'end of the portion Box Al or a portion thereof, and preferably the section Helix A2 represents the second section at the 3 'end of the section Box A2 or a part thereof, wherein the length of the section Helix Al is independent of the length of the section Helix A2.
62. HMGA bindende Nukleinsäure nach Anspruch 61, dadurch gekennzeichnet, dass die Abschnitte Helix Al und Helix A2 wenigstens teilweise oder vollständig miteinander hybridisiert sind, wobei sich die Hybridisierung über vier bis acht Nukleotidpaare erstreckt.62. HMGA-binding nucleic acid according to claim 61, characterized in that the sections Helix Al and Helix A2 are at least partially or completely hybridized with each other, wherein the hybridization extends over four to eight nucleotide pairs.
63. HMGA bindende Nukleinsäure nach Anspruch 61 oder 62, dadurch gekennzeichnet, dass zwischen dem 3 '-Ende des Abschnittes Helix Al und dem 5 '-Ende des Abschnittes Box Al ein Abschnitt Helix Bl angeordnet ist und zwischen dem 3 '-Ende des Abschnittes Box A2 und dem 5 '-Ende des Abschnittes Helix A2 ein Abschnitt Helix B2 angeordnet ist, wobei bevorzugterweise die Länge des Abschnittes Helix Bl und Helix B2 jeweils einzeln und unabhängig eine Länge von vier bis acht Nukleotiden umfasst.63. HMGA-binding nucleic acid according to claim 61 or 62, characterized in that between the 3 'end of the section Helix Al and the 5' end of the section Box Al a section Helix Bl is arranged and between the 3 'end of the section Box A2 and the 5 'end of the section Helix A2 a section Helix B2 is arranged, wherein preferably the length of the section Helix Bl and Helix B2 each individually and independently comprises a length of four to eight nucleotides.
64. HMGA bindende Nukleinsäure nach Anspruch 63, dadurch gekennzeichnet, dass die Abschnitte Helix Bl und Helix B2 wenigstens teilweise oder vollständig miteinander hybridisiert sind, wobei sich die Hybridisierung über vier bis acht Nukleotidpaare erstreckt.64. HMGA-binding nucleic acid according to claim 63, characterized in that the sections Helix Bl and Helix B2 are at least partially or completely hybridized with each other, wherein the hybridization extends over four to eight nucleotide pairs.
65. HMGA bindende Nukleinsäure nach Anspruch 63 oder 64, dadurch gekennzeichnet, dass zwischen dem 3 '-Ende des Abschnittes Helix Al und dem 5 '-Ende des Abschnittes Helix Bl null bis fünf Nukleotide angeordnet sind.65. HMGA-binding nucleic acid according to claim 63 or 64, characterized in that between the 3 'end of the section Helix Al and the 5' end of the section Helix Bl zero to five nucleotides are arranged.
66. HMGA bindende Nukleinsäure nach Anspruch 65, dadurch gekennzeichnet, dass zwischen dem 3 '-Ende des Abschnittes Helix Al und dem 5 '-Ende des Abschnittes Helix Bl zwei Nukleotide angeordnet sind. 66. HMGA-binding nucleic acid according to claim 65, characterized in that between the 3 'end of the section Helix Al and the 5' end of the section Helix Bl two nucleotides are arranged.
67. HMGA bindende Nukleinsäure nach einem der Ansprüche 63 bis 66, dadurch gekennzeichnet, dass zwischen dem 3 '-Ende des Abschnittes Helix B2 und dem 5'-Ende des Abschnittes Helix A2 null bis sechs Nukleotide angeordnet sind.67. HMGA-binding nucleic acid according to any one of claims 63 to 66, characterized in that between the 3 'end of the section Helix B2 and the 5' end of the section Helix A2 zero to six nucleotides are arranged.
68. HMGA bindende Nukleinsäure nach Anspruch 67, bevorzugterweise insoweit sich dieser auf Anspruch 66 bezieht, dadurch gekennzeichnet, dass zwischen dem 3 '-Ende des Abschnittes Helix B2 und dem 5 '-Ende des Abschnittes Helix A2 ein Nukleotid angeordnet ist.68. HMGA-binding nucleic acid according to claim 67, preferably in so far as this refers to claim 66, characterized in that between the 3 'end of the section Helix B2 and the 5' end of the section Helix A2 a nucleotide is arranged.
69. HMGA bindende Nukleinsäure nach einem der Ansprüche 63 bis 68, wobei die Summe der Nukleotide von Abschnitt Helix Al und von Abschnitt Helix Bl 10 bis 12 Nukleotide -beträgt und die Summe der Nukleotide von Abschnitt Helix A2 und von Abschnitt Helix B2 10 bis 12 Nukleotide beträgt.69. HMGA-binding nucleic acid according to any one of claims 63 to 68, wherein the sum of the nucleotides of section Helix Al and section Helix Bl 10 to 12 nucleotides and the sum of the nucleotides of section Helix A2 and section Helix B2 10 to 12 Nucleotides is.
70. HMGA bindende Nukleinsäure nach Anspruch 69, wobei die Summe der hybridisierten Nukleotide aus der Hybridisierung von Abschnitt Helix Al mit Abschnitt Helix A2 und von Abschnitt Helix Bl mit Abschnitt Helix B2 10 bis 12 Nukleotidpaare beträgt.70. The HMGA-binding nucleic acid according to claim 69, wherein the sum of the hybridized nucleotides from the hybridization of section Helix Al with section Helix A2 and section Helix Bl with section Helix B2 is 10 to 12 nucleotide pairs.
71. HMGA bindende Nukleinsäure nach einem der Ansprüche 63 bis 70, bevorzugterweise 63 oder 64, dadurch gekennzeichnet, dass die Nukleinsäure keinen Abschnitt Helix Al und Helix A2 umfasst, wodurch am 5 '-Ende der Nukleinsäure der Abschnitt Helix Bl und am 3 '-Ende die Helix B2 angeordnet ist, wobei bevorzugterweise die Länge des Abschnittes Helix Bl und Helix B2 jeweils einzeln und unabhängig eine Länge von vier bis acht Nukleotiden umfasst.71. HMGA-binding nucleic acid according to one of claims 63 to 70, preferably 63 or 64, characterized in that the nucleic acid does not comprise a section Helix Al and Helix A2, whereby at the 5 'end of the nucleic acid the section Helix Bl and at the 3' - End of the helix B2 is arranged, wherein preferably the length of the section Helix Bl and Helix B2 each individually and independently comprises a length of four to eight nucleotides.
72. HMGA bindende Nukleinsäure nach Anspruch 71, wobei die Abschnitte Helix Bl und Helix B2 wenigstens teilweise oder vollständig miteinander hybridisiert sind, wobei sich die Hybridisierung über vier bis acht Nukleotidpaare erstreckt.72. HMGA-binding nucleic acid according to claim 71, wherein the sections Helix Bl and Helix B2 at least partially or completely hybridized with each other, wherein the hybridization extends over four to eight nucleotide pairs.
73. HMGA bindende Nukleinsäure nach einem der Ansprüche 61 bis 62, dadurch gekennzeichnet, dass zwischen dem 3 '-Ende des Abschnittes Helix Al und dem 5 '-Ende des Abschnittes Box Al ein bis fünf Nukleotide angeordnet sind und zwischen dem 3'- Ende des Abschnittes Box A2 und dem 5 '-Ende des Abschnittes Helix A2 ein bis drei Nukleotide angeordnet sind.73. HMGA-binding nucleic acid according to any one of claims 61 to 62, characterized in that between the 3 'end of the section helix Al and the 5' end of the section box Al one to five nucleotides are arranged and between the 3 ' End of the section box A2 and the 5 'end of the section Helix A2 one to three nucleotides are arranged.
74. HMGA bindende Nukleinsäure nach einem der Ansprüche 63 bis 72, dadurch gekennzeichnet, dass zwischen dem 3 '-Ende des Abschnittes Helix Bl und dem 5 '-Ende des Abschnittes Box Al zwei Nukleotide angeordnet sind und zwischen dem 3 '-Ende des Abschnittes Box A2 und dem 5 '-Ende des Abschnittes Helix B2 eins bis sieben Nukleotide angeordnet sind.74. HMGA-binding nucleic acid according to any one of claims 63 to 72, characterized in that between the 3 'end of the section Helix Bl and the 5' end of the section Box Al two nucleotides are arranged and between the 3 'end of the section Box A2 and the 5 'end of the section Helix B2 are arranged one to seven nucleotides.
75. HMGA bindende Nukleinsäure nach einem der Ansprüche 58 bis 65, 67, soweit sich dieser auf die Ansprüche 63 bis 65 bezieht, 69 und 70, soweit sich diese auf die Ansprüche 63 bis 65 und 67 beziehen, 71 und 72 soweit sich diese auf die Ansprüche 63 bis 65 und 67 und 69 und 70 beziehen, oder 74, soweit sich dieser auf die Ansprüche 63 bis 65, 67, 69 bis 72 bezieht, jeweils in dem hierin eingeschränkten Umfang, dadurch gekennzeichnet, dass der Zwischenabschnitt Zl sechs oder sieben Nukleotide umfasst.75. HMGA-binding nucleic acid according to one of claims 58 to 65, 67, as far as this relates to claims 63 to 65, 69 and 70, as far as they relate to claims 63 to 65 and 67, 71 and 72 as far as they are on Claims 63 to 65 and 67 and 69 and 70, or 74 insofar as it relates to claims 63 to 65, 67, 69 to 72, in each case to the extent limited herein, characterized in that the intermediate section Zl six or seven Nucleotides.
76. HMGA bindende Nukleinsäure nach Anspruch 75, dadurch gekennzeichnet, dass der Zwischenabschnitt Zl die Sequenz NiN2GN8N3N4N5 aufweist, wobei76. HMGA-binding nucleic acid according to claim 75, characterized in that the intermediate section Zl has the sequence NiN 2 GN 8 N 3 N 4 N 5 , wherein
N, = U, C, A oder G ist; N2 = G oder U ist; N3 = U oder C ist; N4 = U oder A ist; N5 = G oder A ist; und N8 = U ist oder fehlt.N, = U, C, A or G; N 2 = G or U; N 3 = U or C; N 4 = U or A; N 5 = G or A; and N 8 = U is or is missing.
77. HMGA bindende Nukleinsäure nach Anspruch 76, dadurch gekennzeichnet, dass die Nukleinsäure einen Abschnitt Box Al und einen Abschnitt Box A2 umfasst, wobei das 3 '-Ende des Abschnittes Box Al direkt mit dem 5 '-Ende des Zwischenabschnittes Zl verbunden ist, und das 3 '-Ende des Zwischenabschnittes Zl direkt mit dem 5'- Ende des Abschnittes Box A2 verbunden ist. 77. HMGA-binding nucleic acid according to claim 76, characterized in that the nucleic acid comprises a section box Al and a section box A2, wherein the 3 'end of the section box Al is connected directly to the 5' end of the intermediate section Zl, and the 3 'end of the intermediate section Zl is directly connected to the 5' end of the section A2.
78. HMGA bindende Nukleinsäure nach einem der Ansprüche 75 bis 77, insbesondere 77, dadurch gekennzeichnet, dass die Nukleinsäure einen Abschnitt Helix Bl und einen Abschnitt Helix B2 umfasst.78. HMGA-binding nucleic acid according to any one of claims 75 to 77, in particular 77, characterized in that the nucleic acid comprises a section Helix Bl and a section Helix B2.
79. HMGA bindende Nukleinsäure nach Anspruch 78, dadurch gekennzeichnet, dass die Abschnitte Helix Bl und Helix B2 jeweils einzeln und unabhängig voneinander vier bis acht Nukleotide umfassen, die bevorzugterweise vollständig oder teilweise miteinander hybridisiert sind.79. HMGA-binding nucleic acid according to claim 78, characterized in that the sections Helix Bl and Helix B2 each individually and independently comprise four to eight nucleotides, which are preferably fully or partially hybridized with each other.
80. HMGA bindende Nukleinsäure nach einem der Ansprüche 78 oder 79, dadurch gekennzeichnet, dass zwischen dem 3'-Ende des Abschnittes Helix Bl und dem 5'-Ende des Abschnittes Box Al in 5 '-3 '-Richtung zwei Nukleotide N6, N7 angeordnet sind, wobei N6 G, A oder U ist, und N7 = G oder U ist.80. HMGA-binding nucleic acid according to one of claims 78 or 79, characterized in that between the 3 'end of the section Helix Bl and the 5' end of the section Box Al in the 5 '-3' direction, two nucleotides N 6 , N 7 are arranged, wherein N 6 is G, A or U, and N 7 = G or U is.
81. HMGA bindende Nukleinsäure nach einem der Ansprüche 78 bis 80, dadurch gekennzeichnet, dass zwischen dem 3 '-Ende des Abschnittes Box A2 und dem 5'-Ende des Abschnittes Helix B2 kein Nukleotid angeordnet ist, oder in 5 '-3 '-Richtung die Nukleotidsequenz GNy angeordnet ist, wobei Ny null bis sechs Nukleotide umfasst, bevorzugterweise 0 oder 6 Nukleotide.81. HMGA-binding nucleic acid according to any one of claims 78 to 80, characterized in that between the 3 'end of the section box A2 and the 5' end of the section Helix B2 no nucleotide is arranged, or in 5 '-3' - Direction, the nucleotide sequence GN y is arranged, wherein N y comprises zero to six nucleotides, preferably 0 or 6 nucleotides.
82. HMGA bindende Nukleinsäure nach einem der Ansprüche 75 bis 81, dadurch gekennzeichnet, dass die Nukleinsäure einen Abschnitt Helix Al und Helix A2 umfasst.82. HMGA-binding nucleic acid according to any one of claims 75 to 81, characterized in that the nucleic acid comprises a section Helix Al and Helix A2.
83. HMGA bindende Nukleinsäure nach Anspruch 82, dadurch gekennzeichnet, dass die Abschnitte Helix Al und Helix A2 jeweils und unabhängig voneinander vier bis acht Nukleotide umfassen, wobei bevorzugterweise_die Abschnitte Helix Al und Helix A2 vollständig oder teilweise miteinander hybridisiert sind.83. HMGA-binding nucleic acid according to claim 82, characterized in that the sections Helix A1 and Helix A2 each independently and independently of each other comprise four to eight nucleotides, wherein preferably the sections Helix A1 and Helix A2 are completely or partially hybridized with one another.
84. HMGA bindende Nukleinsäure nach einem der Ansprüche 82 oder 83, dadurch gekennzeichnet, dass zwischen dem 3 '-Ende des Abschnittes Helix Al und dem 5 '-Ende des Abschnittes Helix Bl eine Nukleotidsequenz Nx angeordnet ist, wobei Nx null bis fünf Nukleotide umfasst. 84. HMGA-binding nucleic acid according to any one of claims 82 or 83, characterized in that between the 3 'end of the section Helix Al and the 5' end of the section Helix Bl a nucleotide sequence N x is arranged, wherein N x zero to five Nucleotides.
85. HMGA bindende Nukleinsäure nach einem der Ansprüche 82 bis 84, dadurch gekennzeichnet, dass zwischen dem 3 '-Ende des Abschnittes Helix B2 und dem 5 '-Ende des Abschnittes Helix A2 eine Nukleotidsequenz N2 angeordnet ist, wobei N2 null bis sechs Nukleotide umfasst.85. HMGA-binding nucleic acid according to any one of claims 82 to 84, characterized in that between the 3 'end of the section Helix B2 and the 5' end of the section Helix A2 a nucleotide sequence N 2 is arranged, wherein N 2 is zero to six Nucleotides.
86. HMGA bindende Nukleinsäure nach einem der Ansprüche 78 bis 85, wobei die Summe der hybridisierten Nukleotide aus der Hybridisierung von Abschnitt Helix Al mit Abschnitt Helix A2 und von Abschnitt Helix Bl mit Abschnitt Helix B2 10 bis 12 Nukleotidpaare beträgt.86. HMGA-binding nucleic acid according to any one of claims 78 to 85, wherein the sum of the hybridized nucleotides from the hybridization of section Helix Al with section Helix A2 and section Helix Bl section Helix B2 is 10 to 12 nucleotide pairs.
87. HMGA bindende Nukleinsäure nach einem der Ansprüche 81 bis 86, dadurch gekennzeichnet, dass zwischen dem 3 '-Ende des Abschnittes Box A2 und dem 5 '-Ende des Abschnittes Helix B2 in 5 '-3 '-Richtung die Nukleotidsequenz GNy angeordnet ist, wobei Ny null bis sechs Nukleotide umfasst, bevorzugterweise 0 oder 6 Nukleotide.87. HMGA-binding nucleic acid according to any one of claims 81 to 86, characterized in that arranged between the 3 'end of the section box A2 and the 5' end of the section Helix B2 in the 5 '-3' direction, the nucleotide sequence GN y wherein Ny comprises zero to six nucleotides, preferably 0 or 6 nucleotides.
88. HMGA bindende Nukleinsäure nach Anspruch 87 umfassend die folgende Struktur88. HMGA-binding nucleic acid according to claim 87 comprising the following structure
Helix Al-Nv-Helix BI-N6N7POxAlIN1N2GN8N3N4NSiBOX AlIG-NY-HeIiX B2-N7-Helix A2Helix Al-Nv helix BI-N 6 N 7 N 2 GN POxAlIN 1 8 N 3 N 4 N S iBOX Alig-N Y N 7 -HeIiX B2-A2 helix
wobeiin which
N2 = G oder U ist;N 2 = G or U;
N3 = U oder C ist;N 3 = U or C;
N4 = U oder A ist;N 4 = U or A;
N5 = G oder A ist;N 5 = G or A;
N6 = G, A oder U ist;N 6 = G, A or U;
N7 = G oder U ist;N 7 = G or U;
N8 = U oder kein Nukleotid ist;N 8 = U or no nucleotide;
Nx = null bis fünf Nukleotide ist;N x = zero to five nucleotides;
Ny = null oder sechs Nukleotide ist; undN y = zero or six nucleotides; and
N2 = null bis sechs Nukleotide ist; der Abschnitt Box Al und Abschnitt Box A2 jeweils einzeln und unabhängig voneinander ausgewählt sind aus der Gruppe von Nukleotidsequenzen umfassend GGGCG, GGGUG und GGGAG;N 2 = zero to six nucleotides; the section Box Al and section box A2 are each individually and independently selected from the group of nucleotide sequences comprising GGGCG, GGGUG and GGGAG;
der Abschnitt Helix Al und der Abschnitt Helix A2 jeweils einzeln und unabhängig voneinander vier bis acht Nukleotide umfassen, wobei bevorzugterweise die Abschnitte Helix Al und Helix A2 vollständig oder teilweise miteinander hybridisiert sind, undthe section Helix A1 and the section Helix A2 each individually and independently comprise four to eight nucleotides, wherein preferably the sections Helix Al and Helix A2 are completely or partially hybridized with each other, and
die Abschnitte Helix Bl und Helix B2 jeweils einzeln und unabhängig voneinander vier bis acht Nukleotide umfassen, wobei bevorzugterweise die Abschnitte Helix Bl und Helix B2 vollständig oder teilweise miteinander hybridisiert sind und der hybridisierende Bereich vier bis acht Nukleotide umfasst, und wobei die Summe der hybridisierten Nukleotide aus der Hybridisierung von Abschnitt Helix Al mit Abschnitt Helix A2 und von Abschnitt Helix Bl mit Abschnitt Helix B2 10 bis 12 Nukleotidpaare beträgt.the sections Helix Bl and Helix B2 each individually and independently comprise four to eight nucleotides, wherein preferably the sections Helix Bl and Helix B2 are fully or partially hybridized with each other and the hybridizing region comprises four to eight nucleotides, and wherein the sum of the hybridized nucleotides from the hybridization of section Helix Al with section Helix A2 and section Helix Bl with section Helix B2 is 10 to 12 nucleotide pairs.
89. HMGA bindende Nukleinsäure nach Anspruch 87 oder 88, umfassend eine Sequenz ausgewählt aus der Gruppe umfassend SEQ. ID. No. 1, SEQ. ID. No. 2, SEQ. ED. No. 3, SEQ. ID. No. 5, SEQ. ID. No. 6, SEQ. ID. No. 7 und SEQ. ID. No. 13.89. HMGA-binding nucleic acid according to claim 87 or 88, comprising a sequence selected from the group comprising SEQ. ID. No. 1, SEQ. ID. No. 2, SEQ. ED. No. 3, SEQ. ID. No. 5, SEQ. ID. No. 6, SEQ. ID. No. 7 and SEQ. ID. No. 13th
90. HMGA bindende Nukleinsäure nach einem der Ansprüche 81 bis 86, dadurch gekennzeichnet, dass sich das 3 '-Ende des Abschnittes Box A2 unmittelbar an das 5'- Ende des Abschnittes Helix B2 anschließt.90. HMGA-binding nucleic acid according to any one of claims 81 to 86, characterized in that connects the 3 'end of the section Box A2 directly to the 5' end of the section Helix B2.
91. HMGA bindende Nukleinsäure nach Anspruch 90 umfassend die folgende Struktur91. HMGA-binding nucleic acid according to claim 90 comprising the following structure
Helix Al-Nv-Helix B 1-N6N7POX AIIN1 N2GN8N3N4N5IBOX Ä2|Helix B2-Nz-Helix A2Helix Al-Nv helix B 1-N 6 N 7 POX AIIN 1 N 2 GN 8 N 3 N 4 N 5 IBOX AE2 | Helix B2-N z-helix A2
wobeiin which
N, = U, C, A oder G ist; N2 = G oder U ist; N3 = U oder C ist; N4 = U oder A ist;N, = U, C, A or G; N 2 = G or U; N 3 = U or C; N 4 = U or A;
N5 = G oder A ist;N 5 = G or A;
N6 = G, A oder U ist;N 6 = G, A or U;
N7 = G oder U ist;N 7 = G or U;
N8 = U oder kein Nukleotid ist;N 8 = U or no nucleotide;
Nx = null bis fünf Nukleotide ist; undN x = zero to five nucleotides; and
N2 = null bis sechs Nukleotide ist;N 2 = zero to six nucleotides;
der Abschnitt Box Al und Abschnitt Box A2 jeweils einzeln und unabhängig voneinander ausgewählt sind aus der Gruppe von Nukleotidsequenzen umfassend GGGCG, GGGUG und GGGAG;the section Box Al and section box A2 are each individually and independently selected from the group of nucleotide sequences comprising GGGCG, GGGUG and GGGAG;
der Abschnitt Helix Al und der Abschnitt Helix A2 jeweils einzeln und unabhängig voneinander vier bis acht Nukleotide umfassen, wobei bevorzugterweise die Abschnitte Helix Al und Helix A2 vollständig oder teilweise miteinander hybridisiert sind, undthe section Helix A1 and the section Helix A2 each individually and independently comprise four to eight nucleotides, wherein preferably the sections Helix Al and Helix A2 are completely or partially hybridized with each other, and
die Abschnitte Helix Bl und Helix B2 jeweils einzeln und unabhängig voneinander vier bis acht Nukleotide umfassen, wobei bevorzugterweise die Abschnitte Helix Bl und Helix B2 vollständig oder teilweise miteinander hybridisiert sind und der hybridisierende Bereich vier bis acht Nukleotide umfasst, und wobei die Summe der hybridisierten Nukleotide aus der Hybridisierung von Abschnitt Helix Al mit Abschnitt Helix A2 und von Abschnitt Helix Bl mit Abschnitt Helix B2 10 bis 12 Nukleotidpaare beträgt.the sections Helix Bl and Helix B2 each individually and independently comprise four to eight nucleotides, wherein preferably the sections Helix Bl and Helix B2 are fully or partially hybridized with each other and the hybridizing region comprises four to eight nucleotides, and wherein the sum of the hybridized nucleotides from the hybridization of section Helix Al with section Helix A2 and section Helix Bl with section Helix B2 is 10 to 12 nucleotide pairs.
92. HMGA bindende Nukleinsäure nach Anspruch 90 oder 91, umfassend eine Sequenz umfassend SEQ. ID. No. 3.92. HMGA-binding nucleic acid according to claim 90 or 91, comprising a sequence comprising SEQ. ID. No. Third
93. HMGA bindende Nukleinsäure nach Anspruch 88, umfassend die folgende Struktur93. HMGA-binding nucleic acid according to claim 88, comprising the following structure
Helix Bl-N6N7JBoX AIININ2GN8N3N4N5IBOX A2|G-NY-Helix B2Helix Bl-N 6 N 7 JBoX AlIn I N 2 GN 8 N 3 N 4 N 5 IBOX A2 | GN Y -Helix B2
94. HMGA bindende Nukleinsäure nach Anspruch 91 , umfassend die folgende Struktur. Helix Bl-N6N7JBoX AIININ2GN8N3N4N5IBOX Ä2|Helix B294. HMGA-binding nucleic acid according to claim 91, comprising the following structure. Helix Bl-N 6 N 7 JBoX AIIN I N 2 GN 8 N 3 N 4 N 5 IBOX A 2 | Helix B2
95. HMGA bindende Nukleinsäure nach Anspruch 93, wobei die Sequenz ausgewählt ist aus der Gruppe umfassend SEQ. ED. No. 15 und SEQ. ID. No. 16.95. HMGA-binding nucleic acid according to claim 93, wherein the sequence is selected from the group comprising SEQ. ED. No. 15 and SEQ. ID. No. 16th
96. HMGA bindende Nukleinsäure nach einem der Ansprüche 58 bis 70 und 73 oder 74, dadurch gekennzeichnet, dass der Zwischenabschnitt Z2 12 bis 25 Nukleotide umfasst.96. HMGA-binding nucleic acid according to any one of claims 58 to 70 and 73 or 74, characterized in that the intermediate section Z 2 comprises 12 to 25 nucleotides.
97. HMGA bindende Nukleinsäure nach Anspruch 96, dadurch gekennzeichnet, dass der Zwischenabschnitt Z2 einen Abschnitt Helix Cl und einen Abschnitt Helix C2 umfasst.97. HMGA-binding nucleic acid according to claim 96, characterized in that the intermediate section Z2 comprises a section Helix Cl and a section Helix C2.
98. HMGA bindende Nukleinsäure nach Anspruch 97, dadurch gekennzeichnet, dass zwischen dem Abschnitt Helix Cl und dem Abschnitt Helix C2 ein zentraler Abschnitt Nc angeordnet ist.98. HMGA-binding nucleic acid according to claim 97, characterized in that between the section Helix Cl and the section Helix C2 a central portion N c is arranged.
99. HMGA bindende Nukleinsäure nach Anspruch 97 oder 98, dadurch gekennzeichnet, dass die Länge des Abschnittes Helix Cl und Helix C2 gleich lang ist.99. HMGA-binding nucleic acid according to claim 97 or 98, characterized in that the length of the section Helix Cl and Helix C2 is the same length.
100. HMGA bindende Nukleinsäure nach einem der Ansprüche 97 bis 99, dadurch gekennzeichnet, dass die Länge des Abschnittes Helix Cl und Helix C2 einzeln und unabhängig drei bis sechs Nukleotide ist.100. HMGA-binding nucleic acid according to any one of claims 97 to 99, characterized in that the length of the section Helix Cl and Helix C2 individually and independently is three to six nucleotides.
101. HMGA bindende Nukleinsäure nach Anspruch 97 bis 100, dadurch gekennzeichnet, dass die Abschnitte Helix Cl und Helix C2 vollständig oder teilweise miteinander hybridisiert ist.101. HMGA-binding nucleic acid according to claim 97 to 100, characterized in that the sections Helix Cl and Helix C2 is completely or partially hybridized with each other.
102. HMGA bindende Nukleinsäure nach einem der Ansprüche 96 bis 101, dadurch gekennzeichnet, dass der zentrale Abschnitt N0 drei bis fünf Nukleotide umfasst.102. HMGA-binding nucleic acid according to any one of claims 96 to 101, characterized in that the central portion N 0 comprises three to five nucleotides.
103. HMGA bindende Nukleinsäure nach einem der Ansprüche 96 bis 102, dadurch gekennzeichnet, dass die Nukleinsäure einen Abschnitt Box Al und einen Abschnitt Box A2 umfasst, wobei zwischen dem 3'-Ende des Abschnittes Box Al und dem 5'-Ende des Abschnittes Helix Cl eine Nukleotidsequenz Nb angeordnet ist und drei Nukleotide umfasst.103. HMGA-binding nucleic acid according to any one of claims 96 to 102, characterized in that the nucleic acid comprises a section box Al and a section box A2, wherein between the 3 'end of the section box Al and the 5' end of the helix Cl section, a nucleotide sequence N b is arranged and comprises three nucleotides.
104. HMGA bindende Nukleinsäure nach einem der Ansprüche 96 bis 103, dadurch gekennzeichnet, dass die Nukleinsäure einen Abschnitt Box Al und einen Abschnitt Box A2 umfasst, wobei zwischen dem 3 '-Ende des Abschnittes Helix C2 und dem 5 '-Ende des Abschnittes Box A2 eine Nukleotidsequenz Nd angeordnet ist und zwei bis fünf Nukleotide umfasst.104. HMGA-binding nucleic acid according to any one of claims 96 to 103, characterized in that the nucleic acid comprises a section box Al and a section box A2, wherein between the 3 'end of the section helix C2 and the 5' end of the section box A2 is a nucleotide sequence N d and comprises two to five nucleotides.
105. HMGA bindende Nukleinsäure nach einem der Ansprüche 96 bis 104, dadurch gekennzeichnet, dass die Nukleinsäure einen Abschnitt Helix Al und einen Abschnitt Helix A2 umfasst.105. HMGA-binding nucleic acid according to any one of claims 96 to 104, characterized in that the nucleic acid comprises a section Helix Al and a section Helix A2.
106. HMGA bindende Nukleinsäure Anspruch 105, dadurch gekennzeichnet, dass die Abschnitte Helix Al und Helix A2 jeweils einzeln und unabhängig voneinander fünf bis sechs Nukleotide umfassen, wobei bevorzugterweise der Abschnitt Helix Al und der Abschnitt Helix A2 vollständig oder teilweise miteinander hybridisiert sind.106. HMGA-binding nucleic acid claim 105, characterized in that the sections Helix Al and Helix A2 each individually and independently of each other comprise five to six nucleotides, wherein preferably the section Helix Al and the section Helix A2 are completely or partially hybridized with each other.
107. HMGA bindende Nukleinsäure einem der Ansprüche 105 bis 106, dadurch gekennzeichnet, dass das zwischen dem 3 '-Ende des Abschnittes Helix Al und dem 5'-Ende des Abschnittes Box Al eine Nukleotidsequenz Na angeordnet ist, wobei Na ein bis fünf Nukleotide umfasst.107. HMGA-binding nucleic acid according to one of claims 105 to 106, characterized in that between the 3 'end of the section Helix Al and the 5' end of the section Box Al a nucleotide sequence N a is arranged, wherein N a one to five Nucleotides.
108. HMGA bindende Nukleinsäure nach einem der Ansprüche 105 bis 107, dadurch gekennzeichnet, dass zwischen dem 3 '-Ende des Abschnittes Box A2 und dem 5 '-Ende des Abschnittes Helix A2 in 5 '-3 '-Richtung eine Nukleotidsequenz GNe angeordnet ist, wobei Ne eins bis zwei Nukleotide, bevorzugterweise A oder UU umfasst.108. HMGA-binding nucleic acid according to any one of claims 105 to 107, characterized in that arranged between the 3 'end of the section box A2 and the 5' end of the section helix A2 in the 5 '-3' direction a nucleotide sequence GN e wherein N e comprises one to two nucleotides, preferably A or UU.
109. HMGA bindende Nukleinsäure nach einem der Ansprüche 105 bis 108, dadurch gekennzeichnet, dass der Abschnitt Helix Cl und der Abschnitt Helix C2 jeweils einzeln und unabhängig voneinander eine Länge von fünf oder sechs Nukleotiden aufweisen, wobei bevorzugterweise die Abschnitte Helix Cl und Helix C2 vollständig oder teilweise miteinander hybridisiert sind. 109. HMGA-binding nucleic acid according to any one of claims 105 to 108, characterized in that the section helix Cl and the section Helix C2 each individually and independently of one another have a length of five or six nucleotides, wherein preferably the sections helix Cl and helix C2 completely or partially hybridized with each other.
1 10. HMGA bindende Nukleinsäure nach Anspruch 109, umfassend die folgende Struktur:1 10. HMGA-binding nucleic acid according to claim 109, comprising the following structure:
(III) (III)
wobeiin which
N3 = ein bis fünf Nukleotide ist;N 3 = one to five nucleotides;
Nb = drei Nukleotide ist;N b = three nucleotides;
Nc = drei bis fünf Nukleotide ist;N c = three to five nucleotides;
Nd = zwei bis fünf Nukleotide ist; undN d = two to five nucleotides; and
Ne = eins bis zwei Nukleotide, bevorzugterweise A oder UU ist;N e = one to two nucleotides, preferably A or UU;
der Abschnitt Box Al und der Abschnitt Box A2 jeweils einzeln und unabhängig voneinander ausgewählt sind aus der Gruppe, die GGGCG, GGGUG und GGGAG um- fasst,the section Box Al and the section box A2 are each individually and independently selected from the group comprising GGGCG, GGGUG and GGGAG,
die Abschnitte Helix Al und Helix A2 jeweils einzeln und unabhängig voneinander fünf oder sechs Nukleotide umfassen, undthe sections Helix A1 and Helix A2 each individually and independently comprise five or six nucleotides, and
die Abschnitte Helix Cl und Helix C2 jeweils fünf oder sechs Nukleotide umfasst, die bevorzugterweise vollständig oder teilweise miteinander hybridisiert sind.the sections helix Cl and helix C2 each comprise five or six nucleotides, which are preferably fully or partially hybridized with each other.
111. HMGA bindende Nukleinsäure nach Anspruch 110, umfassend eine Sequenz, die ausgewählt ist aus der Gruppe umfassend SEQ. ED. No. 8, SEQ. DD. No. 9, SEQ. ID. No. 10, SEQ. ED. No. 11, SEQ. ID. No. 14, SEQ. ID. No. 22 und SEQ. ID. No. 24.111. The HMGA-binding nucleic acid according to claim 110, comprising a sequence selected from the group comprising SEQ. ED. No. 8, SEQ. DD. No. 9, SEQ. ID. No. 10, SEQ. ED. No. 11, SEQ. ID. No. 14, SEQ. ID. No. 22 and SEQ. ID. No. 24th
112. HMGA bindende Nukleinsäure nach einem der Ansprüche 96 bis 101, dadurch gekennzeichnet, dass die Nukleinsäure einen Abschnitt Box Al und einen Abschnitt Helix Cl umfasst, wobei zwischen dem 3 '-Ende des Abschnittes Box Al und dem 5'- Ende des Abschnittes Helix Cl ein Nukleotid A angeordnet ist. 112. HMGA-binding nucleic acid according to any one of claims 96 to 101, characterized in that the nucleic acid comprises a section box Al and a section helix Cl, wherein between the 3 'end of the section box Al and the 5' end of the section helix Cl is a nucleotide A is arranged.
113. HMGA bindende Nukleinsäure nach Anspruch 112, dadurch gekennzeichnet, dass die Nukleinsäure einen Abschnitt Helix C2 und einen Abschnitt Box A2 umfasst, wobei zwischen dem 3 '-Ende des Abschnittes Helix C2 und dem 5 '-Ende des Abschnittes Box A2 ein Nukleotid G angeordnet ist.113. HMGA-binding nucleic acid according to claim 112, characterized in that the nucleic acid comprises a section helix C2 and a section box A2, wherein between the 3 'end of the section helix C2 and the 5' end of the section box A2 a nucleotide G is arranged.
114. HMGA bindende Nukleinsäure nach Anspruch 112 oder 113, dadurch gekennzeichnet, dass der zentrale Abschnitt Nc vier Nukleotide umfasst, , wobei Nc bevorzugterweise GAUG ist.114. HMGA-binding nucleic acid according to claim 112 or 113, characterized in that the central portion N c comprises four nucleotides, wherein N c is preferably GAUG.
115. HMGA bindende Nukleinsäure nach einem der Ansprüche 112 bis 114, umfassend einen Abschnitt Helix Bl und einen Abschnitt Helix B2.115. HMGA-binding nucleic acid according to any one of claims 112 to 114, comprising a section Helix Bl and a section Helix B2.
116. HMGA bindende Nukleinsäure nach Anspruch 115, dadurch gekennzeichnet, dass die Abschnitte Helix Bl und Helix B2 einzeln und unabhängig voneinander jeweils fünf Nukleotide umfassen, wobei bevorzugterweise der Abschnitt Helix Bl mit dem Abschnitt Helix B2 hybridisiert ist.116. HMGA-binding nucleic acid according to claim 115, characterized in that the sections Helix Bl and Helix B2 individually and independently each comprise five nucleotides, wherein preferably the section Helix Bl is hybridized with the section Helix B2.
117. HMGA bindende Nukleinsäure nach Anspruch 115 oder 116, dadurch gekennzeichnet, dass zwischen dem 3'-Ende des Abschnittes Helix Bl und dem 5'-Ende des Abschnittes Box Al eine Nukleotidsequenz umfassend zwei Nukleotide N, angeordnet sind, wobei Nj bevorzugterweise AG ist.117. HMGA-binding nucleic acid according to claim 115 or 116, characterized in that between the 3 'end of the section Helix Bl and the 5' end of the section Box Al a nucleotide sequence comprising two nucleotides N, are arranged, wherein N j is preferably AG is.
118. HMGA bindende Nukleinsäure nach einem der Ansprüche 115 bis 117, dadurch gekennzeichnet, dass zwischen dem 3 '-Ende des Abschnittes Box A2 und dem 5 '-Ende von Helix B2 ein Nukleotid G angeordnet ist.118. HMGA-binding nucleic acid according to any one of claims 115 to 117, characterized in that between the 3 'end of the section box A2 and the 5' end of helix B2, a nucleotide G is arranged.
119. HMGA bindende Nukleinsäure nach einem der Ansprüche 112 bis 118, umfassend einen Abschnitt Helix Al und einen Abschnitt Helix A2.119. HMGA-binding nucleic acid according to any one of claims 112 to 118, comprising a section Helix Al and a section Helix A2.
120. HMGA bindende Nukleinsäure nach Anspruch 119, wobei die Abschnitte Helix Al und Helix A2 einzeln und unabhängig voneinander jeweils sechs Nukleotide umfassen und bevorzugterweise der Abschnitt Helix Al und der Abschnitt Helix A2 miteinander hybridisiert sind. 120. The HMGA-binding nucleic acid according to claim 119, wherein the sections Helix A1 and Helix A2 individually and independently each comprise six nucleotides and preferably the section Helix A1 and the section Helix A2 are hybridized to one another.
121. HMGA bindende Nukleinsäure nach Anspruch 119 oder 120, dadurch gekennzeichnet, dass zwischen dem 3 '-Ende des Abschnittes Helix Al und dem 5'-Ende des Abschnittes Helix Bl eine Nukleotidsequenz umfassend zwei Nukleotide N, angeordnet ist, wobei Nj bevorzugterweise CA ist.121. HMGA-binding nucleic acid according to claim 119 or 120, characterized in that between the 3 'end of the section Helix Al and the 5' end of the section Helix Bl a nucleotide sequence comprising two nucleotides N, is arranged, wherein Nj is preferably CA. ,
122. HMGA bindende Nukleinsäure nach einem der Ansprüche 119 bis 121, dadurch gekennzeichnet, dass zwischen dem 3 '-Ende des Abschnittes Helix B2 und dem 5 '-Ende des Abschnittes Helix A2 ein Nukleotid A ist.122. HMGA-binding nucleic acid according to any one of claims 119 to 121, characterized in that between the 3 'end of the section Helix B2 and the 5' end of the section Helix A2 is a nucleotide A.
123. HMGA bindende Nukleinsäure nach einem der Ansprüche 112 bis 122, dadurch gekennzeichnet, dass die Abschnitte Helix Cl und Helix C2 jeweils drei Nukleotide umfassen, wobei bevorzugterweise die Abschnitte Helix Cl und Helix C2 miteinander hybridisiert sind.123. HMGA-binding nucleic acid according to any one of claims 112 to 122, characterized in that the sections helix Cl and helix C2 each comprise three nucleotides, wherein preferably the sections helix Cl and helix C2 are hybridized with each other.
124. HMGA bindende Nukleinsäure nach Anspruch 123 umfassend die folgende Struktur:124. HMGA-binding nucleic acid according to claim 123 comprising the following structure:
Helix Al-NrHelix Bl-Nj-fBox Al|-A-Ηelix Cl'-Nc-<Helix C2'-G-|Box Ä2|-G-Helix B2-AHelix Al-NrHelix Bl-Nj FBOX Al | -A-Ηelix Cl 'N c - <Helix C2' G | Box AE2 | -G-Helix B2-A
Helix A2Helix A2
wobeiin which
Nj = zwei Nukleotide umfasst, bevorzugterweise CA ist; Nj = zwei Nukleotide umfasst, bevorzugterweise AG ist; Nc = vier Nukleotide umfasst, bevorzugterweise GAUG ist;Nj = two nucleotides, preferably CA; Nj = two nucleotides, preferably AG; N c = four nucleotides, preferably GAUG;
die Abschnitte Box Al und Box A2 jeweils einzeln und unabhängig voneinander ausgewählt sind aus der Gruppe umfassend die Sequenzen GGGCG, GGGUG und GGGAG;the sections Box Al and Box A2 are each individually and independently selected from the group comprising the sequences GGGCG, GGGUG and GGGAG;
die Abschnitte Helix Al und Helix A2 jeweils einzeln und unabhängig sechs Nukleotide umfassen, die bevorzugterweise miteinander hybridisiert sind; die Abschnitte Helix Bl und Helix B2 jeweils einzeln und unabhängig fünf Nukleotide umfassen, wobei bevorzugterweise der Abschnitt Helix Bl und der Abschnitt Helix B2 miteinander hybridisiert ist; undthe sections Helix A1 and Helix A2 each individually and independently comprise six nucleotides, which are preferably hybridized with each other; the sections Helix Bl and Helix B2 individually and independently comprise five nucleotides, wherein preferably the section Helix Bl and the section Helix B2 are hybridized with each other; and
die Abschnitte Helix Cl und Helix C2 jeweils einzeln und unabhängig drei Nukleotide umfassen, wobei bevorzugterweise die Abschnitte Helix Cl und Helix C2 miteinander hybridisiert sind.the sections helix Cl and helix C2 each individually and independently comprise three nucleotides, wherein preferably the sections helix Cl and helix C2 are hybridized with each other.
125. HMGA bindende Nukleinsäure nach Anspruch 124, umfassend eine Sequenz, die ausgewählt ist aus der Gruppe umfassend SEQ. ID. No. 12.125. The HMGA-binding nucleic acid of claim 124, comprising a sequence selected from the group comprising SEQ. ID. No. 12th
126. Nukleinsäure nach einem der Ansprüche 57 bis 125, dadurch gekennzeichnet, dass sie an Transkriptionsfaktoren binden, insbesondere Transkriptionsfaktoren, die einen AT- Haken aufweisen.126. A nucleic acid according to any one of claims 57 to 125, characterized in that they bind to transcription factors, in particular transcription factors which have an AT hook.
127. Nukleinsäure bindend an einen Transkriptionsfaktor umfassend einen AT-Haken, wobei die Nukleinsäure einen Aufbau gemäß einem der Ansprüche 57 bis 126 umfasst.127. A nucleic acid binding to a transcription factor comprising an AT-hook, wherein the nucleic acid comprises a construction according to one of claims 57 to 126.
128. Zusammensetzung nach einem der Ansprüche 37 bis 52, wobei die L-Nukleinsäure eine Nukleinsäure nach einem der Ansprüche 57 bis 127 ist.128. The composition according to any one of claims 37 to 52, wherein the L-nucleic acid is a nucleic acid according to any one of claims 57 to 127.
129. Verwendung nach einem der Ansprüche 1 bis 8, wobei die L-Nukleinsäure eine Nukleinsäure nach einem der Ansprüche 57 bis 127 ist.129. Use according to any one of claims 1 to 8, wherein the L-nucleic acid is a nucleic acid according to any one of claims 57 to 127.
130. Verfahren nach einem der Ansprüche 9 bis 16, wobei die L-Nukleinsäure eine Nukleinsäure nach einem der Ansprüche 57 bis 127 ist.130. The method according to any one of claims 9 to 16, wherein the L-nucleic acid is a nucleic acid according to any one of claims 57 to 127.
131. Verwendung nach einem der Ansprüche 17 bis 26, wobei die L-Nukleinsäure eine Nukleinsäure nach einem der Ansprüche 57 bis 127 ist.131. Use according to any one of claims 17 to 26, wherein the L-nucleic acid is a nucleic acid according to any one of claims 57 to 127.
132. Verfahren nach einem der Ansprüche 27 bis 36, wobei die L-Nukleinsäure eine Nukleinsäure nach einem der Ansprüche 57 bis 127 ist. 132. The method according to any one of claims 27 to 36, wherein the L-nucleic acid is a nucleic acid according to any one of claims 57 to 127.
133. Verfahren zum Screenen eines HMGA- Antagonisten oder HMGA- Agonisten umfassend die folgenden Schritte:133. A method of screening an HMGA antagonist or HMGA agonist comprising the steps of:
Bereitstellen eines Kandidaten-HMGA-Antagonisten und/oder eines Kandida- ten-HMGA-Agonisten,Providing a candidate HMGA antagonist and / or a candidate HMGA agonist,
Bereitstellen einer Nukleinsäure nach einem der Ansprüche 57 bis 127,Providing a nucleic acid according to one of claims 57 to 127,
Bereitstellen eines Testsystems, welches ein Signal in Gegenwart eines HMGA-Antagonisten und/oder eines HMGA-Agonisten liefert, undProviding a test system which provides a signal in the presence of an HMGA antagonist and / or an HMGA agonist, and
Bestimmen, ob der Kandidaten-HMGA-Antagonist ein HMGA-Antagonist ist und/oder ob der Kandidaten-HMGA-Agonist ein HMGA- Agonist ist.Determining whether the candidate HMGA antagonist is an HMGA antagonist and / or whether the candidate HMGA agonist is an HMGA agonist.
134. Verfahren zum Screenen eines HMGA-Agonisten und/oder eines HMGA- Antagonisten umfassend die folgenden Schritte:134. A method for screening an HMGA agonist and / or an HMGA antagonist comprising the following steps:
Bereitstellen eines an einer Phase, bevorzugterweise einer Festphase, imobili- sierten HMGA,Providing a HMGA immobilized on one phase, preferably a solid phase,
Bereitstellen einer Nukleinsäure gemäß einem der Ansprüche 57 bis 127, bevorzugterweise eine Nukleinsäure nach einem der Ansprüche 57 bis 127, die markiert ist,Providing a nucleic acid according to one of claims 57 to 127, preferably a nucleic acid according to any one of claims 57 to 127, which is labeled
Zugeben eines Kandidaten-HMGA-Agonisten und/oder eines Kandidaten- HMGA-Antagonisten, undAdding a candidate HMGA agonist and / or a candidate HMGA antagonist, and
Bestimmen, ob der Kandidaten-HMGA-Agonist ein HMGA-Agonist ist und/oder ob der Kandidaten-HMGA-Antagonist ein HMGA-Antagonist ist.Determining whether the candidate HMGA agonist is an HMGA agonist and / or whether the candidate HMGA antagonist is an HMGA antagonist.
135. Verfahren nach Anspruch 134, dadurch gekennzeichnet, dass die Bestimmung so durchgeführt wird, dass getestet wird, ob die Nukleinsäure durch den Kandidaten- HMGA-Agonisten oder durch den Kandidaten-HMGA-Antagonisten ersetzt wird. 135. The method of claim 134, characterized in that the determination is made to test whether the nucleic acid is replaced by the candidate HMGA agonist or by the candidate HMGA antagonist.
136. Kit für den Nachweis von HMGA, umfassend eine Nukleinsäure nach einem der Ansprüche 57 bis 127.136. A kit for the detection of HMGA, comprising a nucleic acid according to any one of claims 57 to 127.
137. HMG A- Antagonist, erhältlich durch ein Verfahren nach einem der Ansprüche 134 oder 135.137. HMG A antagonist obtainable by a method according to any one of claims 134 or 135.
138. HMGA-Agonist, erhältlich durch ein Verfahren nach einem der Ansprüche 134 oder 135.138. HMGA agonist obtainable by a method according to any one of claims 134 or 135.
139. Komplex umfassend ein HMGA-Protein und eine Nukleinsäure nach einem der Ansprüche 57 bis 127. 139. A complex comprising an HMGA protein and a nucleic acid according to any one of claims 57 to 127.
EP06742799A 2005-05-04 2006-05-04 Novel use of spiegelmers Ceased EP1877069A2 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
EP09016125A EP2206501A3 (en) 2005-05-04 2006-05-04 HMGA binding nucleic acids

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
DE102005020874 2005-05-04
PCT/EP2006/004180 WO2006117217A2 (en) 2005-05-04 2006-05-04 Novel use of spiegelmers

Publications (1)

Publication Number Publication Date
EP1877069A2 true EP1877069A2 (en) 2008-01-16

Family

ID=36928624

Family Applications (2)

Application Number Title Priority Date Filing Date
EP06742799A Ceased EP1877069A2 (en) 2005-05-04 2006-05-04 Novel use of spiegelmers
EP09016125A Withdrawn EP2206501A3 (en) 2005-05-04 2006-05-04 HMGA binding nucleic acids

Family Applications After (1)

Application Number Title Priority Date Filing Date
EP09016125A Withdrawn EP2206501A3 (en) 2005-05-04 2006-05-04 HMGA binding nucleic acids

Country Status (11)

Country Link
US (2) US8497250B2 (en)
EP (2) EP1877069A2 (en)
JP (2) JP2008540363A (en)
KR (2) KR101418367B1 (en)
CN (2) CN104293780A (en)
AU (1) AU2006243334A1 (en)
BR (1) BRPI0610367A2 (en)
CA (1) CA2607185A1 (en)
MX (1) MX2007013760A (en)
SG (1) SG161311A1 (en)
WO (1) WO2006117217A2 (en)

Families Citing this family (39)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9492400B2 (en) 2004-11-04 2016-11-15 Massachusetts Institute Of Technology Coated controlled release polymer particles as efficient oral delivery vehicles for biopharmaceuticals
WO2007070682A2 (en) 2005-12-15 2007-06-21 Massachusetts Institute Of Technology System for screening particles
CA2648099C (en) 2006-03-31 2012-05-29 The Brigham And Women's Hospital, Inc System for targeted delivery of therapeutic agents
CN101573141B (en) 2006-05-15 2016-05-04 麻省理工学院 For the polymer of functional particles
US9381477B2 (en) 2006-06-23 2016-07-05 Massachusetts Institute Of Technology Microfluidic synthesis of organic nanoparticles
US9217129B2 (en) 2007-02-09 2015-12-22 Massachusetts Institute Of Technology Oscillating cell culture bioreactor
EP2144600A4 (en) 2007-04-04 2011-03-16 Massachusetts Inst Technology POLY TARGETING FRACTIONS (AMINO ACID)
MX350501B (en) 2007-10-12 2017-09-07 Massachusetts Inst Technology Vaccine nanotechnology.
US8343497B2 (en) 2008-10-12 2013-01-01 The Brigham And Women's Hospital, Inc. Targeting of antigen presenting cells with immunonanotherapeutics
US8277812B2 (en) 2008-10-12 2012-10-02 Massachusetts Institute Of Technology Immunonanotherapeutics that provide IgG humoral response without T-cell antigen
US8343498B2 (en) 2008-10-12 2013-01-01 Massachusetts Institute Of Technology Adjuvant incorporation in immunonanotherapeutics
US8591905B2 (en) 2008-10-12 2013-11-26 The Brigham And Women's Hospital, Inc. Nicotine immunonanotherapeutics
KR20120023830A (en) 2009-05-27 2012-03-13 셀렉타 바이오사이언시즈, 인크. Nanocarriers possessing components with different rates of release
US20130149314A1 (en) * 2010-02-09 2013-06-13 Jörn Bullerdiek p19Arf, HMGA2 and MDM2 For Use in the Diagnosis and Treatment of Aberrant Cell Growth
EP2561079A1 (en) 2010-04-21 2013-02-27 Noxxon Pharma AG Lipid binding nucleic acids
EP2575773A4 (en) 2010-05-26 2014-06-25 Selecta Biosciences Inc Synthetic nanocarrier combination vaccines
CN102375064A (en) * 2010-08-26 2012-03-14 杭州华得森生物技术有限公司 In-vitro diagnostic kit for detecting HMGA2 (High Mobility Group A) content with enzyme-linked immuno sorbent assay
DE102010056610A1 (en) * 2010-12-31 2012-07-05 Volker A. Erdmann Pharmaceutical composition containing L-DNA
EP2736537A4 (en) 2011-07-29 2015-04-15 Selecta Biosciences Inc Synthetic nanocarriers that generate humoral and cytotoxic t lymphocyte (ctl) immune responses
SG11201401362TA (en) * 2011-10-21 2014-05-29 Noxxon Pharma Ag Glucagon binding nucleic acids
US9163243B2 (en) * 2012-01-10 2015-10-20 Noxxon Pharma Ag Nucleic acids specifically binding CGRP
CN103566377A (en) 2012-07-18 2014-02-12 上海博笛生物科技有限公司 Targeted immunotherapy for cancer
US9233119B2 (en) * 2012-09-27 2016-01-12 Miami University Use of HGMA-targeted phosphorothioate DNA aptamers to suppress carcinogenic activity and increase sensitivity to chemotherapy agents in human cancer cells
WO2014193964A2 (en) * 2013-05-28 2014-12-04 Marsha Rosner Prognostic and predictive breast cancer signature
US10679730B2 (en) 2013-05-28 2020-06-09 The University Of Chicago Prognostic and predictive breast cancer signature
CN114671954A (en) 2014-01-10 2022-06-28 博笛生物科技有限公司 Compounds and compositions targeting HER2 positive tumors
CN112546230A (en) 2014-07-09 2021-03-26 博笛生物科技有限公司 Combination therapeutic compositions and combination therapeutic methods for treating cancer
CN105440135A (en) 2014-09-01 2016-03-30 博笛生物科技有限公司 Anti-PD-L1 conjugate for treating tumors
CN107074958A (en) 2014-07-09 2017-08-18 博笛生物科技有限公司 Anti- PD L1 for treating tumour are combined
KR101755617B1 (en) 2014-07-23 2017-07-10 한국과학기술연구원 Drug Carrier Having Self-assembled 3-D Nucleic Acid Nano-structure
ES2874562T3 (en) * 2014-12-19 2021-11-05 Kemin Ind Inc Intraocular delivery of bioactive molecules through the use of iontophoresis
CN107613980A (en) 2015-05-31 2018-01-19 源生公司 combination composition for immunotherapy
WO2017044859A1 (en) 2015-09-10 2017-03-16 Affigen, Inc. Sequencing-directed selection of tumor theranostics
DE17829597T1 (en) * 2016-11-30 2019-12-05 Noxxon Pharma Ag METHOD FOR THE POLYALKOXYLATION OF NUCLEIC ACIDS FOR THE RECOVERY AND RE-USE OF AN EXCESSIVE POLYALKOXYLATION REAGENT
WO2020055663A1 (en) * 2018-09-11 2020-03-19 The Texas A&M University System L-oligonucleotide inhibitors of polycomb repressive complex 2 (prc2)
KR20230005908A (en) * 2020-04-30 2023-01-10 벨라니디 테크놀로지스 엘엘씨 Molecular wire for detecting biological or chemical entities or events
CN112725438B (en) * 2021-02-05 2023-08-22 深圳市宝安区妇幼保健院 Endometrial polyp methylation marker combination, detection kit and application
CN114807183B (en) * 2021-12-06 2023-06-02 西藏自治区农牧科学院农业研究所 New use of highland barley cyanidin oxymethyl transferase gene
CN118311277B (en) * 2024-06-11 2024-12-31 北京卫未科学技术有限公司 Kit for early screening and auxiliary diagnosis of cancers and application thereof

Family Cites Families (21)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5622828A (en) * 1990-06-11 1997-04-22 Nexstar Pharmaceuticals, Inc. High-affinity oligonucleotide ligands to secretory phospholipase A2 (sPLA2)
EP1793006A3 (en) * 1993-09-08 2007-08-22 Gilead Sciences, Inc. Nucleic acid ligands and improved methods for producing the same
JPH11504926A (en) * 1995-05-04 1999-05-11 ネクスター ファーマスーティカルズ,インコーポレイテッド Nucleic acid ligand complex
US5780611A (en) * 1995-09-15 1998-07-14 Ramareddy Venkata Guntaka Oligomers which inhibit expression of collagen genes
US6171779B1 (en) 1996-07-12 2001-01-09 University Of Medicine & Dentistry Of New Jersey HMGI proteins in cancer
US6605713B1 (en) * 1996-08-30 2003-08-12 Jens Peter Furste Mirror-symmetrical selection and evolution of nucleic acids
DE19726186A1 (en) * 1997-06-20 1998-12-24 Boehringer Ingelheim Int Complexes for the transport of nucleic acid into higher eukaryotic cells
CN1479632A (en) * 2000-10-09 2004-03-03 拜尔公司 Complexes for transferring necleic acids into cells
DE10118452A1 (en) * 2001-04-12 2002-10-31 Joern Bullerdiek Nucleic acid sequences from hyperplasias and thyroid tumors
EP1438321B1 (en) * 2001-10-26 2010-05-26 Noxxon Pharma AG Modified l-nucleic acid
EP1453531B1 (en) * 2001-12-19 2008-05-14 Alcedo Biotech GmbH Use of hmgb proteins and nucleic acids that code therefor
DE10211558A1 (en) * 2002-03-15 2003-10-09 Noxxon Pharma Ag Use of double-stranded RNA containing L-nucleotide, for treating cancer, infections and virus disease, also in screening for immunomodulators
WO2003094973A1 (en) * 2002-05-08 2003-11-20 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. Agent and method for transporting biologically active molecules in cells
US7250496B2 (en) * 2002-11-14 2007-07-31 Rosetta Genomics Ltd. Bioinformatically detectable group of novel regulatory genes and uses thereof
JP2006517537A (en) * 2003-01-03 2006-07-27 アルケド バイオテック ゲーエムベーハー Use of DNA-binding proteins
US7595304B2 (en) * 2003-04-13 2009-09-29 Enzon Pharmaceuticals, Inc. Polymeric oligonucleotide prodrugs
AU2004238076A1 (en) * 2003-05-09 2004-11-25 Novosom Ag Injectable liposomal depots for delivering active ingredients
CA2526853A1 (en) * 2003-05-23 2005-03-03 Board Of Regents - The University Of Texas System Structure based and combinatorially selected oligonucleoside phosphorothioate and phosphorodithioate aptamer targeting ap-1 transcription factors
US7727969B2 (en) * 2003-06-06 2010-06-01 Massachusetts Institute Of Technology Controlled release nanoparticle having bound oligonucleotide for targeted delivery
AU2005209242A1 (en) * 2004-01-26 2005-08-11 Psivida Inc. Controlled and sustained delivery of nucleic acid-based therapeutic agents
SG158175A1 (en) * 2004-12-27 2010-01-29 Silence Therapeutics Ag Lipid complexes coated with peg and their use

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO2006117217A2 *

Also Published As

Publication number Publication date
CN104293780A (en) 2015-01-21
KR20140042941A (en) 2014-04-07
WO2006117217A3 (en) 2007-08-09
KR20080009276A (en) 2008-01-28
US8497250B2 (en) 2013-07-30
US9074214B2 (en) 2015-07-07
JP2013224319A (en) 2013-10-31
US20090192100A1 (en) 2009-07-30
CN101217967A (en) 2008-07-09
CA2607185A1 (en) 2006-11-09
SG161311A1 (en) 2010-05-27
KR101418367B1 (en) 2014-07-25
MX2007013760A (en) 2008-01-28
CN101217967B (en) 2014-09-10
JP2008540363A (en) 2008-11-20
WO2006117217A2 (en) 2006-11-09
JP5766750B2 (en) 2015-08-19
US20130337049A1 (en) 2013-12-19
AU2006243334A1 (en) 2006-11-09
BRPI0610367A2 (en) 2010-06-15
EP2206501A2 (en) 2010-07-14
EP2206501A3 (en) 2010-09-29
KR101418369B1 (en) 2014-07-24

Similar Documents

Publication Publication Date Title
EP1877069A2 (en) Novel use of spiegelmers
Tang et al. In vitro selection of DNA aptamer against abrin toxin and aptamer-based abrin direct detection
EP3049523B1 (en) Multiaptamer target detection
US20100261291A1 (en) Nucleic acids specifically binding bioactive ghrelin
JP2011024592A (en) Further novel form of interfering rna molecule
CN104293794B (en) Nucleic acid aptamers specifically combined with beta-amyloid precursor protein lyase 1 and application of aptamers
Al-Turki et al. Mammalian telomeric RNA (TERRA) can be translated to produce valine–arginine and glycine–leucine dipeptide repeat proteins
EP2821504A1 (en) Method for designating disease relating to amount of tdp-43 existing in cells
Ranjith-Kumar et al. Single-stranded oligonucleotides can inhibit cytokine production induced by human toll-like receptor 3
WO2016009225A2 (en) Method for preventing or treating a protein aggregation disease
JP2006500014A (en) Newer forms of interfering RNA molecules
AU2012241062A1 (en) Novel use of spiegelmers
Kletzien et al. The RNA-binding selectivity of the RGG/RG motifs of hnRNP U is abolished by elements within the C-terminal intrinsically disordered region
Wang et al. n oligonucleotides correct RNA mis-splicing in TDP-43 pathology
Liu et al. A primate-specific RNA-binding protein (RBMXL3) is involved in glucocorticoid regulation of human pulmonary surfactant protein B (SP-B) mRNA stability
Martín García et al. Alternative splicing regulation of cell-cycle genes by SPF45/SR140/CHERP complex controls cell proliferation
Elles Escherichia coli RNA helicase DbpA and its role in assembly of the large subunit of the ribosome
Mokhtarian Gene expression detection using Targeted Reversibly Activated Probe (TRAP)
WO2002081686A2 (en) Nucleic acids binding a neuropeptide

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20071105

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LI LT LU LV MC NL PL PT RO SE SI SK TR

AX Request for extension of the european patent

Extension state: AL BA HR MK YU

17Q First examination report despatched

Effective date: 20080214

DAX Request for extension of the european patent (deleted)
REG Reference to a national code

Ref country code: DE

Ref legal event code: R003

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION HAS BEEN REFUSED

18R Application refused

Effective date: 20131125