FR2694766A1 - New nucleic acid encoding aminopeptidase PepC of Lactococcus lactis - useful in cheese mfr., also related vectors, transformants, polypeptide(s) etc. - Google Patents

Abstract

Nucleic acid fragment (I) comprising a sequence encoding aminopeptidase PepC (II) of Lactococcus lactis, or a fragment of it, is new. Also claimed are (1) fragments (Ia) of over 10 hp which hybridise specifically with (I) or its complement; (2) recombinant vectors contg. (I) or (Ia); (3) eukaryotic or prokaryotic cells transformed with (I) or (Ia); (4) (II), a polypeptide of 435 amino acids etc. USE/ADVANTAGE - The transformed cells and recombinant proteins are useful in mfr. of foods, esp. cheese. (II) is one of the enzymes involved in cheese maturation, i.e. it generates amino acids (flavour precursors) and decomposes bitter peptides. Transformed cells produce PepC at a higher level than wild type strains.

Description

 The invention relates to the cloning of DNA sequences carrying a gene coding for the PepC aminopeptidase from Lactococcus lactis, to the production of said aminopeptidase, and to its uses.

 The lactococci used in the dairy industry have a complex proteolytic system which plays a role both in bacterial growth and in the ripening of cheese. Free amino acids and small peptides necessary for bacterial growth are present in milk in relatively small quantities, and microorganisms must therefore hydrolyze the main milk proteins, caseins, in order to achieve high cell density.

 In addition, the proteolytic enzymes contribute to the ripening of the cheese by producing free amino acids which are the precursors of the flavoring of the cheese, and by degrading the bitter peptides responsible for defects in the cheese.

 The extracellular proteinase associated with the cell envelope [MONNET et al., Appl. Microbiol.

Biotechnol. 31: 112-118 (1989)], first hydrolyzes casein into oligopeptides. The subsequent degradation of these oligopeptides by peptidases, in combination with the action of peptide and amino acid transport systems, produces the amino acids used by bacteria for their biosynthesis.

A large variety of peptidases with different specificities have been demonstrated in different strains of Lactococcus lactis; several enzymes, for example aminopeptidases, dipeptidases, tripeptidases as well as endopeptidases (for review see J. KOK [FEMS Microbiology
Reviews, 87, 15-42 (1990)], have been purified and their biochemical properties have been determined.

 In addition, genetic studies have been undertaken with the aim of obtaining more information concerning the structure, localization and expression of these enzymes, in order to elucidate the contribution of each of them in the degradation process. caseins. The cloning of said genes has also been undertaken, with the aim, for example, of being able to increase the expression of an enzyme by inserting several copies of the corresponding gene in the same bacterium, or of being able to transfer them to another bacterial strain used in the dairy industry, or to be able to produce the corresponding enzymes by genetic engineering.

The pepXP gene coding for an X-prolyldipeptidyl-aminopeptidase was first characterized [NARDI et al., Appl. About. Microbio., 57, 45-50, (1991); MAYO et al., Appl. About. Microbiol., 57, 3844, (1991)]
More recently, the pepN gene which codes for a metallo-aminopeptidase called PepN (or also AP II) has been cloned, VAN ALEN-BOERRIGTER et al [Appl. About.

Microbiol. 57: 2555-2561 (1991)]. Aminopeptidase AP II had previously been characterized and purified by TAN and
KONINGS, [Appl. About. Microbiol., 56: 526-532 (1990)]
Another aminopeptidase, called PepC (or also AP I), and also having a broad specificity of substrates, was purified from
Lactococcus. lactis subsp cremoris AM2, and its existence in other lactococci has been demonstrated [NEVIANI et al., Appl. About. Microbiol., 55: 2308-2314 (1989)
PCT application WO / 91 03738, on behalf of the NATIONAL INSTITUTE OF
AGRONOMIC RESEARCH; BOQUIEN et al., Appl Environ.

Microbiol., 57, 2211-2216, (1991)].

Biochemical and immunochemical studies have shown that PepC aminopeptidase is clearly different from PepN aminopeptidase. Aminopeptidase
PepC hydrolyzes amino acids substituted by naphthylamide, as well as di- and tripeptides.

 It is a 300 kDa hexamer composed of identical subunits, and its enzymatic activity is inhibited by the compounds which block the thiol groups, but not by the conventional inhibitors of serine proteases and metallo-proteases.

 The inventors have now undertaken to clone and sequence the gene coding for the PepC aminopeptidase of lactococci.

The gene encoding the PepC aminopeptidase from
Lactococcus lactis subsp. cremoris AM2 was cloned by complementation of a pepN mutant from Escherichia col i, which mutant lacks aminopeptidase activity.

A DNA library of the AM2 strain was constructed in the E. coli mutant using the plasmid Bluescript, and was screened using an enzymatic box assay using Leu-naphthylamide as substrate. A clone expressing PepC aminopeptidase activity was selected by immunoblotting using polyclonal antibodies directed against the purified enzyme. The gene coding for aminopeptidase
PepC, called pepC, has been subcloned and sequenced. It codes for a protein of 435 amino acids. It appears that it does not have a signal sequence, which suggests an intracellular localization of the enzyme. Analysis of the amino acid sequence deduced from the nucleotide sequence of pepC shows significant homology with the active site of the proteases to cysteine, and in particular a conservation of the amino acids involved in the catalytic site.

 The subject of the present invention is a nucleic acid fragment, characterized in that it comprises a sequence coding for the aminopeptidase PepC of Lactococcus lactis, or for a fragment thereof.

 The sequence of a nucleic acid fragment in accordance with the invention is represented in the list of sequences in the appendix under the n SEQ. ID. N 1. The sequence coding for the aminopeptidase PepC (reading frame ORF1) corresponds to bases 718 to 2025 of said sequence. The polypeptide sequence of the aminopeptidase PepC deduced from the ORF1 reading frame is also shown.

 It should be understood that the invention also encompasses all DNA fragments whose sequence is derived from the sequence SEQ. ID. N 1, and in particular nucleic acid fragments of more than 10 bp which hybridize specifically with said sequence, or with its complement, as well as all the sequences which, due to the degeneration of the genetic code, code for the aminopeptidase PepC from Lactococcus lactis or from a neighboring lactococcus species, as well as for its isoforms or allelic variants, or for a fragment of these proteins. Such sequences can, for example, be obtained from the sequence SEQ. ID. N 1 by site-directed mutagenesis.

The invention also relates to recombinant vectors (plasmids, viruses, etc.) characterized in that they comprise at least one DNA segment as defined above, coding for the aminopeptidase
PepC from Lactococcus lactis, or a fragment thereof.

A recombinant vector conforming to the invention was deposited on August 12, 1992, under the deposit number I-1258, with the National Collection of
Cultures of Microorganisms (CNCM), held by INSTITUT PASTEUR, 25, rue du Docteur Roux, 75724 PARIS
CEDEX 15.

 According to a preferred embodiment of the present invention, said vectors are expression vectors, comprising sequences suitable for controlling the expression of the pepC gene (promoter, terminator, etc.).

 The present invention also relates to transformed eukaryotic or prokaryotic cells (and in particular microorganisms), characterized in that they contain at least one nucleic acid fragment as defined above, and in particular the cells comprising at minus one copy of the gene coding for the aminopeptidase PepC. This gene can be carried by a recombinant vector in accordance with the invention, or else integrated into the chromosomal DNA of the host cell.

The subject of the invention is also a polypeptide of 435 amino acids whose sequence is that of the aminopeptidase PepC from Lactococcus lactis, and more particularly that of the aminopeptidase PepC from
Lactococcus lactis subsp. cremoris AM2, coded by the reading frame of the nucleotide sequence represented in the list of sequences, under the number SEQ. ID. N 1.

The invention encompasses, of course, the polypeptides whose sequence differs from the sequence mentioned above only by a few amino acids, in particular polypeptides representing allelic variants or isoforms of the aminopeptidase PepC of
Lactococcus lactis.

The invention also includes any peptide fragment whose sequence represents more than 5 consecutive amino acids of that of the aminopeptidase PepC of
Lactococcus lactis; such a fragment is advantageously a polypeptide carrying an epitope specific for said aminopeptidase
The invention also includes preparations of aminopeptidase PepC obtained by genetic engineering, as well as more generally, preparations of recombinant proteins comprising all or part of the sequence of the aminopeptidase PepC, optionally fused with another peptide sequence.

 The invention also relates to a process for producing the aminopeptidase PepC from Lactococcus lactis, or a recombinant protein as defined above, which process is characterized in that it comprises a step during which proceeds to culture transformed cells as defined above, comprising at least one DNA fragment in accordance with the invention.

 The transformed cells, as well as the PepC aminopeptidase preparations obtained by genetic engineering in accordance with the invention, can be used in the food industry for the manufacture of food, in particular cheese.

The present invention will be better understood with the aid of the additional description which follows, which refers to the cloning and expression of the pepC gene of
Lactococcus lactis, cloned from Lactococcus lactis ssp creinoris AM2. It goes without saying, however, that these examples are given solely by way of illustration of the subject of the invention, of which they in no way constitute a limitation.

EXAMPLE 1: CLONING OF THE AMINOPEPTIDASE PepC GENE
The aminopeptidase gene of L. lactis subsp. cremoris AM2 was cloned by complementation of the E. coli 1047 pepN mutation.

l) Bacterial strains, plasmids, and culture media
L. lactis subsp. cremoris AM2 was obtained from the Center's culture collection
Research by JOUY-EN-JOSAS. The E. coli 1047 strain (met, supE, supF, hsdS, recA, pepN) is that described by LATIL et al. [Molec. Gen. Broom. 148: 43-47 (1976)]; this mutant is unable to hydrolyze Leu-ssNA.

 L. lactis subsp. cremoris was cultivated, at 30oC, on M17 medium [TERZAGHI et al. Appl. Microbiol.

Rev. 46: 245-268 (1975)], in which lactose has been replaced by glucose. E. coli was cultivated on LURIA-BERTANI medium [MANIATIS et al., Molecular
Cloning: A Laboratory Manual. Cold spring harbor
Laboratory, Cold Spring Harbor, (1982)], at 37 C.

Ampicillin (Ap) was added, when necessary, to a final concentration of 50 Rg / ml in the culture medium. The plasmid pBluescript was obtained from
STRATAGENE (La Jolla, Calif.).

2) Molecular cloning
A total DNA library of L. lactis subsp.

cremoris AM2 was built in the mutant strain of
E. coli 1047, using the plasmid pBluescript.

 The Lactococcus lactis DNA was prepared according to the protocol described by LOUREIRO DOS SANTOS, and A.

CHOPIN [FEMS Microbiol. Lett. 42: 209-212 (1982)]. Restriction endonucleases and T4 ligase were obtained from BOEHRINGER MANNKEIM BIOCHEMICALS, and used according to the manufacturer's instructions. DNA manipulation, E. coli cell transformation, and cloning protocols are those described by
MANIATIS et al. (reference cited above).

The total DNA of the AM2 strain was partially digested with the Sau3A endonuclease so as to obtain fragments of average size 5 kb. These fragments were ligated into the pBluescript plasmid previously digested with the BamHI endonuclease and dephosphorylated. The ligation product was used to transform competent E. coli 1047 cells. The transformed ampicillin-resistant cells were selected by carrying out an assay for aminopeptidase activity by enzymatic plaque assay, under the following conditions
- The search for aminopeptidase activity was made using Leu-Bnaphthylamide (Leu-ssNA) (Sigma) as a substrate. 0.2 ml of L-Leu-ssNA solution (10 mg / ml in methanol) was mixed with 5 ml of phosphate buffer (pH 7) and 1 ml of Fast Garnet GBC (SIGMA, St. Louis) (10 mg / ml in water). The mixture is poured onto culture dishes carrying the transformed bacteria. After a few minutes of incubation at room temperature, the positive clones appear colored red.

 Screening the library by this method made it possible to obtain two positive clones from 3000 ampicillin-resistant transformants.

The two clones obtained were then characterized by immunoblotting, according to the following procedure
A lysate of each of the 2 selected clones was prepared as follows
The bacteria are grown overnight in LB medium containing ampicillin at 50 Fg / ml. One ml aliquots of culture are removed and centrifuged and the bacterial pellet is washed once in 1 ml of 200 mM Tri-HCl buffer pH 8, and resuspended in 25 l of H2O. The same volume of denaturation buffer (Tris 62.5 mM, 2.5% SDS, 5% ss-mercaptoethanol, 10% glycerol, 0.01% bromophenol blue) concentrated twice was added and the samples are heated at 100 ° C for 5 minutes. 10 l of the mixture are deposited on a polyacrylamide gel and electrophoresis is carried out in the presence of SDS.

After electrophoresis, the proteins are transferred to nitrocellulose membranes using a TRANS BLOT cell (Biorad), for 1 hour at 100 volts in 25 mM Tris-HCL buffer, 192 mM glycine pH 8.3 and 20% methanol. . The saturation of the nitrocellulose and the subsequent incubations and washes are carried out in a 10 mM phosphate buffer pH 7.4, 150 mM NaCl, 1% of skimmed milk powder and 0.05% of
Tween X100. Anti-PepC (1/500), anti-PepN (1/1000) rabbit sera, as well as anti-rabbit goat antibodies coupled with peroxidase (dilution 1/1000) (INSTITUT PASTEUR) were successively brought to incubate with the nitrocellulose membrane for 1 hour at room temperature. 4-chloro-1-naphthol was used as the substrate for peroxidase.

 The results are illustrated in Figure 1.

In FIG. 1A, the revelation is made using anti-PepC antibodies, FIG. 1B corresponds to the revelation using anti-PepN antibodies. In both cases, lane 1 represents a protein extract of the E. coli pepN mutant, lane 2, the positive clone n 1, lane 3, the positive clone n 2, lane 4, a cytoplasmic extract of L. lactis subsp. cremoris AM2.

 The anti-PepC and anti-PepN antibodies recognize respectively the 50 kDa monomer of the aminopeptidase PepC, and the aminopeptidase PepN in the total cytoplasmic extract of AM2 (lane 4). No protein band is detected by the anti-PepC antibody in the lysate of the E. coli pepN mutant (1A lane 1), whereas the 55 kDa band which appears when the same lysate is revealed by the anti -PepN (Figure 1B track 1) appears not to be specific.

 The antibodies directed against PepC recognize a 50 kDa protein in the cell lysate of clone 1 (FIG. 1A, lane 2) this band corresponds well to the molecular weight of the PepC monomer revealed in the cytosolic extract of AM2 (FIG. 1A, lane 4 ). No band is however detected when the lysate of clone 2 is revealed by the anti-PepC antibody (FIG. 1A, lane 3). On the other hand, the use of anti-PepN antibodies shows that clone 2 expresses the PepN aminopeptidase (FIG. 1B, lane 3).

The recombinant plasmid obtained from clone 1 was designated pTIL4. This plasmid carries a 15 kb DNA insert. From this plasmid, a fragment
2.7 kb PvuII carrying the PepC aminopeptidase gene was subcloned. The plasmid carrying this fragment was designated pTIL24, this plasmid was deposited in the Collection
Nationale de Cultures de Microorganismes (CNCM) run by INSTITUT PASTEUR, 25, rue du Docteur ROUX, 75724
PARIS CEDEX 15, dated August 12, 1992 under deposit number I-1258.

 The nucleotide sequence of the 2664 bp DNA insert of the plasmid pTIL24 was determined by two different techniques: on the one hand on single-stranded DNA [NARDI et al., Appl. About. Microbiol., 57, 45-50, (1991)], and on the other hand on double stranded DNA, using the PROMEGA CYCLE sequencing kit, following the protocol recommended by the manufacturer.

 This sequence is represented on the list of sequences in the appendix under the number SEQ ID NO 1: it contains a first reading frame (ORF1) of 436 codons, and the C-terminal part of another open reading frame (ORF2) , with the same orientation.

The length of ORF1 corresponds to that of a reading frame coding for a protein of 50 kDa. A potential ribosome binding site (RBS) complementary to the 3 'end of the 16S ribosomal RNA of
L. lactis subsp. lactis, was found 4 bp upstream of the initiation codon AUG. Regions comprising the consensus sequences of the lactococcus promoters -10 and -35 were located at positions 581 and 614 of the nucleotide sequence. A potential transcription terminator has been identified, 14 bp downstream of the stop codon of ORF1.

In order to verify that ORF1 coded well for the aminopeptidase PepC, the amino acid sequence
N-terminal purified PepC aminopeptidase was determined. This sequence: Thr-Val-Thr-Ser-Asp-Phe-Thr Gln-Lys-Leu-Tyr-Glu-Asn-Phe-Ala-, agrees with that which is deduced from codons 2 to 16 of the reading frame ORF1.

This confirms that the PepC aminopeptidase is encoded by
ORF1 and demonstrates that the protein undergoes cleavage of the N-terminal methionine. On the other hand, no hydrophobic sequence corresponding to a possible signal peptide has been located.

EXAMPLE 2 OVEREXPRESSION OF THE AMINOPEPTIDASE GENE
PepC CLONE IN A MULTICOPIC VECTOR
The cloned 2.7 kb DNA fragment which carries the pepC gene and its own expression signals was cloned into the XhoI site of the multicopy vector pIL253. This vector is present in a copy number of 50 to 60 per bacterium [SIMON and CHOPIN, Biochemistry, 70, 559-566 (1988)]
The recombinant plasmid was introduced by electroporation into the SL5117 strain of L. lactis subsp.

lactis. This strain was obtained by mutagenesis with nitrosoguanidine of the strain MQ422 [KIWAKI et al. MOL.

MICROBIOL. 3, 359-369, (1989)], which is itself derived from the strain NCDO763 after cleaning its plasmids. The SL5117 strain is partially devoid of aminopeptidase activity and the immunoblotting experiments show that it no longer expresses the enzyme PepN while the expression of PepC is not affected.

The clones transformed by the plasmid pIL253 were selected for their resistance to erythromycin. The activity assays carried out with the Met-pNA substrate on one of the clones selected after lysis of the bacteria reveal a PepC activity 25 times higher in the transformed strain than in the strain
SL5117 without plasmid.

LIST OF SEQUENCES: SEQ. ID. N01 CAGCTGAACAACTGGTAATTGATTATTCAGAGAAAAGTGTGATAGTTCAAAAAGAAAAATTAATTGCAAAAAATACTGACGAAAATTTGAAGCTAATTTTTACTGATGGAGTGCAACAAA 120
AEQLVIDISEKSVIVQKEKLI AKNTDNNLKLIFTDGVQQ
ORF #
AAGAGATTAACCAGTTTATCAGTAAGAGTCAAGCTTTTGTTGCTGGACTTATGCATGATATTGGTGGGGTTTATCCAAATCATCAGCGAGTAGAAAAAGCAGAATTATTTGGTATAGAAT 240
KEINQFISKSQAFVAGLNHDI GGVIPNEQRVEKALEFGIE
TACTGACAGAAGAGCGTGAATTTCCTTTGATTATTCATCAAAAACTTTCTAAATATCTGGCGCGTGAGCATTTTAAAATTACTGACGAAAATATATTGTCAGCGATTGAGTGCCACACAA 480
TLKENFTELDLIVFLADKISW DGGDNAPFKEGLLTALSVN
TGCAAAGTGCAGCACTTTATTATATAGACTTCATCATCAATGATGGCTTGAAAGTTGCGCACCCGTGGCTTTTAGAAGCAAAGAAAGATTTAGAAAATCAGCTTTCCTAGCTGATTTTTT 600
LQSAALYYIDFIINDGLKVAH PWLLEAKKDLENQLS *
-35
TGATAATTTAGATTATAATAGAAGAATGTAAAAATAATAGAATATCATTAATCAAAATCGATAATGATTATTTTTATCGAAACTTTTGTCAGAAGTTTCGATTTATTGGGAGGTATTATG 720
RES M 1
-10 ORF1 #
ACAGTAACATCAGATTTCACACAAAAACTCTACGAAAATTTTGCTGAAAACACAAAATTGCGTGCGGTGGAAAATGCCGTGACTAAAAATGGTTTGCTTTCATCACTCGAAGTGCGTGGT 840
TVTSDFTQELTENFAENTKLR AVENAVTENGLLSSLSVRG 41
TCACATGCAGCGAATTTGCCTGAGTTTTCACTTGACTTGACAAAAGACCCTGTAACGAATCAAAAACAATCTGGACGTTGCTGGATGTTTGCTGCTTTGAACACTTTCCGTCATAAATTT 960
SHAANLPEFSLDLTKDPVTNQ KQSGRCWMFAALNTFRHKF 81
ATTAATGAATTTAAAACAGAAGATTTTGAATTTTCACAAGCTTATACTTTCTTCTGGGATAAATATGAAAAATCAAACTGGTTTATGGAACAAATTATAGGAGTAGTTGCGATGGACGAC 1080
INETKTEDZETSQAZTFFWDK ZEKSNWFMEQIIGDVAMDD 121
CGTCGTTTGAAATTCCTCTTGCAAACTCCACAACAAGATGGTGGTCAATGGGATATGATGGTAGCCATTTTTGACAAATATGGAATTGTTCCAAAAGCTGTTTATCCTGAATCACAAGCT 1200
RRLKFLLQTPQQDGGQWDMMV AIFDKZGIVPKAVZPESQA 161
TCAAGTAGCTCACGCGAATTGAATCAATACTTGAACAAATTGCTCCGACAAGATGCTGAAATCTTACGTTATACAATTGAGCAAGACGGTGATGTTCAAGCGGTCAAAGAAGAACTTTTA 1320
SSSSRELNQILNKLLRQDAEI LRYTIEQDGDVQAVKEELL 201
CAAGAAGTTTTTAATTTCCTTGCTGTAACTCTAGGTTTGCCACCACAAAATTTTGAATTTGCTTTCCGCAACAAAGATAATGAATACAAAAAATTTGTTGGAACGCCAAAAGAATTCTAC 1440
QEVFNFLAVTLGLPPQNFEFA FRNKDNEYKKFVGTPKEFY 241
AACGAATATGTTGGGATTGATTTGAACAATTATGTTTCGGTCATTAATGCTCCAACTGCTGATAAACCTATAAACAAAAGCTATACCGTTGAATTTCTTGGTAATGTAGTCGGTGGTAAA 1560
NEYVGIDLNNYVSVINAPTAD KPYNKSYTVEFLGNVVGGK 281
GAAGTCAAACACTTGAACGTTGAGATGGACCGTTTCAAAAAATTGGCTATTGCCCAAATGCGGGCGAAACTGTCTGTTTGGGTGACGTTGGTCAAGAATCAAGAATCAAACCGTTCAGCA 1680
EVKHLNVEMDRFKKLAIAQMQ AGETVWFGCDVGQESNRSA 321
GGACTTTTGACAATGGATTCTTATGATTTTAAATCTTCATTGGATATTGAATTCACACAAAGTAAGGCTGGACGTCTTGACTATGGCGAATCACTGATGACTCATGCCATGGTTTTAGCG 1800
GLLTMDSZDFKSSLDIEFTQS KAGRLDYGESLNTHAMVLA 361 GGTGTTGATTTAGATGCTGACGGAAATTCAACTAAATGGAAAGTTGAAAATTCTTGGGGTAAAGATGCCGGTCAAAAAGGATATTTCGTTGCTTCTGATGAATGGATGATGA
GVDLDADGNSTKWKVENSWGK DAGQKGYFVASDEWMDEYT 401
TATCAAATTGTTGTCCGCAAAGACCTTTAAGCGAAGAAGAATTAGCTGCTTATGAAGCAAAACCTCAAGTTCTGCTTCCAATGGGATCCAATGGGAGCCTTGGCTTAATTTGTAAATTGA 2040
YQIVVRKDLLSEEELAAYEAK PQVLLPWDPMGALA * 436
AACATTTAACTTTTGTTAAATGTTTTTTTATTGACTTAAAGTTCACTTCAAGTGTTAAAATAAAAGAATGAATATAAAAAAGGCCGCCGACTTATCAGGGATAAAAACAGATAATATCAG 2160
ATATTATGAAAGAATTGGGCTAATTCCTAAAATTGCACGGACAGAGTCTGGAATACGAAATTTTTCAGAAGCGAATATTAGAACATTAAAATTCGTCAAACATATGAGAGATGCAGGAGT 2280
GCAAGTAGAACCCTTGACACGTTATATGGTATTGGTAACTGAAGGAAATCCTAATACTAAAGAATAAAGAATTGAAATTCTGAAGAGTCAAGTTGAACAATTGAGAACAGAAATTATTGA 2400
AAAACAATCTGCTTTAGATTATTTAACATTCAAAATTGAAAATTATGATGAAGTCATGCTTCCAAGCGAAATGAATTTGAATCAAAGTTCAACAGAAACAATAAAAATTTGAAGAGGATA 2520
AGGATAAATGGAACTTCGATTATTAAAGTATTTTTGGACAGTTGCCACTGCTGGGACGGTATCCAAAGCTGCTGACAGTTATATATTACACAGCCAACATTATCTAGACAAATTAAAGAA 2640
CTTGAACGAGAATTAGATACTCAGCTTTTTATGCGTATGGGAAAAAGCTTATCTTGACTGAAGATGGTCAATTCTTAAAATCAAAGCTGAAGAGATTTTACAGCTG 2748
LIST OF SEQUENCES: SEQ. ID. N01 (Continued)

Claims (14)

 1) Nucleic acid fragment, characterized in that it comprises a sequence coding for the PepC aminopeptidase from Lactococcus lactis, or for a fragment thereof.  2) Nucleic acid fragment according to Claim 1, characterized in that it comprises a sequence represented in the list of sequences in the annex under the n SEQ. ID N 1, or a fragment thereof.  3) Nucleic acid fragment of more than 10 bp, characterized in that it specifically hybridizes with a sequence according to any one of Claims 1 or 2, or with its complement.  4) Recombinant vector characterized in that it comprises at least one nucleic acid fragment according to any one of Claims 1 to 3.  5) Recombinant vector according to Claim 4, characterized in that it consists of the plasmid pTIL24 deposited on August 12, 1992, under the number I-1258, with the C.N.C.M ..  6) Recombinant vector according to Claim 4, characterized in that it further comprises sequences suitable for controlling the expression of the gene for the aminopeptidase PepC from Lactococcus lactis.  7) Transformed eukaryotic or prokaryotic cells, characterized in that they contain at least one nucleic acid fragment according to any one of Claims 1 to 3.  8) Polypeptide characterized in that it comprises 435 amino acids, and in that its sequence is that of the aminopeptidase PepC from Lactococcus lactis.  9) Polypeptide according to Claim 8, characterized in that its sequence is that of the aminopeptidase PepC from Lactococcus lactis subsp. ORF1 of the sequence represented in the list of sequences, under the number SEQ. ID. Do 1.  cremoris AM2, as encoded by the reading frame  10) Peptide fragment characterized in that it represents more than 5 consecutive amino acids of the sequence of the aminopeptidase PepC according to any one of Claims 8 or 9.  11) Recombinant protein, characterized in that it comprises all or part of the sequence of the PepC aminopeptidase according to any one of Claim 8 or 9, possibly fused with another polypeptide sequence.  12) Method for producing a recombinant protein according to Claim 11, which method is characterized in that it comprises a step during which the cultivation of transformed cells according to Claim 7 is carried out.  13) Use of a transformed cell according to Claim 7 for the manufacture of food.  14) Use of a recombinant protein according to Claim 11 for the manufacture of food.