RU2469093C2 - EXPRESSION PLASMID DNA pCID-PROC CODING HUMAN PROTEIN C AND CELL LINE DG-CID-PROC-1 PRODUCING RECOMBINANT HUMAN PROTEIN C - Google Patents

Abstract

FIELD: medicine.

SUBSTANCE: invention refers to biotechnology, namely plasmid DNA pCID-PROC for expression of recombinant human protein C, cell lines of Chinese hamster ovary DG-CID-PROC-1 and a method for producing recombinant human protein C. The presented invention may be used for producing recombinant human protein C. Plasmid DNA pCID-PROC for expression of recombinant human protein C contains a sequence of full-length complementary DNA of a human protein C gene presented in List of Sequences as the sequence SEQ ID NO: 1. Plasmid DNA pCID-PROC is characterised by a physical map presented on dwg. 1. A cell line of Chinese hamster ovary DG-CID-PROC-1 is produced by transformation of the cell line of Chinese hamster ovary DG-44 by said expression plasmid DNA pCID-PROC. The method for producing recombinant human protein C involves culture of said cell line DG-CID-PROC-1 in a nutrient medium and recovery of produced target protein from a culture fluid.

EFFECT: invention provides higher production performance of the protein C expression system and simplified recovery, activation and purification of recombinant activated human protein C.

3 cl, 3 dwg, 2 ex

Description

The invention relates to the field of biotechnology, and in particular to a technology for the production of biologically active substances (BAS) by genetic engineering methods, more specifically to methods for producing activated and intact (zymogenic) human protein C.

Protein C is a vitamin K-dependent plasma protein. It enters the hemostatic system and plays an extremely important role in the regulation of blood coagulation. Protein C is synthesized as an inactive precursor molecule, undergoes multi-stage post-translational processing in cell compartments and is secreted in the form of an intact (zymogenic) form. Activation of protein C occurs in the bloodstream with the participation of the thrombomodulin-thrombin complex. Activated protein C, together with cofactor - protein S, performs an anticoagulant function. Activated protein C can prevent intravascular thrombosis and inhibit the growth of existing blood clots. The mechanism of action of activated protein C and the mechanism of activation of zymogen into an active protease are described in detail in (Gardiner IE, Griffin IH, Progress in Hematology, vol XIII. Pp. 265-278, ed. Elmer B. Brown. Grime and Strattom Inc., 1983, )

The activation of protein C is directly carried out by thrombin, the last serine protease of the blood coagulation cascade, and is mediated by the thrombomodulin glycoprotein associated with the membrane of endothelial cells. Thrombomodulin forms a strong non-covalent complex of 1: 1 composition with thrombin and completely changes the functional properties of thrombin. Under normal conditions, free thrombin activates platelets, converts fibrinogen to fibrin and coagulation factors V and VIII to active forms Va and VIIIa. At the same time, thrombin in combination with thrombomodulin loses all of the above properties, but effectively activates intact protein C at physiological concentrations of calcium ions.

Activated protein C, in turn, selectively inactivates the activated forms of coagulation factors V and VIII, but not their original forms. It should be noted that the main events at the start of the blood coagulation cascade occur on the cell surface and require the participation of membrane-bound proteins and phospholipids, while factors V and VIII circulate freely in the bloodstream and participate in the positive feedback loop during the operation of the coagulation system. When activated by thrombin, they accelerate the activation of factor X and prothrombin by 5 orders of magnitude and dramatically accelerate the generation of thrombin at the site of the coagulation cascade.

Thus, the physiological role of activated protein C can be described as limiting the start area of the blood coagulation system.

The main cofactor of activated protein C is protein S, another vitamin K-dependent plasma protein. Protein S more than 10 times enhances the degradation of factors Va and VIIIa caused by activated protein C.

Protein C is an important therapeutic agent (EP 215549, EP 0191606) as a specific anticoagulant having a potentially wider scope than traditional anticoagulants heparin, warfarin (oxycoumarin) or derivatives of the latter. Unlike traditional anticoagulants, activated or intact protein C does not affect the blood coagulation system until the appearance of thrombin and does not cause a decrease in the concentration of zymogenic proteins of the coagulation system. Consequently, anticoagulant therapy with protein C is potentially safer because it does not cause a constant risk of bleeding. Exogenous intact protein C can also be used for replacement therapy with hereditary protein C deficiency, which causes death in infancy with homozygous deficiency and frequent thromboembolic conditions with a heterozygous form of deficiency.

The main area of clinical use of activated protein C is life-threatening thrombotic conditions, primarily disseminated intravascular coagulation syndrome (DIC), which occurs, including during the development of acute sepsis.

Activated protein C is a marker of sepsis, and its level and deficiency correlate with the severity of the disease. Thus, protein C deficiency is observed in more than 85% of patients with severe sepsis; and protein C deficiency correlates with adverse clinical outcomes, such as septic shock (severe sepsis, accompanied by the development of arterial hypotension), DIC, and multiple organ failure.

Since the concentration of protein C in the blood plasma is very low and its separation from other vitamin K-dependent proteins of the hemostatic system is very difficult, the only way to obtain activated protein C for medical use is the biosynthesis, activation and purification of the recombinant protein. The presence of the so-called Gla domain in protein C, i.e., a cluster of closely located gamma-carboxylated glutamic acid residues, is necessary for the normal functioning of the protein. The post-translational conversion of glutamine residues to gamma-carboxylated glutamic acid residues is possible only in mammalian cells and is mediated by a complex enzyme system that uses vitamin K as a cofactor. Thus, only cultured mammalian cells can be the only reliable source of recombinant protein C.

A genetic vector containing complete human protein C cDNA was obtained by screening a phage cDNA library and is described in US patents US4968626 and US 5302529.

The basic method for expression of a protein C minigene in mammalian cells is described in US Pat. No. 4,959,318. It consists of constructing a plasmid containing the SV40 virus promoter, a target gene and a dihydrofolate reductase gene (DHFR), cotransfection of this plasmid and an auxiliary plasmid containing the neomycin antibiotic resistance gene, into mammalian cells of the COS, BHK, A293 lines, obtaining colonies of stably transfected cells and their growth on a selection medium containing methotrexate. When using this method, the level of secretion of protein C in the culture medium remained very low and amounted to about 0.05 mg / L. In addition, the degree of conversion of intact protein C into an unstable activated form was quite significant and reached 90% when using the 293 cell line.

Various methods have been used to increase the level of protein C secretion. US Pat. No. 5,618,714 discloses a 56-215% increase in protein C secretion with an increase in cell cultivation temperature from 37 ° C to 39 ° C. This method has limited practical suitability, since an increase in the cultivation temperature can lead to a decrease in cell viability and contamination of the secreted protein C with cell breakdown products.

Another way to increase productivity is to use expression systems based on the introduction of multiple copies of protein C into the genome of cultured cells. This approach was described in US Pat. No. 5,516,650: for co-transfection of BHK cells with plasmids pSV2-DHFR and pDX / PC962 containing the gene DHFR and the artificial protein C gene, respectively, and subsequent cultivation in the presence of methotrexate, clones of producer cells were secreted that secreted Protein C into the culture medium at a level of from 0.55 to 2.5 mg / L.

The closest in technical essence analogue of the present invention is the plasmid pL141, transfected into cells of the CHO-K1 (dhfr ^- ) line, described in US patent US 4775624. Using this system allows to achieve the level of secretion of the target protein in 1.8 mg / l culture, but requires the use of fetal serum as part of the culture medium, which leads to a very high contamination of the target protein with extraneous polypeptides, primarily bovine serum albumin. In addition, the level of protein C secretion remained quite low, which may be due to the lack of complete linkage of the signs of resistance to methotrexate and protein C secretion caused by the use of a vector with separate promoters for the target gene and DHFR gene.

The technical problem solved by the authors was to create a technology for producing activated and intact protein C with a higher yield.

The technical result was achieved by creating a new expression plasmid DNA pCID-PROC encoding an intact human protein C and creating a producer line based on it.

The basis of this technology is the 6174 bp plasmid DNA pCID-PROC developed by the authors, which contains the sequence encoding human protein C. It consists of a 1792 bp DNA fragment containing the sequence of the full-length cDNA of the human protein C gene, and a 4382 bp fragment. plasmids pCID containing

- regulatory elements that provide expression of protein C: constitutive promoter of the CMV virus, Kozak sequence (ribosome binding site) and herpes simplex virus (HSV) polyadenylation signal;

- the sequence of the resistance factor of transfected cells to the effects of methotrexate - dihydrofolate reductase (DHFR) and regulatory elements for the expression of DHFR - the IRES sequence of encephalomyocarditis virus. (EMCV) providing bicistronic expression in animal cells and a polyadenylation signal;

- the antibiotic resistance gene ampicillin and the bacterial promoter of the ampicillin resistance gene, allowing for the preparative production of plasmids in E. coli.

Plasmid pCID-PROC contains unique recognition sites for restriction endonucleases - PvuI (5640) SpeI (54) Hind III (2772).

Has a molecular weight of 3.82 mDa.

The plasmid was introduced into DG-44 cells by liposomal transfection (Straus S.E. et al. J Virol. 1981 Jul: 390): 290-4), a pool of stably transfected cells was obtained by culturing in a medium containing no hypoxanthine and thymidine. Amplification of the cassette in the cell genome was carried out by successive cultivation in the presence of increasing concentrations of methotrexate. A pool of cells resistant to a high concentration of methotrexate was obtained and used for cloning by limiting dilution. The obtained clones of producer cells were analyzed by enzyme-linked immunosorbent assay and clones giving the maximum expression level of protein C were selected. Among them, the clone DG-CID-PROC-1 was selected. When cultured in suspension form in serum-free medium, the level of protein C secretion was not less than 4 mg / l.

Features of the design, cell lines and the results of the practical application of the invention are shown in the following figures.

Figure 1. The pCID-PROC schematic map, where the following conventions are used:

Pvul (5640) Spel (54) Hind 111 (2773) - unique recognition sites for restriction endonucleases;

Ampicillin (bla) resistance gene - ampicillin resistance gene;

bla promoter - bacterial promoter of the ampicillin resistance gene;

CMYPromoter - eukaryotic promoter of cytomegalovirus;

Kozak - ribosome binding site - Kozak sequence;

Start ATOprotein C - the first codon of the protein C reading frame;

PROC is the region encoding the open reading frame of protein C;

polyA is the region corresponding to the poly-A pathway of the PROC cDNA;

ECMU IRES - ribosome binding site - IRES sequence of encephalomyocarditis, providing bicistronic expression in animal cells;

DHFR - sequence of resistance factor of transfected cells to the effects of methotrexate - dihydrofolate reductase (DHFR);

TC polyA signal - polyadenylation signal.

Figure 2. The primary nucleotide sequence of the NotI-NotI fragment of the pCID-PROC plasmid containing human cDNA (1792 bp length)

Figure 3. Amino acid sequence of a polypeptide translated from plasmid pCID-PROC (length 461 amino acids; molecular weight 52078.06 Yes).

The cell line DG-CID-PROC-1 was deposited in the Specialized Collection of Vertebrate Cell Cultures of the Russian Cell Culture Collection at the Institute of Cytology of the Russian Academy of Sciences on March 16, 2010 under the number RKKK (P) 732D.

The following characteristics were recorded.

1. Name of organization where the line of cultured animal cells was obtained: Limited Liability Company "Innovation Center" New Technologies and Materials ""

2. The author or team of authors, the date of receipt of the strain: Kovnir SV., Orlova N.A., Vorobyev I.I .; 06/25/2009

3. Depositor address:

Legal: 115093, Moscow, ul. Bolshaya Serpukhovskaya 44, office 33.

Postal: Hematological Scientific Center RAMS, Moscow, 125167, New Zykovsky passage, 4a.

4. Registration number; copyright name of the strain:

PKKK (H) 732D; DG-CID-PROC-1.

5. Reasons for deposit: producer of recombinant protein; a strain promising for biotechnology.

6. The origin of the strain:

Parent cells: Chinese hamster, ovary, CHO line DG44 (Invitrogen cGMP banked, USA; Mol Cell Biol 5, 1750-1759 Kaufman RJ et al. 1985).

Transfection, cloning: stable transfection was performed in the Laboratory of Medical Biotechnology, State Scientific Center of RAMS,

Transfection Agent: Unfectine-56sp.

Transfected plasmid: pCID-PROC.

Selection system: dhff knockout / methotrexate

Cloning ratio: 2

7. The number of passages at the time of certification and deposit:

36 passages from transfection of the parent cell line CHO DG44

8. Standard growing conditions (nutrient composition, temperature, etc.):

Medium: serum-free, specific chemical composition, CD Opti CHO (Invitrogen, USA).

Temperature: + 37 ° C.

The concentration of CO ₂ : 8%.

Mixing speed: 120-130 rpm.

9. Cultural properties (cultivation method, sowing dose, sieving ratio, subculture time and other growth characteristics and strain features):

Cultivation method: suspension, in Erlenmeira flasks on an orbital rocking chair 130-135 rpm.

Sowing dose: 300,000 per 1 ml.

Sieving ratio: 1: 2-1: 6

Other growth characteristics and features of the strain:

Selective medium - serum-free, of a certain chemical composition, CD Opti CHO (Invitrogen, USA) with the addition of L-glutamine 8 mm + sodium methotrexate 500 nm.

Reseeding procedure: - centrifugation of the suspension at a speed of 1200 rpm, 5 min, resuspension in a new growth medium.

Optimum density: 1.0-1.2 × 10 ⁶ cells / ml.

10. Characterization of cultivation in the animal body:

not provided when using the cell line as a producer.

11. Species data:

Chinese hamster Cricetulus griseus, ovary.

Control of species identity: karyological, isoenzymatic (LDH and G6FDG).

12. Marker signs and methods for their assessment: immunological, cytogenetic, biochemical, physiological:

Morphology: epithelial-like.

Karyology: 2p = 22, the range of variation in the number of chromosomes is 10-28, the modal number of chromosomes is 22, pseudodiploid, there are microchromosomes, the number of polyploids is 9.0%.

Biochemistry: Dihydrofolate reductase activity by resistance to methotrexate.

13. Contamination control by bacteria, mycoplasmas, fungi and viruses: bacteria, fungi were not detected by direct culture on LB and Saburo-Emmons culture media; Mycoplasma by PCR and fluorescence analysis was not detected; viruses - no data.

14. Characterization of the beneficial substance produced by the strain (for immunoglobulins, an indication of the class, specificity and methods for its assessment):

recombinant protein - activated human protein C,

determination by ELISA, western blotting with chemiluminescent detection.

15. Characterization of the biosynthesis of useful products, the yield of the product on Wednesday, the level of activity and the determination method indicating the preservation of useful properties during prolonged cultivation:

The content of activated protein C in the culture medium (with daily cultivation of a cell suspension with a density of 1 million cells / ml) is at least 4 mg / l, the level is constant for 12 consecutive passages.

16. The method of cryopreservation (medium, cryoprotectant, freeze and heat mode, conditions of long-term storage, viability after cryopreservation, indicating methods for its assessment)

Medium: serum-free, chemically defined, CD

Opti CHO (Invitrogen, USA).

Cryoprotectant: 10% DMSO.

Freezing and warming mode: freezing a cell suspension in a medium with the addition of a cryopreservative, the temperature drop rate of not more than 1 ° C / min (coolant isopentanol); defrosting fast, in a water bath at 37 ° C.

Long-term storage conditions: 10 cells / ml in an ampoule in liquid nitrogen. Vitality after cryopreservation: 81% (stained with trepan blue).

17. Other features of the strain (oncogenicity, the presence of viruses, etc.)

Oncogenicity: -

Sensitivity: vesicular stomatitis (Indiana), Geta arbovirus.

Resistance: poliovirus type 2, flavivirus Modoc MODV, arbovirus Baton Willow.

Amplified gene: dhfr.

A copy of the certificate of deposit is attached.

The practical applicability of the claimed invention is illustrated by the following examples.

Example 1. Obtaining a genetic construct pCID-PROC encoding human protein C for transfection of a cell line DG-44

Clone pCMY6-XL41NM_000312 (Origene proprietary collection) containing a fully sequenced sequence of the full-length cDNA of the PROC gene matching the theoretically determined cDNA of the human PROC gene according to HUGO data (deposited in the GeneBank public database was used as a cDNA source for cloning the protein C minigene) : //www.ncbl.nlin.nih.gov/sites/entrez NM_000312).

A 1792 bp DNA fragment containing the protein C gene was obtained from the purified plasmid pCMY6-XL41NM_000312, which was preparatively restricted with NotI restriction endonuclease. Restriction products were mixed with 1 μl of application buffer and separation was performed on a 1% agarose gel with the addition of ethidium bromide (0.4 μg / ml). To isolate DNA, the band corresponding to the amplification product visualized by ultraviolet (UV) was excised from the agarose gel, placed in a 1.5 ml tube and DNA was isolated using the Wizard SV Gel and PCR Clean-Up System reagent kit ( "Promega", USA) according to the protocol of the manufacturer.

The recipient plasmid pCID was obtained on the basis of the commercially available linearized plasmid DNA pOptivec-TOPO after incubation in deionized water for 30 minutes, followed by ligation with T4 phage DNA ligase (Fermentas, Lithuania), carried out in a standard buffer solution according to the method of the enzyme manufacturer. The obtained ligase mixture was used to transform E. coli cells of strain DH5ά, with the genotype F-φ80lacZΔM15 Δ (lacZYA-argF) U169 recA1 endA1 hsdR17 (r _k -, m _k +) phoA supE44 λ-thi-1 gyrA96 relA1. For this, 5 μl of the ligase mixture was added to 200 μl of frozen E. coli cells, incubated on ice for 30 minutes to sorb plasmid DNA, heated to 42 ° C for 60 seconds, and incubated on ice for 5 minutes. Then 800 μl of SOC nutrient broth (20 g / L tryptone, 5 g / L yeast extract, 0.5 g / L NaCl, 250 mM KCl, 10 mM MgCl ₂ ) was added and incubated at 37 ° C for 60 min. After incubation, the suspension was transferred to a Petri dish with solid agar medium 2xYT-agar (16 g / l tryptone, 10 g / l yeast extract, 10 g / l NaCl, 18 g / l agar) containing ampicillin at a concentration of 100 μg / ml, and placed in a thermostat for 18 hours at 37 ° C. Individual transformant clones were inoculated in 5 ml LB nutrient broth supplemented with ampicillin at a concentration of 50 μg / ml, increased for 18 hours at 37 ° C, and plasmid DNA was isolated using the Wizard Plus SV Minipreps reagent kit (Promega, USA) according to standard protocol of the manufacturer ..

The purified plasmid pCID was digested with NotI endonuclease, followed by dephosphorylation of the vector with alkaline phosphatase (Fermentas, Lithuania) according to the manufacturer's recommendations. Silk phosphatase was inactivated by heating to 85 ° C for 20 minutes. Restricted and dephosphorylated plasmid was treated with an equal volume of 1: 1 phenol-chloroform mixture and the aqueous phase was reprecipitated with 3 volumes of ethanol. It was centrifuged for 10 minutes at a speed of 13200 rpm at room temperature, the precipitate was washed with 70% alcohol, dissolved in water and used to set up a ligation reaction at a working concentration of 10 ^-2 μg / μl.

The ligation reaction of the purified fragment corresponding to the human PROC gene cDNA and the recipient plasmid was carried out using T4 phage DNA ligase and standard buffer solution (Fermentas, Lithuania). Ligation was carried out in a volume of 10 or 20 μl, with a molar ratio of vector and insert of 1:10, for 2-20 hours at room temperature. The E. coli strain DH5ά was transformed with the obtained ligase mixture, as described above, the suspension of transformed cells was transferred to a Petri dish with solid agar medium 2xYT-agar containing ampicillin at a concentration of 100 μg / ml, and placed in a thermostat for 18 hours at 37 ° C .

E. coli colonies were analyzed for the presence of the insertion in the correct orientation by polymerase chain reaction (PNR) of the clones using the CMVfor and PROC-AS primer oligonucleotides to the vector sequence (direct) and insert (reverse), since the NotI endonuclease recognition site is palindromic. Primary nucleotide sequences of CMVfor primers are 5'CGCAAATGGGCGGTAGGCGTG3 '; PROC-AS - 5'CCGTCGACGTGCTTGGACCA3 '.

The polymerase chain reaction (PCR) was performed on a Tertsik MS2 instrument (DIK-technology, Russia) in a volume of 12.5 μl. An incubation PCR mixture of the following composition was prepared: 1x buffer for thermostable DNA polymerase; 10 pM of each primer oligonucleotide; 2 mM each deoxyribonucleotide triphosphate; 1-2 units thermostable DNA polymerase with 0.1-0.2 μg of DNA.

Bacterial colonies were looped into test tubes and, at the same time, strokes were made on a fresh, labeled Petri dish with 2xYT-agar solid nutrient medium with the addition of a selective antibiotic, which was then placed in an air thermostat for 5-7 hours at 37 ° C.

50 μl of light mineral oil was layered over the PCR mixture and amplified according to the scheme: 1 cycle - denaturation - 94 ° C, 3 min; 25 cycles - denaturation 94 ° С, 30 sec, annealing Х ° С 30 sec, completion 72 ° С, 45-60 sec; 1 cycle - completion 72 ° C, 7 min, where the calculation of the annealing temperature (X) was carried out according to the formula: X = 2 ° C × n (A / T) + 4 ° C × n (G / C) - 5 ° C, where n is the number of corresponding nucleotides. PCR products were mixed with 1 μl of application buffer and separation was performed on a 1% agarose gel with the addition of ethidium bromide (0.4 μg / ml).

Selected clones containing the insert in the correct orientation were grown for 18 hours in 5 ml LB nutrient broth supplemented with ampicillin at a concentration of 50 μg / ml and plasmid DNA was isolated using the Wizard Plus SV Minipreps reagent kit (Promega, USA) according to standard manufacturer's protocol. The resulting plasmids were analyzed by NotI endonuclease restriction and clones bearing 1 copy of the insert were selected.

3 plasmid clones selected in this way were further examined by PCR DNA sequencing in the insertion region using standard and specific primers CMVfor, PROC-AS, 1RESrev; PROC_DS1; PROC_DS2; PROC_DS3; PROC_DS4; PROC_C01; PROC_C02; PROC_C03; PROC_C04; primary nucleotide sequences of primers:

CMVfor - 5'ССОААТОООСОООТАООСОСО3 ';

PROC-AS - 5'SSOTSOASOTOSTSTOOOOSSA3 ';

1RESrev - 5'CGAAGCCGCTTGGAATAAGG3 '

PROC_DS1 - 5'CCCTACAGGTGCCAGTGCC3 ';

PROC_DS2 - 5'TGGGAGGGCCGCTTCTG3 ';

PROC_DS3 - 5'TGCATGGATGAGTCCAAGAAGC3 ';

PROC_DS4 - 5'ATCCTCGGGGACCGGC3 ';

PROC_C01 - 5'GGCCTCCTCGAAGTCACAGATC3 ';

PROC_C02 - 5'CCGCGGATCTACTTGGTCTTC3 ';

PROC_C03 - 5'CACGAGGGTCTCCTGGCC3 ';

PROC_C04 - 5'AAGCCCAGCCCTGCAGG3 ').

For further work, we used the plasmid pCID-PROC, 6174 bp in length, not containing mutations, for which there were complete sequencing data. By PCR sequencing using the above primer oligonucleotides, the nucleotide sequence of both complementary DNA chains was determined for the pCID-PROC construct for the cDNA insertion region of the PROC gene. Two-strand primary nucleotide sequence determination data obtained from an automatic capillary electrophoresis device were exported to the ContigExpress application of the VectorNTI Suite software package (Invitrogen, USA). Using the standard algorithm, trimming of the 5'-terminal and / or 3'-terminal regions of the fragments was performed, after which the contig was assembled using standard settings. A ponucleotide comparison of the obtained consensus sequence with the theoretically predicted one was performed. In addition to the coding region (ORS) of the PROC gene cDNA, the NotI restriction site regions were also sequenced, along which the cDNA fragment was cloned, as well as the most significant regulatory elements of the expression vector (promoter, 1RES), and the data obtained were analyzed by a similar algorithm. As a result of sequencing, it was found that the obtained plasmid preparation does not contain mutations in the insertion region and encodes the cDNA of the PROC gene. The created genetic construct was used to obtain a producer line.

PCID-PROC plasmid DNA was amplified in bacterial cells in preparative amounts, isolated by alkaline bacterial lysis and three-step chromatographic purification (Sepharose 4B Fast Flow, PlasmidSelect Xtra, Source 15 Q, Amersham sorbents) according to the method of the sorbent manufacturer, part of the highly purified plasmid DNA pyrogen-free, additionally linearized by PvuI restriction and purified from restriction enzyme extraction with phenol-chloroform and precipitation with ethanol. The obtained plasmid forms for cell transfection were transferred to phosphate-saline solution using dialysis and sterilized with a 0.22 μm filter.

Example 2. Construction of eukaryotic protein C producers DG-CID-PROC-1 by transfection of hamster ovary cells of the DG-44 line with a cytomegalovirus vector using plasmid pCID-PROC

DG-44 Chinese hamster ovary cells knocked out by the dhfr gene and adapted for cultivation in serum-free medium were obtained from Invitrogen, Ltd. (USA). The transformation method described below refers to DG-44 cells as a host cell line, but the method is generally applicable to most cell lines, including other Chinese hamster ovary (CHO) cell lines, 293 human embryonic kidney cells, Syrian hamster kidney fibroblasts BHKs also suitable for expression of the pCID-PROC construct.

DG-44 cells obtained in 1 ml cryovials containing a frozen suspension of cells of approximately 10 ⁷ cells in CD DG-44 medium (Gibco) with 10% dimethyl sulfoxide (DMSO). The contents of the vessel are thawed at 37 ° C and added to 30 ml of complete medium DG-44. The complete medium consists of VP-44 (Cibco) with 8 mM L-glutamine and 1.8 ml / L Pluronic F-68 surfactant (BASF Inc.) and contains sufficient amounts of hypoxanthine and thymidine for the growth of DHFR negative cells. Cells are cultured in Erlenmeyer flasks on an orbital shaker at 130 rpm in an atmosphere containing 8% carbon dioxide at a temperature of 37 ° C. Calculation of the density of the cell suspension and the proportion of living cells is carried out in the Goryaev’s chamber, when stained with trepan blue. Subcultured with a frequency of 1 time in 24-48 hours upon reaching a concentration of 1.2 × 10 ⁶ . To do this, remove the old medium by centrifugation for 5 minutes at a speed of 1200 rpm, resuspend the cell pellet with fresh medium and distribute into new Erlenmeyer flasks with a subculture ratio of 1: 6.

48 hours before transfection, cells are seeded according to the described procedure in the amount of 9 × 10 ⁶ cells per 1 flask. On the day of transfection, the proportion of living cells should be at least 95%. Cells on the day of transfection are not centrifuged diluted to a final concentration of 1.5 × 10 ⁷ cells per 30 ml of DG-44 medium in Erlenmeyer flasks. Sterile ethanol-precipitated plasmid DNA was dissolved in PBS buffer and used to obtain a transfection mixture containing 18 μg of plasmid DNA, 15 μl of the FreeStyle MAX transfection agent (Invitrogen) in 1.2 ml of Opti-Pro SFM MAX auxiliary medium (Invitrogen). The plasmid DNA used for transfection is a 20: 1 mixed plasmid pCID-PROC, linearized PvuI restriction endonuclease, and supercoiled pEGFP. The transfection mixture was gently mixed and incubated for 10-20 minutes, and then carefully added to the rotating flask containing DG-44 cells at the concentration indicated above. The fluorescent protein expressed in transfected cells is used to evaluate transfection efficiency. For this, 12 hours after transfection in the cell sample, the proportion of fluorescent cells is determined by analysis using a pair of optical EGFP filters. The resulting ratio characterizes the intensity of transient expression in transfected cells.

The present invention includes an expression vector containing a selective marker for dhfr knockout eukaryotic cells. It is known to use a dihydrofolate reductase (dhfr) gene or a dhfr gene derivative (dhfr-mix), which confers resistance to methotrexate (MTX), as a selective marker for introducing a gene or plasmid into cell lines lacking dhfr, and the subsequent use of methotrexate for copy reproduction . DG-44 cells are dhfr knockout (negative); therefore, transfectants containing the pCID-PROC plasmid with the dhfr gene sequence are selected based on the dhfr-positive phenotype, as they are able to grow in a medium lacking hypoxanthine and thymidine. Cell lines knocked out by dhfr gene and transformed with dhfr-containing plasmids can be selected based on the dhfr-positive phenotype.

To select stable transformants with the inclusion of the pCID-PROC genetic construct in the chromosomal sequence, transfected DG-44 cells were transplanted into OptiCHO medium (Invitogen), which did not contain hypoxanthine and thymidine, and cultured according to the following procedure. The density of the cell suspension and the proportion of living cells in the counting chamber of Goryaev are measured by staining with trepan blue. Then remove the old medium by centrifugation for 5 min at a speed of 1200 rpm, resuspend the cell pellet with fresh CD OptiCHO medium (Invitogen), with the addition of L-glutamine at a final concentration of 8 mM, and distribute 9 × 10 ⁶ cells into new Erlenmeyer flasks to the flask. Cells are cultured in Erlenmeyer flasks on an orbital shaker at 130 rpm in an atmosphere containing 8% carbon dioxide at a temperature of 37 ° C. Subcultured with a frequency of 1 time, in 3 days for 10-14 days until the proportion of living cells exceeds 90%. As a control, when selecting dhfr positive transfectants, cells transfected with the pOptiVec plasmid vector expressing dihydrofolate reductase without linkage of this trait to others are used. Upon reaching the percentage of living cells of 90% or more, the intermediate cell bank with samples containing 10 ⁷ cells in 1 ml of OptiCHO CD medium supplemented with 10% DMSO is frozen.

To amplify the target trait for the expression of activated protein C, selective cultivation is carried out in the presence of increasing doses of methotrexate. For this, samples from the intermediate bank are thawed according to the protocol described above with the changes that CD OptiCHO (Invitrogen) is used as the cultivation medium, with the addition of L-glutamine at a final concentration of 8 mM. Then methotrexate is added to the cultivation medium in the concentration range from 250 nM to 4 μMs by doubling the working concentration of MTX at each amplification step. The transition to the next step of amplification is carried out every 14-21 days after reaching a proportion of living cells of more than 90%. At each step of amplification, the level of expression of protein C in cell culture is determined by enzyme-linked immunosorbent assay. The producer cells of the last amplification step are cloned by the limiting dilution method and adapted to cultivation on a solid substrate.

The methods described in this example are applicable to create cell lines of producers of activated protein C based on any eukaryotic cell lines that have a genetic knockout of the dhfr- gene, both attached and suspension, as well as transformed both by the described method and using other liposomal agents as well as methods of calcium phosphate transfection, nucleofection or microinjection.

Claims (3)

1. Plasmid DNA pCID-PROC for expression of recombinant human protein C, containing the sequence of the full-length cDNA of the protein of the human C, presented in the sequence List as the sequence of SEQ ID NO: 1, wherein the plasmid is characterized by the physical map shown in figure 1. 2. The Chinese hamster ovary cell line DG-CID-PROC-1 is a producer of human recombinant protein C obtained by transforming the Chinese hamster ovary cell line DG-44 expression plasmid DNA pCID-PROC according to claim 1. 3. A method of producing a recombinant human protein C, comprising the following steps:
- cultivation in a nutrient medium of the cell line according to claim 2 - producer of recombinant human protein C; and
- isolation of the obtained target protein from the culture fluid.

Images